Starting /dee2/code/volunteer_pipeline.sh ERR10610824
    current disk space = 1549566672896
    free memory = 1365856816 
ERR10610824 SRAfilesize
ae3fe686b2f1cafc77691ca99832e73f  ERR10610824.sra
ERR10610824.sra file validated
ERR10610824 is paired end
ERR10610824 is conventional basespace
ERR10610824 read1 length is 101 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	ERR10610824_1.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	101
%GC	47
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	28.63325	32.0	27.0	33.0	18.0	33.0
2	30.5425	33.0	31.0	33.0	25.0	33.0
3	30.8585	33.0	31.0	33.0	25.0	34.0
4	30.76675	33.0	32.0	33.0	25.0	34.0
5	31.023	33.0	32.0	33.0	25.0	34.0
6	33.28575	37.0	33.0	38.0	16.0	38.0
7	33.759	37.0	33.0	38.0	16.0	38.0
8	33.14425	37.0	31.0	38.0	16.0	38.0
9	33.50075	38.0	33.0	38.0	16.0	38.0
10-11	33.85875	38.0	34.0	38.0	16.0	38.0
12-13	33.863	38.0	33.5	38.0	16.0	38.0
14-15	33.852875	38.0	33.5	38.0	16.0	38.0
16-17	33.868750000000006	38.0	33.5	38.0	16.0	38.0
18-19	34.109125	38.0	34.0	38.0	20.0	38.0
20-21	33.946625	38.0	33.5	38.0	16.0	38.0
22-23	33.988875	38.0	34.0	38.0	16.0	38.0
24-25	33.656375	38.0	33.0	38.0	20.0	38.0
26-27	33.966	38.0	34.0	38.0	20.0	38.0
28-29	34.070125000000004	38.0	34.0	38.0	16.0	38.0
30-31	34.127875	38.0	34.0	38.0	16.0	38.0
32-33	34.081125	38.0	34.0	38.0	20.0	38.0
34-35	34.304375	38.0	34.0	38.0	25.0	38.0
36-37	34.127375	38.0	34.0	38.0	20.5	38.0
38-39	34.287875	38.0	34.0	38.0	24.0	38.0
40-41	34.138625000000005	38.0	34.0	38.0	20.0	38.0
42-43	34.115875	38.0	34.0	38.0	20.5	38.0
44-45	34.27075	38.0	34.0	38.0	24.5	38.0
46-47	34.204875	38.0	34.0	38.0	20.5	38.0
48-49	34.22825	38.0	34.0	38.0	20.0	38.0
50-51	34.11725	38.0	34.0	38.0	20.0	38.0
52-53	34.116625	38.0	34.0	38.0	20.5	38.0
54-55	34.187	38.0	34.0	38.0	20.5	38.0
56-57	34.26375	38.0	34.0	38.0	24.5	38.0
58-59	33.937375	38.0	34.0	38.0	16.0	38.0
60-61	33.907375	38.0	34.0	38.0	16.0	38.0
62-63	33.894	38.0	33.5	38.0	16.0	38.0
64-65	34.182	38.0	34.0	38.0	20.5	38.0
66-67	34.15775	38.0	34.0	38.0	24.0	38.0
68-69	34.180125000000004	38.0	34.0	38.0	20.0	38.0
70-71	34.194	38.0	34.0	38.0	24.5	38.0
72-73	33.744	38.0	33.5	38.0	16.0	38.0
74-75	34.167125	38.0	34.0	38.0	24.0	38.0
76-77	33.95875	38.0	34.0	38.0	19.0	38.0
78-79	33.986125	38.0	34.0	38.0	19.5	38.0
80-81	34.051375	38.0	34.0	38.0	19.5	38.0
82-83	33.944625	38.0	34.0	38.0	15.0	38.0
84-85	34.117875	38.0	34.0	38.0	23.0	38.0
86-87	33.815875	38.0	34.0	38.0	15.5	38.0
88-89	33.571125	38.0	33.0	38.0	15.0	38.0
90-91	33.783500000000004	38.0	34.0	38.0	18.5	38.0
92-93	33.748999999999995	38.0	34.0	38.0	15.0	38.0
94-95	33.727125	38.0	34.0	38.0	15.0	38.0
96-97	33.596875	38.0	34.0	38.0	15.0	38.0
98-99	33.218125	38.0	33.0	38.0	15.0	38.0
100-101	32.367625000000004	37.0	30.0	38.0	15.0	38.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
16	1.0
17	1.0
18	8.0
19	27.0
20	39.0
21	46.0
22	44.0
23	51.0
24	74.0
25	68.0
26	83.0
27	89.0
28	118.0
29	103.0
30	140.0
31	160.0
32	190.0
33	211.0
34	293.0
35	379.0
36	667.0
37	1208.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	28.354430379746837	10.481012658227847	11.69620253164557	49.46835443037975
