Starting /dee2/code/volunteer_pipeline.sh ERR10610825 current disk space = 1549540069376 free memory = 1599708428 ERR10610825 SRAfilesize 96c72230202550b536e9709321ac0abf ERR10610825.sra ERR10610825.sra file validated ERR10610825 is paired end ERR10610825 is conventional basespace ERR10610825 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610825_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.34825 32.0 30.0 33.0 18.0 34.0 2 32.46875 33.0 33.0 33.0 32.0 34.0 3 32.66725 33.0 33.0 34.0 31.0 34.0 4 33.002 34.0 33.0 34.0 32.0 34.0 5 33.1225 34.0 33.0 34.0 32.0 34.0 6 36.662 38.0 37.0 38.0 34.0 38.0 7 37.082 38.0 38.0 38.0 36.0 38.0 8 37.18475 38.0 38.0 38.0 37.0 38.0 9 37.24325 38.0 38.0 38.0 37.0 38.0 10-11 37.18825 38.0 38.0 38.0 37.0 38.0 12-13 37.15375 38.0 38.0 38.0 37.0 38.0 14-15 37.122625 38.0 38.0 38.0 37.0 38.0 16-17 37.17125 38.0 38.0 38.0 37.0 38.0 18-19 37.169125 38.0 38.0 38.0 37.0 38.0 20-21 37.191 38.0 38.0 38.0 37.0 38.0 22-23 37.1485 38.0 38.0 38.0 37.0 38.0 24-25 37.156499999999994 38.0 38.0 38.0 37.0 38.0 26-27 37.14475 38.0 38.0 38.0 37.0 38.0 28-29 37.16925 38.0 38.0 38.0 37.0 38.0 30-31 37.137 38.0 38.0 38.0 37.0 38.0 32-33 37.142250000000004 38.0 38.0 38.0 37.0 38.0 34-35 37.1465 38.0 38.0 38.0 37.0 38.0 36-37 37.09675 38.0 38.0 38.0 37.0 38.0 38-39 37.1355 38.0 38.0 38.0 37.0 38.0 40-41 37.128125 38.0 38.0 38.0 37.0 38.0 42-43 37.148250000000004 38.0 38.0 38.0 37.0 38.0 44-45 37.1115 38.0 38.0 38.0 37.0 38.0 46-47 37.122625 38.0 38.0 38.0 37.0 38.0 48-49 37.067875 38.0 38.0 38.0 37.0 38.0 50-51 36.911874999999995 38.0 38.0 38.0 36.5 38.0 52-53 36.823875 38.0 38.0 38.0 36.0 38.0 54-55 36.784625000000005 38.0 38.0 38.0 36.0 38.0 56-57 36.91375 38.0 38.0 38.0 35.5 38.0 58-59 37.039625 38.0 38.0 38.0 36.0 38.0 60-61 37.063625 38.0 38.0 38.0 36.0 38.0 62-63 37.025999999999996 38.0 38.0 38.0 36.0 38.0 64-65 36.906625000000005 38.0 38.0 38.0 36.0 38.0 66-67 36.917500000000004 38.0 38.0 38.0 36.0 38.0 68-69 37.00375 38.0 38.0 38.0 36.0 38.0 70-71 36.996375 38.0 38.0 38.0 36.0 38.0 72-73 36.92725 38.0 38.0 38.0 36.0 38.0 74-75 37.026624999999996 38.0 38.0 38.0 36.0 38.0 76-77 36.92325 38.0 38.0 38.0 36.0 38.0 78-79 36.9475 38.0 38.0 38.0 36.0 38.0 80-81 37.030874999999995 38.0 38.0 38.0 36.0 38.0 82-83 36.99075 38.0 38.0 38.0 36.0 38.0 84-85 36.944625 38.0 38.0 38.0 36.0 38.0 86-87 36.983000000000004 38.0 38.0 38.0 36.0 38.0 88-89 36.910124999999994 38.0 38.0 38.0 36.0 38.0 90-91 36.749125 38.0 38.0 38.0 36.0 38.0 92-93 36.721125 38.0 38.0 38.0 35.5 38.0 94-95 36.653875 38.0 38.0 38.0 35.5 38.0 96-97 36.567499999999995 38.0 38.0 38.0 35.0 38.0 98-99 36.535125 38.0 38.0 38.0 35.0 38.0 100-101 36.318 38.0 37.5 38.0 34.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 4.0 20 7.0 21 7.0 22 11.0 23 5.0 24 14.0 25 15.0 26 15.0 27 18.0 28 24.0 29 29.0 30 32.0 31 38.0 32 48.0 33 65.0 34 70.0 35 120.0 36 278.0 37 3198.