2	21.349999999999998	16.85	39.25	22.55
3	21.425	20.349999999999998	24.4	33.825
4	25.624999999999996	27.35	22.45	24.575
5	25.95	31.3	24.325	18.425
6	19.55	34.875	25.974999999999998	19.6
7	15.778944736184048	22.1055263815954	41.96049012253063	20.155038759689923
8	17.883941970985493	21.135567783891947	34.26713356678339	26.713356678339167
9	18.704676169042262	21.030257564391096	33.908477119279816	26.356589147286826
10-11	21.21780445111278	31.357839459864966	22.918229557389346	24.50612653163291
12-13	21.980495123780948	23.493373343335833	28.169542385596397	26.356589147286826
14-15	21.039448966812774	25.410144020037574	28.9167188478397	24.633688165309955
16-17	21.606405604904293	26.323032653571875	26.66082822469661	25.409733516827227
18-19	21.54288572143036	26.756689172293076	26.494123530882717	25.206301575393848
20-21	21.165145643205403	26.078259782472806	27.315914489311165	25.440680085010626
22-23	22.537499999999998	25.674999999999997	26.924999999999997	24.8625
24-25	21.57769721215152	26.153269158644832	27.053381672709087	25.21565195649456
26-27	20.252531566445807	26.440805100637583	27.665958244780597	25.640705088136016
28-29	21.625	26.200000000000003	25.9875	26.187500000000004
30-31	21.349999999999998	26.700000000000003	26.337500000000002	25.6125
32-33	22.15	26.3125	26.337500000000002	25.2
34-35	22.025	26.5625	26.900000000000002	24.5125
36-37	21.5625	26.674999999999997	27.1	24.6625
38-39	20.6625	26.9625	27.3375	25.0375
40-41	21.099999999999998	26.787499999999998	26.325	25.7875
42-43	21.837500000000002	26.575	26.275	25.3125
44-45	21.75	26.950000000000003	26.737499999999997	24.5625
46-47	21.875	26.650000000000002	26.6625	24.8125
48-49	21.675	25.900000000000002	26.6625	25.7625
50-51	22.025	25.974999999999998	27.3375	24.6625
52-53	21.925	26.0375	26.687499999999996	25.35
54-55	21.4875	26.1125	27.6	24.8
56-57	21.525	25.85	26.924999999999997	25.7
58-59	22.0625	26.187500000000004	26.9625	24.7875
60-61	21.9625	26.375	26.424999999999997	25.2375
62-63	21.212500000000002	25.724999999999998	27.9125	25.15
64-65	22.5	25.724999999999998	26.487500000000004	25.2875
66-67	22.5625	26.437500000000004	26.35	24.65
68-69	21.1625	27.05	25.837500000000002	25.95
70-71	22.2	26.087500000000002	25.662499999999998	26.05
72-73	21.6625	25.650000000000002	26.9125	25.775
74-75	21.9625	26.275	26.3125	25.45
76-77	21.85	26.7625	25.387500000000003	26.0
78-79	22.3625	25.224999999999998	26.450000000000003	25.9625
80-81	22.5125	26.2625	26.0125	25.2125
82-83	22.662499999999998	26.0	26.387500000000003	24.95
84-85	21.8125	26.25	25.7625	26.174999999999997
86-87	22.650000000000002	26.237500000000004	25.874999999999996	25.2375
88-89	22.825	26.325	26.1	24.75
90-91	22.9375	25.662499999999998	26.1125	25.2875
92-93	21.912499999999998	26.3625	25.95	25.775
94-95	22.325	25.412499999999998	26.8125	25.45
96-97	21.8875	26.337500000000002	26.075	25.7
98-99	21.5625	27.0125	25.525	25.900000000000002
100-101	22.875	26.787499999999998	25.474999999999998	24.8625
>>END_MODULE
>>Per sequence GC content	fail
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.0
20	0.0
21	0.0
22	0.0
23	0.0
24	0.5
25	0.5
26	0.5
27	0.5
28	1.0
29	2.5
30	6.5
31	11.5
32	15.0
33	17.5
34	21.5
35	32.0
36	46.0
37	67.0
38	88.5
39	117.5
40	171.5
41	196.0
42	195.5
43	214.5
44	221.0
45	216.5
46	210.0
47	198.0
48	180.0
49	179.5
50	191.5
51	186.5
52	179.5
53	160.0
54	132.5
55	136.5
56	130.0
57	91.0
58	76.0
59	77.5
60	65.5
61	49.0
62	37.5
63	26.5
64	19.5
65	13.0
66	5.5
67	5.5
68	5.0
69	1.0
70	0.0
71	0.0
72	0.0
73	0.0
74	0.0
75	0.0
76	0.0
77	0.0
78	0.0
79	0.0
80	0.0
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	1.25
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.025
8	0.05
9	0.025
10-11	0.025
12-13	0.025
14-15	0.1875
16-17	0.08750000000000001
18-19	0.025
20-21	0.0125
22-23	0.0
24-25	0.0125
26-27	0.0125
28-29	0.0
30-31	0.0
32-33	0.0
34-35	0.0
36-37	0.0
38-39	0.0
40-41	0.0
42-43	0.0
44-45	0.0
46-47	0.0
48-49	0.0
50-51	0.0
52-53	0.0
54-55	0.0
56-57	0.0
58-59	0.0
60-61	0.0
62-63	0.0
64-65	0.0
66-67	0.0
68-69	0.0
70-71	0.0
72-73	0.0
74-75	0.0
76-77	0.0
78-79	0.0
80-81	0.0
82-83	0.0
84-85	0.0
86-87	0.0
88-89	0.0
90-91	0.0
92-93	0.0
94-95	0.0
96-97	0.0
98-99	0.0
100-101	0.0
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
101	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	97.675
#Duplication Level	Percentage of deduplicated	Percentage of total
1	97.97798822626056	95.7
2	1.7660609163040697	3.45
3	0.15357051446122344	0.44999999999999996
4	0.10238034297414896	0.4
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	pass
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.025	0.0	0.0	0.0	0.0
62-63	0.025	0.0	0.0	0.0	0.0
64-65	0.05	0.0	0.0	0.0	0.0
66-67	0.1	0.0	0.0	0.0	0.0
68-69	0.1125	0.0	0.0	0.0	0.0
70-71	0.125	0.0	0.0	0.0	0.0
72-73	0.175	0.0	0.0	0.0	0.0
74-75	0.2375	0.0	0.0	0.0	0.0
76-77	0.30000000000000004	0.0	0.0	0.0	0.0
78-79	0.375	0.0	0.0	0.0	0.0
80-81	0.475	0.0	0.0	0.0	0.0
82-83	0.5375000000000001	0.0	0.0	0.0	0.0
84-85	0.6375	0.0	0.0	0.0	0.0
86-87	0.8375	0.0	0.0	0.0	0.0
88-89	1.1	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	pass
>>END_MODULE
ERR10610824 read2 length is 101 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	ERR10610824_2.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	101
%GC	48
>>END_MODULE
>>Per base sequence quality	pass
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	29.54075	32.0	27.0	33.0	18.0	33.0
2	29.9305	32.0	28.0	33.0	18.0	34.0
3	26.54425	30.0	18.0	33.0	18.0	33.0
4	28.6075	32.0	27.0	33.0	15.0	33.0
5	29.4725	32.0	27.0	33.0	15.0	33.0
6	26.969	29.0	16.0	37.0	15.0	38.0
7	30.5435	34.0	27.0	38.0	16.0	38.0
8	32.463	36.0	29.0	38.0	16.0	38.0
9	32.95425	37.0	31.0	38.0	16.0	38.0
10-11	33.508875	37.5	33.0	38.0	16.0	38.0
12-13	33.59675	38.0	33.0	38.0	16.0	38.0
14-15	33.7355	38.0	33.5	38.0	16.0	38.0
16-17	33.510000000000005	38.0	33.0	38.0	16.0	38.0
18-19	33.460499999999996	38.0	33.0	38.0	16.0	38.0
20-21	33.44225	38.0	33.0	38.0	16.0	38.0
22-23	33.582875	38.0	33.0	38.0	16.0	38.0
24-25	33.267875000000004	37.5	33.0	38.0	16.0	38.0
26-27	33.38075	37.5	32.0	38.0	16.0	38.0
28-29	31.67975	36.5	24.5	38.0	16.0	38.0
30-31	32.957375	37.0	30.5	38.0	16.0	38.0
32-33	33.59325	38.0	33.0	38.0	16.0	38.0
34-35	33.65625	38.0	33.0	38.0	16.0	38.0
36-37	33.213625	38.0	31.5	38.0	16.0	38.0