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.275 9.825000000000001 11.0 50.9 2 20.424999999999997 17.224999999999998 39.300000000000004 23.05 3 20.875 19.425 24.5 35.199999999999996 4 24.474999999999998 30.275000000000002 20.775 24.474999999999998 5 24.975 31.1 24.325 19.6 6 19.35 33.375 26.55 20.724999999999998 7 15.275 21.975 43.525000000000006 19.225 8 19.175 22.55 32.05 26.224999999999998 9 18.95 21.0 33.775 26.275 10-11 22.725 30.8125 21.725 24.7375 12-13 21.9625 24.1875 26.787499999999998 27.0625 14-15 20.849999999999998 26.2125 27.712500000000002 25.224999999999998 16-17 22.037499999999998 26.200000000000003 25.825 25.937500000000004 18-19 21.1375 26.7625 25.924999999999997 26.174999999999997 20-21 21.925 25.7 27.462500000000002 24.9125 22-23 21.712500000000002 26.5125 26.35 25.424999999999997 24-25 23.0625 25.4875 26.6125 24.837500000000002 26-27 21.95 26.150000000000002 25.9875 25.912499999999998 28-29 21.3625 27.2625 25.55 25.825 30-31 21.625 25.7125 26.35 26.3125 32-33 21.712500000000002 26.2625 25.874999999999996 26.150000000000002 34-35 21.7875 26.0375 26.4125 25.7625 36-37 22.05 25.724999999999998 26.724999999999998 25.5 38-39 22.175 26.25 25.887500000000003 25.687500000000004 40-41 22.3625 26.3 25.624999999999996 25.7125 42-43 21.8125 25.637500000000003 26.737499999999997 25.8125 44-45 22.225 26.2125 26.375 25.1875 46-47 22.3125 26.337500000000002 25.85 25.5 48-49 21.53865430397193 26.337551685252475 26.600676606941487 25.523117403834107 50-51 22.071563088512242 26.026365348399246 26.716886377903325 25.185185185185183 52-53 22.02343454705808 25.828398639284366 26.546554113644955 25.6016127000126 54-55 21.975122502826988 25.744440256313606 26.020856891569295 26.25958034929011 56-57 21.441080810607957 26.51988991743808 26.80760570427821 25.23142356767576 58-59 21.975 25.7125 27.3 25.0125 60-61 22.7125 25.825 25.362499999999997 26.1 62-63 22.05 25.7375 27.3375 24.875 64-65 22.985336508334377 24.965534528136356 25.930567740318335 26.11856122321093 66-67 21.8304576144036 26.281570392598148 25.98149537384346 25.906476619154787 68-69 22.753441802252816 25.56946182728411 25.60700876095119 26.070087609511887 70-71 22.5125 26.275 26.0375 25.174999999999997 72-73 22.7 25.4375 25.937500000000004 25.924999999999997 74-75 22.9875 25.4 26.1125 25.5 76-77 22.825 25.7375 26.375 25.0625 78-79 22.0625 26.2875 25.75 25.900000000000002 80-81 22.525000000000002 26.025 25.912499999999998 25.5375 82-83 23.0625 26.7125 25.7375 24.4875 84-85 22.912499999999998 25.3125 26.05 25.724999999999998 86-87 22.5125 24.85 26.4125 26.224999999999998 88-89 22.648824412206103 25.137568784392194 26.513256628314156 25.700350175087543 90-91 23.04211187932118 25.279698302954117 25.83280955373979 25.845380263984914 92-93 23.86277959286253 24.579039959788894 25.998994722292036 25.559185725056548 94-95 23.023752670604498 24.97172301118512 25.901721754430064 26.10280256378032 96-97 21.912802419354836 25.60483870967742 25.27721774193548 27.205141129032256 98-99 22.931143398610235 25.57169930511687 25.559065066329755 25.938092229943145 100-101 23.107920916761113 25.802795617680392 25.324266465180706 25.76501700037779 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.5 27 0.5 28 1.0 29 3.5 30 4.0 31 8.0 32 12.0 33 16.5 34 28.0 35 32.0 36 46.0 37 68.5 38 77.5 39 90.0 40 119.0 41 148.5 42 173.5 43 192.5 44 210.5 45 216.5 46 211.5 47 210.0 48 202.5 49 214.0 50 208.0 51 175.0 52 154.5 53 145.0 54 152.5 55 162.0 56 155.0 57 125.0 58 94.5 59 79.0 60 64.5 61 59.5 62 50.0 63 33.0 64 23.5 65 14.0 66 7.5 67 5.5 68 3.