38-39	33.378625	38.0	33.0	38.0	16.0	38.0
40-41	33.613	38.0	33.0	38.0	16.0	38.0
42-43	33.619625	38.0	33.0	38.0	16.0	38.0
44-45	33.976749999999996	38.0	34.0	38.0	20.0	38.0
46-47	33.68925	38.0	33.5	38.0	16.0	38.0
48-49	33.88225	38.0	34.0	38.0	16.0	38.0
50-51	34.044875000000005	38.0	34.0	38.0	20.0	38.0
52-53	34.107875	38.0	34.0	38.0	20.0	38.0
54-55	33.905249999999995	38.0	34.0	38.0	16.0	38.0
56-57	33.943375	38.0	34.0	38.0	16.0	38.0
58-59	33.870625000000004	38.0	34.0	38.0	16.0	38.0
60-61	33.866875	38.0	34.0	38.0	16.0	38.0
62-63	33.793625000000006	38.0	33.5	38.0	16.0	38.0
64-65	33.766	38.0	33.5	38.0	16.0	38.0
66-67	33.810500000000005	38.0	33.5	38.0	16.0	38.0
68-69	33.9125	38.0	34.0	38.0	16.0	38.0
70-71	33.714	38.0	33.5	38.0	16.0	38.0
72-73	33.753	38.0	33.5	38.0	16.0	38.0
74-75	33.721875	38.0	33.5	38.0	16.0	38.0
76-77	33.824124999999995	38.0	34.0	38.0	16.0	38.0
78-79	33.150125	37.5	31.5	38.0	15.5	38.0
80-81	33.1945	37.5	32.5	38.0	16.0	38.0
82-83	33.1525	38.0	32.0	38.0	16.0	38.0
84-85	33.543625	38.0	33.0	38.0	15.5	38.0
86-87	33.13275	37.5	32.0	38.0	15.0	38.0
88-89	33.391125	38.0	33.0	38.0	15.0	38.0
90-91	33.160375	38.0	32.0	38.0	15.0	38.0
92-93	33.30875	38.0	33.0	38.0	15.0	38.0
94-95	33.263125	38.0	33.0	38.0	15.0	38.0
96-97	33.311125000000004	38.0	33.0	38.0	15.0	38.0
98-99	33.11775	38.0	32.0	38.0	15.0	38.0
100-101	31.249499999999998	36.0	28.0	37.5	15.0	38.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
17	15.0
18	35.0
19	37.0
20	48.0
21	46.0
22	35.0
23	86.0
24	75.0
25	69.0
26	85.0
27	106.0
28	116.0
29	132.0
30	140.0
31	182.0
32	208.0
33	235.0
34	353.0
35	396.0
36	708.0
37	893.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	30.65	14.6	13.850000000000001	40.9
2	27.950000000000003	21.725	32.574999999999996	17.75
3	19.05	23.45	34.675	22.825
4	26.974999999999998	30.325000000000003	20.25	22.45
5	27.200000000000003	32.975	20.775	19.05
6	19.6	33.925	26.174999999999997	20.3
7	21.825	16.950000000000003	39.0	22.225
8	23.400000000000002	22.225	27.224999999999998	27.150000000000002
9	23.375	23.575	28.549999999999997	24.5
10-11	27.3875	29.5	20.5375	22.575
12-13	26.090761345168147	22.802850356294538	25.30316289536192	25.803225403175396
14-15	25.575	26.5125	25.8125	22.1
16-17	26.450000000000003	25.4625	24.212500000000002	23.875
18-19	25.674999999999997	26.087500000000002	25.337500000000002	22.900000000000002
20-21	26.400000000000002	26.8375	24.3875	22.375
22-23	26.525	26.0625	24.7375	22.675
24-25	25.424999999999997	26.55	25.174999999999997	22.85
26-27	25.900000000000002	26.437500000000004	25.124999999999996	22.537499999999998
28-29	26.55	26.075	25.224999999999998	22.15
30-31	25.3125	27.537499999999998	24.2375	22.912499999999998
32-33	26.275	26.437500000000004	24.175	23.1125
34-35	25.431357839459867	25.906476619154787	24.968742185546386	23.69342335583896
36-37	25.56739811912226	26.244514106583072	25.61755485893417	22.570532915360502
38-39	25.647117669125922	27.872952357133922	24.934350381393024	21.54557959234713
40-41	26.463231615807903	26.18809404702351	24.899949974987493	22.448724362181093
42-43	25.431197280624453	26.325066095933526	25.783708926098452	22.460027697343573
44-45	25.83791895947974	26.713356678339167	24.787393696848426	22.661330665332667
46-47	26.394284998120064	26.644942975310187	24.752475247524753	22.208296779044993
48-49	26.094023505876468	25.63140785196299	26.219054763690924	22.05551387846962
50-51	25.1875	27.212500000000002	25.900000000000002	21.7
52-53	26.2125	26.1125	25.124999999999996	22.55
54-55	25.2	26.2875	26.1	22.412499999999998
56-57	25.1	26.450000000000003	25.8	22.650000000000002
58-59	25.30316289536192	26.615826978372297	25.55319414926866	22.527815976997125
60-61	25.418854713678417	26.78169542385596	26.03150787696924	21.767941985496375
62-63	24.93123280820205	26.694173543385848	25.806451612903224	22.568142035508878
64-65	25.853231653956744	26.540817602200274	25.240655081885237	22.365295661957745
66-67	25.4875	26.2625	26.1625	22.0875
68-69	25.4625	26.1	25.05	23.3875
70-71	26.006501625406354	26.39409852463116	25.481370342585645	22.118029507376843
72-73	26.128266033254157	26.003250406300786	26.090761345168147	21.77772221527691
74-75	25.387500000000003	27.700000000000003	26.05	20.8625
76-77	25.728216027003377	26.428303537942245	25.278159769971246	22.565320665083135
78-79	25.965745718214777	25.440680085010626	26.67833479184898	21.915239404925615
80-81	25.381345336334082	27.406851712928233	25.731432858214554	21.48037009252313
82-83	25.528191023877984	25.90323790473809	26.62832854106763	21.94024253031629
84-85	25.85646411602901	26.331582895723933	25.868967241810452	21.94298574643661
86-87	25.79394848712178	26.19404851212803	26.131532883220803	21.880470117529384
88-89	26.056514128532132	25.831457864466117	26.319079769942487	21.792948237059264
90-91	24.962500000000002	27.212500000000002	25.937500000000004	21.8875
92-93	24.25	27.3	26.35	22.1
94-95	25.8125	26.5	25.2875	22.400000000000002
96-97	25.21565195649456	26.903362920365048	24.928116014501814	22.95286910863858
98-99	26.237500000000004	26.5375	26.0	21.224999999999998
100-101	26.075	26.674999999999997	25.4875	21.762500000000003
>>END_MODULE
>>Per sequence GC content	warn
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.0
16	0.0
17	0.0
18	0.0
19	0.0
20	0.0
21	0.0
22	0.0
23	0.0
24	0.0
25	0.0
26	0.0
27	0.0
28	0.5
29	0.5
30	1.0
31	2.0
32	4.0
33	13.0
34	19.5
35	24.0
36	42.5
37	64.0
38	74.5
39	88.0
40	128.0
41	160.5
42	173.5
43	196.0
44	207.0
45	211.0
46	218.5
47	222.0
48	218.5
49	194.0
50	167.5
51	187.0
52	192.0
53	164.5
54	167.5
55	153.0
56	141.5
57	121.0
58	90.5
59	76.0
60	65.5
61	64.0
62	46.0
63	36.5
64	26.0
65	11.5
66	10.0
67	8.0
68	6.0
69	3.5
70	0.0
71	0.0
72	0.0
73	0.0
74	0.0
75	0.0
76	0.0
77	0.0
78	0.0
79	0.0
80	0.0
81	0.0
82	0.0
83	0.0
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-11	0.0
12-13	0.0125
14-15	0.0
16-17	0.0
18-19	0.0
20-21	0.0
22-23	0.0
24-25	0.0
26-27	0.0
28-29	0.0
30-31	0.0
32-33	0.0
34-35	0.025
36-37	0.3125
38-39	0.0375
40-41	0.05
42-43	0.7125
44-45	0.05
46-47	0.2625
48-49	0.025
50-51	0.0
52-53	0.0
54-55	0.0
56-57	0.0
58-59	0.0125
60-61	0.025
62-63	0.025
64-65	0.0125
66-67	0.0
68-69	0.0
70-71	0.025
72-73	0.0125
74-75	0.0
76-77	0.0125
78-79	0.0125
80-81	0.025
82-83	0.0125
84-85	0.025
86-87	0.025
88-89	0.025
90-91	0.0
92-93	0.0
94-95	0.0
96-97	0.0125