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.2375 50-51 0.43750000000000006 52-53 0.7875 54-55 0.5125000000000001 56-57 0.075 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.2625 66-67 0.025 68-69 0.125 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.05 90-91 0.5625 92-93 0.525 94-95 0.5375 96-97 0.8 98-99 1.0625 100-101 0.7374999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.65 #Duplication Level Percentage of deduplicated Percentage of total 1 97.25814795654422 94.0 2 2.2503879979306776 4.35 3 0.3362648732540093 0.975 4 0.10346611484738748 0.4 5 0.02586652871184687 0.125 6 0.02586652871184687 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 6 0.15 No Hit CTCAGTGTCAGTGTCGGCCCAGCAGAGTGCTTTCGCCGTTGGTGTTCTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5625 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGGCA 15 0.009569117 47.97468 50-51 >>END_MODULE ERR10610825 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610825_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.697 33.0 33.0 34.0 32.0 34.0 2 32.6435 33.0 33.0 34.0 31.0 34.0 3 32.727 34.0 33.0 34.0 32.0 34.0 4 32.6735 34.0 33.0 34.0 32.0 34.0 5 32.71175 34.0 33.0 34.0 32.0 34.0 6 36.40875 38.0 38.0 38.0 35.0 38.0 7 36.26125 38.0 38.0 38.0 35.0 38.0 8 2.0 2.0 2.0 2.0 2.0 2.0 9 28.95925 30.0 30.0 31.0 27.0 31.0 10-11 23.4255 22.5 22.5 23.0 21.5 30.0 12-13 31.284875 33.0 31.5 34.0 28.0 34.0 14-15 35.27875 38.0 37.5 38.0 30.0 38.0 16-17 35.43725 38.0 38.0 38.0 33.0 38.0 18-19 35.634874999999994 38.0 38.0 38.0 33.0 38.0 20-21 35.43325 38.0 38.0 38.0 32.5 38.0 22-23 35.548500000000004 38.0 38.0 38.0 33.5 38.0 24-25 35.528000000000006 38.0 38.0 38.0 33.0 38.0 26-27 35.532375 38.0 38.0 38.0 33.0 38.0 28-29 35.52775 38.0 38.0 38.0 33.0 38.0 30-31 35.32825 38.0 38.0 38.0 32.0 38.0 32-33 35.30475 38.0 38.0 38.0 32.0 38.0 34-35 35.53025 38.0 38.0 38.0 33.0 38.0 36-37 35.780249999999995 38.0 38.0 38.0 33.0 38.0 38-39 35.784375 38.0 38.0 38.0 33.0 38.0 40-41 35.68275 38.0 38.0 38.0 33.5 38.0 42-43 35.653875 38.0 38.0 38.0 33.5 38.0 44-45 35.736125 38.0 38.0 38.0 33.5 38.0 46-47 35.8315 38.0 38.0 38.0 34.0 38.0 48-49 35.896874999999994 38.0 38.0 38.0 34.0 38.0 50-51 36.1215 38.0 38.0 38.0 34.0 38.0 52-53 36.341625 38.0 38.0 38.0 34.0 38.0 54-55 36.464 38.0 38.0 38.0 35.0 38.0 56-57 36.521625 38.0 38.0 38.0 35.0 38.0 58-59 36.516375 38.0 38.0 38.0 35.0 38.0 60-61 36.46875 38.0 38.0 38.0 35.0 38.0 62-63 36.474375 38.0 38.0 38.0 35.0 38.0 64-65 36.50625 38.0 38.0 38.0 35.0 38.0 66-67 36.4925 38.0 38.0 38.0 35.0 38.0 68-69 36.412125 38.0 38.0 38.0 35.0 38.0 70-71 36.248000000000005 38.0 38.0 38.0 34.0 38.0 72-73 36.171499999999995 38.0 38.0 38.0 34.0 38.0 74-75 35.992875 38.0 38.0 38.0 34.0 38.0 76-77 35.974375 38.0 38.0 38.0 33.5 38.0 78-79 35.953 38.0 38.0 38.0 34.0 38.0 80-81 35.881 38.0 38.0 38.0 33.0 38.0 82-83 35.931 38.0 38.0 38.0 33.0 38.0 84-85 35.968875 38.0 38.0 38.0 34.0 38.0 86-87 35.980125 38.0 38.0 38.0 34.0 38.0 88-89 35.82225 38.0 38.0 38.0 33.5 38.0 90-91 35.711 38.0 38.0 38.0 33.0 38.0 92-93 35.631625 38.0 38.0 38.0 32.0 38.0 94-95 35.596125 38.0 38.0 38.0 32.5 38.0 96-97 35.553124999999994 38.0 38.0 38.0 32.5 38.0 98-99 35.468500000000006 38.0 38.0 38.0 32.0 38.0 100-101 34.83775 38.0 36.5 38.0 28.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 1.0 5 2.0 6 10.0 7 3.0 8 9.0 9 9.0 10 10.0 11 10.0 12 2.0 13 4.0 14 3.0 15 3.0 16 8.0 17 7.0 18 17.0 19 22.0 20 10.0 21 24.0 22 17.0 23 18.0 24 18.0 25 19.0 26 23.0 27 26.0 28 37.0 29 34.0 30 49.0 31 50.0 32 67.0 33 78.0 34 122.0 35 244.0 36 2673.0 37 358.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.74937343358396 14.862155388471177 13.659147869674184 41.72932330827068 2 28.542763982944567 21.419613744670176 33.13268121394532 16.904941058439928 3 22.523200401304237 25.608226736894906 26.235264609982444 25.63330825181841 4 26.56132430398796 32.129420617005266 19.48833709556057 21.8209179834462 5 28.299046663321626 33.06573005519318 18.941294530858002 19.693928750627197 6 22.823886639676115 35.77935222672065 21.052631578947366 20.344129554655872 7 22.5765306122449 17.270408163265305 36.147959183673464 24.005102040816325 8 NaN NaN NaN NaN 9 23.958066990539503 22.47507031449757 27.946816670928154 25.620046024034774 10-11 24.145380607446942 29.49548862625492 20.35836828059474 26.000762485703394 12-13 26.48628048780488 24.148882113821138 24.568089430894307 24.796747967479675 14-15 25.82935329805086 25.868077965664128 24.951594165483414 23.3509745708016 16-17 27.69390942217595 25.53357626236335 23.03487766788131 23.737636647579386 18-19 26.049222797927463 27.24093264248705 23.49740932642487 23.212435233160623 20-21 27.037229888049986 26.67274147357459 23.90002603488675 22.390002603488675 22-23 25.97301504929943 27.270368448365335 23.91022314478464 22.846393357550596 24-25 25.835392016642828 25.601352229879083 24.977246131842413 23.58600962163568 26-27 26.748115414608787 25.5913698986223 24.49961008578113 23.160904600987784 28-29 26.474033580632568 25.57594689574385 24.326434986333464 23.62358453729012 30-31 26.18020138616451 25.513273179024452 24.728651758859684 23.577873675951352 32-33 25.93125081688668 26.27107567638217 24.33668801463861 23.460985492092536 34-35 26.55946051095837 26.105563480741793 24.147322007521723 23.18765400077811 36-37 25.838796760509062 25.92878261987402 24.051934695976346 24.18048592364057 38-39 24.556213017751478 27.231798302032416 25.109338821713408 23.1026498585027 40-41 26.67097608274079 25.95992243051067 24.16289592760181 23.206205559146735 42-43 25.49248315189217 26.08864696734059 25.505443234836704 22.913426645930535 44-45 25.778122174867622 26.268888027896164 25.10654784967067 22.846441947565545 46-47 25.86917331959825 26.371362348699463 24.980685037342262 22.778779294360028 48-49 26.557882564563794 26.185275600668124 24.20660413722215 23.050237697545935 50-51 25.737913486005088 