98-99	0.0
100-101	0.0
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
101	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	99.075
#Duplication Level	Percentage of deduplicated	Percentage of total
1	99.21776431995963	98.3
2	0.6560686348725713	1.3
3	0.10093363613424174	0.3
4	0.025233409033560434	0.1
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	pass
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.025	0.0	0.0	0.0	0.0
62-63	0.025	0.0	0.0	0.0	0.0
64-65	0.05	0.0	0.0	0.0	0.0
66-67	0.1	0.0	0.0	0.0	0.0
68-69	0.1125	0.0	0.0	0.0	0.0
70-71	0.125	0.0	0.0	0.0	0.0
72-73	0.175	0.0	0.0	0.0	0.0
74-75	0.2375	0.0	0.0	0.0	0.0
76-77	0.30000000000000004	0.0	0.0	0.0	0.0
78-79	0.375	0.0	0.0	0.0	0.0
80-81	0.475	0.0	0.0	0.0	0.0
82-83	0.5375000000000001	0.0	0.0	0.0	0.0
84-85	0.6375	0.0	0.0	0.0	0.0
86-87	0.8375	0.0	0.0	0.0	0.0
88-89	1.1	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	pass
>>END_MODULE
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163303 spots for ERR10610824.sra
Written 163303 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
Read 163288 spots for ERR10610824.sra
Written 163288 spots for ERR10610824.sra
SRR ids: ['ERR10610824.sra']
extra args: ['--split-files', '--defline-qual', '+']
tempdir: /tmp/pfd_k4we9mje
ERR10610824.sra spots: 3265775
blocks: [[1, 163288], [163289, 326576], [326577, 489864], [489865, 653152], [653153, 816440], [816441, 979728], [979729, 1143016], [1143017, 1306304], [1306305, 1469592], [1469593, 1632880], [1632881, 1796168], [1796169, 1959456], [1959457, 2122744], [2122745, 2286032], [2286033, 2449320], [2449321, 2612608], [2612609, 2775896], [2775897, 2939184], [2939185, 3102472], [3102473, 3265775]]
ERR10610824 file size 782382
ERR10610824 completed basic pipeline successfully
skewer v0.2.2 [April 4, 2016]
COMMAND LINE:	skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610824 ERR10610824_1.fastq ERR10610824_2.fastq
Input file:	ERR10610824_1.fastq
Paired file:	ERR10610824_2.fastq
trimmed:	ERR10610824-trimmed-pair1.fastq, ERR10610824-trimmed-pair2.fastq

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- end quality threshold (-q):		10
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ 
-- number of concurrent threads (-t):	20
Fri Dec  6 20:18:28 2024 >> started

Fri Dec  6 20:18:31 2024 >> done (2.929s)
3265775 read pairs processed; of these:
     10 ( 0.00%) short read pairs filtered out after trimming by size control
    242 ( 0.01%) empty read pairs filtered out after trimming by size control
3265523 (99.99%) read pairs available; of these:
 113159 ( 3.47%) trimmed read pairs available after processing
3152364 (96.53%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 18	      1	  0.00%
 19	      0	  0.00%
 20	      0	  0.00%
 21	      0	  0.00%
 22	      0	  0.00%
 23	      0	  0.00%
 24	      0	  0.00%
 25	      0	  0.00%
 26	      1	  0.00%
 27	      3	  0.00%
 28	      0	  0.00%
 29	      1	  0.00%
 30	      1	  0.00%
 31	      5	  0.00%
 32	      2	  0.00%
 33	      2	  0.00%
 34	      5	  0.00%
 35	      4	  0.00%
 36	      5	  0.00%
 37	      5	  0.00%
 38	      6	  0.00%
 39	     11	  0.00%