26.24681933842239 25.06361323155216 22.951653944020357 52-53 27.309490711487427 25.75508656640971 24.175407557184382 22.76001516491849 54-55 24.921294547286234 27.364311799521474 25.462788061956932 22.25160559123536 56-57 25.812547241118672 26.429831191735953 25.573192239858905 22.18442932728647 58-59 25.598387503149407 25.913328294280674 25.207860922146637 23.28042328042328 60-61 25.535399344923153 25.648778029730412 25.346434870244394 23.46938775510204 62-63 26.68178382464097 26.039304610733183 24.993701184177375 22.285210380448476 64-65 26.34828629032258 25.89465725806452 25.352822580645164 22.40423387096774 66-67 25.633270321361056 25.94833018273472 25.507246376811594 22.911153119092628 68-69 25.313092979127134 26.325110689437064 25.363693864642634 22.99810246679317 70-71 24.863630597488264 26.3097805404034 25.85310161106178 22.973487251046556 72-73 26.62007623888183 24.930114358322744 25.794155019059723 22.655654383735705 74-75 25.681528662420384 25.770700636942674 26.611464968152866 21.936305732484076 76-77 25.716834459028924 27.18236268637696 24.518924429718364 22.581878424875747 78-79 26.24984017389081 24.9200869454034 26.21148190768444 22.61859097302135 80-81 25.947670708359922 27.083599234205487 24.543714103382257 22.42501595405233 82-83 25.512412476129853 27.040101845957988 25.512412476129853 21.935073201782306 84-85 25.439714504205963 26.726994646953862 25.452459852153964 22.38083099668621 86-87 25.644297014544527 26.70324062260781 25.924980862464913 21.72748150038275 88-89 25.281473899692937 26.63766632548618 26.023541453428862 22.057318321392017 90-91 25.76379974326059 26.82926829268293 26.12323491655969 21.28369704749679 92-93 26.163312395846688 26.778618125881298 25.33008588642482 21.7279835918472 94-95 26.5887790473745 26.344845294646298 24.971113108229552 22.09526254974965 96-97 26.04381443298969 26.224226804123713 25.36082474226804 22.37113402061856 98-99 26.41558106539404 26.157616406552304 25.78356765123178 21.643234876821875 100-101 27.214045959204753 26.1425251742835 25.058094500387295 21.58533436612445 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 6.0 2 3.0 3 0.5 4 0.5 5 2.0 6 3.5 7 4.5 8 2.5 9 2.0 10 4.5 11 7.0 12 7.5 13 6.0 14 6.5 15 6.0 16 4.0 17 2.0 18 1.0 19 1.5 20 3.5 21 4.0 22 2.5 23 3.0 24 4.5 25 4.5 26 4.0 27 3.5 28 2.0 29 6.0 30 11.5 31 9.5 32 10.5 33 14.5 34 20.0 35 26.0 36 34.0 37 50.0 38 74.5 39 97.0 40 114.5 41 142.5 42 163.5 43 170.0 44 192.0 45 213.5 46 206.0 47 205.0 48 217.0 49 204.0 50 176.0 51 168.0 52 165.0 53 163.5 54 159.0 55 144.0 56 135.0 57 129.0 58 116.5 59 89.0 60 69.0 61 64.0 62 52.0 63 29.5 64 17.0 65 14.0 66 9.5 67 7.0 68 3.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.25 2 0.325 3 0.325 4 0.325 5 0.35000000000000003 6 1.2 7 2.0 8 100.0 9 2.225 10-11 1.6375000000000002 12-13 1.6 14-15 3.1625 16-17 3.95 18-19 3.5000000000000004 20-21 3.975 22-23 3.65 24-25 3.8625 26-27 3.8249999999999997 28-29 3.9625 30-31 4.4125 32-33 4.3625 34-35 3.6125 36-37 2.7625 38-39 2.825 40-41 3.3125 42-43 3.55 44-45 3.2125 46-47 2.9250000000000003 48-49 2.7125 50-51 1.7500000000000002 52-53 1.0875 54-55 0.7374999999999999 56-57 0.775 58-59 0.775 60-61 0.775 62-63 0.775 64-65 0.8 66-67 0.8125 68-69 1.1875 70-71 1.4625000000000001 72-73 1.625 74-75 1.875 76-77 1.9124999999999999 78-79 2.2375 80-81 2.0625 82-83 1.8124999999999998 84-85 1.925 86-87 2.025 88-89 2.3 90-91 2.625 92-93 2.4875000000000003 94-95 2.6374999999999997 96-97 3.0 98-99 3.0875 100-101 3.175 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29346454706031 98.375 2 0.5551349987383295 1.0999999999999999 3 0.10093363613424174 0.3 4 0.025233409033560434 0.1 5 0.025233409033560434 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219028 spots for ERR10610825.sra Written 1219028 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra Read 1219017 spots for ERR10610825.sra Written 1219017 spots for ERR10610825.sra SRR ids: ['ERR10610825.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1t1nxi43 ERR10610825.sra spots: 24380351 blocks: [[1, 1219017], [1219018, 2438034], [2438035, 3657051], [3657052, 4876068], [4876069, 6095085], [6095086, 7314102], [7314103, 8533119], [8533120, 9752136], [9752137, 10971153], [10971154, 12190170], [12190171, 13409187], [13409188, 14628204], [14628205, 15847221], [15847222, 17066238], [17066239, 18285255], [18285256, 19504272], [19504273, 20723289], [20723290, 21942306], [21942307, 23161323], [23161324, 24380351]] ERR10610825 file size 5882915 ERR10610825 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610825 ERR10610825_1.fastq ERR10610825_2.fastq Input file: ERR10610825_1.fastq Paired file: ERR10610825_2.fastq trimmed: ERR10610825-trimmed-pair1.fastq, ERR10610825-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:22:20 2024 >> started Fri Dec 6 20:22:54 2024 >> done (34.307s) 24380351 read pairs processed; of these: 96775 ( 0.40%) short read pairs filtered out after trimming by size control 8679 ( 0.04%) empty read pairs filtered out after trimming by size control 24274897 (99.57%) read pairs available; of these: 837877 ( 3.45%) trimmed read pairs available after processing 23437020 (96.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 4 0.00% 22 3 0.00% 23 0 0.00% 24 1 0.00% 25 4 0.00% 26 1 0.00% 27 3 0.00% 28 8 0.00% 29 12 0.00% 30 6 0.00% 31 21 0.00% 32 18 0.00% 33 16 0.00% 34 24 0.00% 35 33 0.00% 36 44 0.00% 37 46 0.00% 38 45 0.00% 39 56 0.00% 40 79 0.00% 41 80 0.00% 42 101 0.00% 43 102 0.00% 44 160 0.00% 45 137 0.00% 46 179 0.00% 47 175 0.00% 48 223 0.00% 49 274 0.00% 50 374 0.00% 51 379 0.00% 52 398 0.00% 53 491 0.00% 54 561 0.00% 55 637 0.00% 56 669 0.00% 57 823 0.00% 58 1001 0.00% 59 3625 0.01% 60 48459 0.20% 61 1207 0.00% 62 1166 0.00% 63 1623 0.01% 64 1846 0.01% 65 2810 0.01% 66 2587 0.01% 67 5030 0.02% 68 4110 0.02% 69 2674 0.01% 70 2885 0.01% 71 3558 0.01% 72 3738 0.02% 73 4860 0.02% 74 4902 0.02% 75 5601 0.02% 76 6138 0.03% 77 7177 0.03% 78 7886 0.03% 79 9204 0.04% 80 10425 0.04% 81 11295 0.05% 82 12762 0.05% 83 14791 0.06% 84 16378 0.07% 85 17906 0.07% 86 19509 0.08% 87 21167 0.09% 88 23568 0.10% 89 26093 0.11% 90 28684 0.12% 91 32306 0.13% 92 34607 0.14% 93 38836 