 40	     12	  0.00%
 41	     15	  0.00%
 42	      4	  0.00%
 43	     15	  0.00%
 44	     24	  0.00%
 45	     19	  0.00%
 46	     17	  0.00%
 47	     30	  0.00%
 48	     28	  0.00%
 49	     29	  0.00%
 50	     37	  0.00%
 51	     47	  0.00%
 52	     38	  0.00%
 53	     61	  0.00%
 54	     76	  0.00%
 55	     82	  0.00%
 56	     88	  0.00%
 57	     93	  0.00%
 58	    107	  0.00%
 59	    121	  0.00%
 60	    133	  0.00%
 61	    159	  0.00%
 62	    151	  0.00%
 63	    206	  0.01%
 64	    191	  0.01%
 65	    239	  0.01%
 66	    274	  0.01%
 67	    285	  0.01%
 68	    319	  0.01%
 69	    375	  0.01%
 70	    455	  0.01%
 71	    513	  0.02%
 72	    529	  0.02%
 73	    603	  0.02%
 74	    719	  0.02%
 75	    742	  0.02%
 76	    913	  0.03%
 77	    989	  0.03%
 78	   1168	  0.04%
 79	   1281	  0.04%
 80	   1420	  0.04%
 81	   1609	  0.05%
 82	   1760	  0.05%
 83	   2051	  0.06%
 84	   2311	  0.07%
 85	   2554	  0.08%
 86	   2910	  0.09%
 87	   3114	  0.10%
 88	   3601	  0.11%
 89	   3827	  0.12%
 90	   4268	  0.13%
 91	   4781	  0.15%
 92	   5265	  0.16%
 93	   5589	  0.17%
 94	   6203	  0.19%
 95	   6807	  0.21%
 96	   7313	  0.22%
 97	   8194	  0.25%
 98	   8589	  0.26%
 99	   9593	  0.29%
100	  10161	  0.31%
101	3152364	 96.53%
3265523 reads passed initial QC


criterion=sequence-density
sequence-density=0.35
sequence-density-rank=1
fanout-score=1.99
fanout-score-rank=27
prefix-density=0.34
prefix-fanout=2.0
sequence=TTCAAATGTACA


criterion=fanout-score
sequence-density=0.01
sequence-density-rank=36
fanout-score=13.52
fanout-score-rank=1
prefix-density=0.03
prefix-fanout=2.4
sequence=CCTGATCTGAAACAGATTTATTTAAAACAGTAAGATGATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCACCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGTTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG


criterion=sequence-density
sequence-density=0.29
sequence-density-rank=1
fanout-score=2.32
fanout-score-rank=21
prefix-density=0.30
prefix-fanout=2.2
sequence=GGTGGTGCATGGC


criterion=fanout-score
sequence-density=0.04
sequence-density-rank=31
fanout-score=28.36
fanout-score-rank=1
prefix-density=0.20
prefix-fanout=6.5
sequence=AAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCACTCATCCGTGACGGTCGTATGGAGAAGTTCTACTGGGCCCCCACCCGCGAAGACCGTATCGGTGTCTGCAGGGGTATCTTCCAAACTGACAACATCAGCGACGAGTCCGTCATCAAGATCGTAGACACCTTCCCAGGCCAATCCATCGACTTTTTCGGAGCGCTGCGTGCCCGGGTGTACGACGATGAGGTGCGCAAGTGGGTCAGCTCAACCGGAATAGAGAACATCGGCAAGAAGCTGGTGAACTCGAAGGATGGACCGGTGTCCTTTGAGCAGCCAAAGATGACAATCGAGAAGCTCCTGGAGTACGGCCACATGCTCGTCCAAGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACAAGTACATGAGCGAGGCTGCTCTGGGAGATGCTAACTCAGATGCCATGAAGACTGGTTCCTTCTACGGTTAGAACACTCTTC
ERR10610824 testing PE reads STAR mapping to Ensembl genome
                                 Started job on |	Dec 06 20:19:26
                             Started mapping on |	Dec 06 20:19:26
                                    Finished on |	Dec 06 20:19:58
       Mapping speed, Million of reads per hour |	367.37

                          Number of input reads |	3265523
                      Average input read length |	193