0.16% 94 42130 0.17% 95 46569 0.19% 96 49791 0.21% 97 55901 0.23% 98 59884 0.25% 99 66624 0.27% 100 70369 0.29% 101 23437020 96.55% 24274897 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=26 prefix-density=0.34 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=65.26 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.1 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=28 prefix-density=0.37 prefix-fanout=2.2 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=38.77 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=1.7 sequence=CGCCCCCGGCGGCCCATGAAAATCCGGAGGACCGAGTACCGTTCACGCCCGGTCGTACTCATAACCGCATCAGGTCTCCAAGGTGAACAGCCTCTGGCCAATGGAACAATGTAGGCAAGGGAAGTCGGCAAAACGGATCCGTAACTTCG ERR10610825 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:23:26 Started mapping on | Dec 06 20:23:26 Finished on | Dec 06 20:25:13 Mapping speed, Million of reads per hour | 816.73 Number of input reads | 24274897 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 20846527 Uniquely mapped reads % | 85.88% Average mapped length | 200.41 Number of splices: Total | 11935974 Number of splices: Annotated (sjdb) | 11022521 Number of splices: GT/AG | 11731695 Number of splices: GC/AG | 140278 Number of splices: AT/AC | 4234 Number of splices: Non-canonical | 59767 Mismatch rate per base, % | 0.47% Deletion rate per base | 0.02% Deletion average length | 2.33 Insertion rate per base | 0.02% Insertion average length | 1.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1996886 % of reads mapped to multiple loci | 8.23% Number of reads mapped to too many loci | 129355 % of reads mapped to too many loci | 0.53% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.98% % of reads unmapped: other | 3.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1484188 1484188 1484188 N_multimapping 1996886 1996886 1996886 N_noFeature 1293959 20198261 1418332 N_ambiguous 605345 1821 83974 UnstrandedReadsAssigned:18947223 PositiveStrandReadsAssigned:646445 NegativeStrandReadsAssigned:19344221 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610825 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610825-trimmed-pair1.fastq ERR10610825-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,274,897 reads, 19,779,791 reads pseudoaligned [quant] estimated average fragment length: 178.227 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,175 rounds 52973 ERR10610825.ke.tsv 35125 ERR10610825.se.tsv 88098 total ==> ERR10610825.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 758.897 0 0 PNS24247 1044 866.773 57.825 4.71742 PNS24249 1928 1750.77 25.9399 1.04769 PNS24246 1044 866.773 57.825 4.71742 PNS24248 1044 866.773 57.825 4.71742 PNS24244 1471 1293.77 93.585 5.11495 PNS24243 293 126.532 0 0 KQK14069 1603 1425.77 554.68 27.5097 KQK14071 474 298.607 4.39206 1.04007 ==> ERR10610825.se.tsv <== BRADI_1g14170v3 600 BRADI_1g53295v3 335 BRADI_1g59795v3 425 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 492 BRADI_1g74790v3 83 BRADI_1g09890v3 0 BRADI_1g77505v3 422 BRADI_1g48960v3 0 ERR10610825 completed mapping pipeline successfully