                                    UNIQUE READS:
                   Uniquely mapped reads number |	2582697
                        Uniquely mapped reads % |	79.09%
                          Average mapped length |	192.13
                       Number of splices: Total |	1392739
            Number of splices: Annotated (sjdb) |	1283320
                       Number of splices: GT/AG |	1367514
                       Number of splices: GC/AG |	16065
                       Number of splices: AT/AC |	494
               Number of splices: Non-canonical |	8666
                      Mismatch rate per base, % |	0.85%
                         Deletion rate per base |	0.02%
                        Deletion average length |	2.26
                        Insertion rate per base |	0.01%
                       Insertion average length |	1.82
                             MULTI-MAPPING READS:
        Number of reads mapped to multiple loci |	239588
             % of reads mapped to multiple loci |	7.34%
        Number of reads mapped to too many loci |	20303
             % of reads mapped to too many loci |	0.62%
                                  UNMAPPED READS:
       % of reads unmapped: too many mismatches |	0.00%
                 % of reads unmapped: too short |	9.77%
                     % of reads unmapped: other |	3.18%
                                  CHIMERIC READS:
                       Number of chimeric reads |	0
                            % of chimeric reads |	0.00%
N_unmapped	443238	443238	443238
N_multimapping	239588	239588	239588
N_noFeature	153453	2501619	169038
N_ambiguous	77665	273	12528
UnstrandedReadsAssigned:2351579 PositiveStrandReadsAssigned:80805 NegativeStrandReadsAssigned:2401131
Dataset is classified negative stranded
MeadianReadLen=101 20thPercentileLength=101 echo kmer=97
ERR10610824 Starting Kallisto paired end mapping to ensembl reference transcriptome

[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 52,972
[index] number of k-mers: 66,720,672
[index] number of equivalence classes: 111,837
[quant] running in paired-end mode
[quant] will process pair 1: ERR10610824-trimmed-pair1.fastq
                             ERR10610824-trimmed-pair2.fastq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 3,265,523 reads, 2,612,692 reads pseudoaligned
[quant] estimated average fragment length: 161.731
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 1,066 rounds

  52973 ERR10610824.ke.tsv
  35125 ERR10610824.se.tsv
  88098 total
==> ERR10610824.ke.tsv <==
target_id	length	eff_length	est_counts	tpm
PNS24245	936	775.369	2.98771e-08	2.14105e-08
PNS24247	1044	883.269	6.28884	3.95615
PNS24249	1928	1767.27	0	0
PNS24246	1044	883.269	6.28884	3.95615
PNS24248	1044	883.269	6.28884	3.95615
PNS24244	1471	1310.27	20.1335	8.53794
PNS24243	293	138.753	0	0
KQK14069	1603	1442.27	78	30.0499
KQK14071	474	314.508	1	1.7667

==> ERR10610824.se.tsv <==
BRADI_1g14170v3	74
BRADI_1g53295v3	46
BRADI_1g59795v3	67
BRADI_1g07683v3	0
BRADI_1g00485v3	0
BRADI_1g20270v3	64
BRADI_1g74790v3	7
BRADI_1g09890v3	0
BRADI_1g77505v3	57
BRADI_1g48960v3	0
ERR10610824 completed mapping pipeline successfully
