Starting /dee2/code/volunteer_pipeline.sh ERR10610826 current disk space = 1548881272832 free memory = 1601825436 ERR10610826 SRAfilesize 03ed3c2f466baa74dc9dc4140d1d77f0 ERR10610826.sra ERR10610826.sra file validated ERR10610826 is paired end ERR10610826 is conventional basespace ERR10610826 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610826_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.67525 18.0 18.0 30.0 18.0 32.0 2 28.29525 32.0 27.0 32.0 18.0 33.0 3 29.402 32.0 27.0 33.0 18.0 33.0 4 29.8955 32.0 30.0 33.0 15.0 33.0 5 30.2845 33.0 31.0 33.0 15.0 33.0 6 32.03825 36.0 29.0 38.0 16.0 38.0 7 31.8295 36.0 29.0 38.0 16.0 38.0 8 32.01375 36.0 29.0 38.0 16.0 38.0 9 32.838 37.0 29.0 38.0 16.0 38.0 10-11 33.349000000000004 37.5 31.0 38.0 16.0 38.0 12-13 33.442125 38.0 32.0 38.0 16.0 38.0 14-15 33.39875000000001 38.0 33.0 38.0 16.0 38.0 16-17 33.5205 38.0 33.0 38.0 16.0 38.0 18-19 33.667249999999996 38.0 33.5 38.0 16.0 38.0 20-21 33.625 38.0 33.5 38.0 16.0 38.0 22-23 33.712375 38.0 33.0 38.0 16.0 38.0 24-25 33.374375 38.0 32.5 38.0 16.0 38.0 26-27 33.68825 38.0 33.5 38.0 16.0 38.0 28-29 33.8 38.0 33.5 38.0 16.0 38.0 30-31 33.722125 38.0 33.5 38.0 16.0 38.0 32-33 33.892 38.0 33.5 38.0 16.0 38.0 34-35 33.785875000000004 38.0 33.5 38.0 16.0 38.0 36-37 33.646249999999995 38.0 33.5 38.0 16.0 38.0 38-39 33.769499999999994 38.0 33.5 38.0 16.0 38.0 40-41 33.89025 38.0 34.0 38.0 16.0 38.0 42-43 33.756625 38.0 33.5 38.0 16.0 38.0 44-45 33.878 38.0 34.0 38.0 16.0 38.0 46-47 33.761250000000004 38.0 33.5 38.0 16.0 38.0 48-49 33.7145 38.0 33.0 38.0 16.0 38.0 50-51 33.687 38.0 33.5 38.0 16.0 38.0 52-53 33.726625 38.0 33.5 38.0 16.0 38.0 54-55 33.732124999999996 38.0 33.5 38.0 16.0 38.0 56-57 33.810625 38.0 34.0 38.0 16.0 38.0 58-59 33.565625 38.0 33.0 38.0 16.0 38.0 60-61 33.542125 38.0 33.0 38.0 16.0 38.0 62-63 33.513 38.0 33.0 38.0 16.0 38.0 64-65 33.669250000000005 38.0 33.5 38.0 16.0 38.0 66-67 33.811125000000004 38.0 34.0 38.0 16.0 38.0 68-69 33.81325 38.0 34.0 38.0 16.0 38.0 70-71 33.77875 38.0 34.0 38.0 16.0 38.0 72-73 33.5225 38.0 33.0 38.0 16.0 38.0 74-75 33.653875 38.0 33.0 38.0 16.0 38.0 76-77 33.61225 38.0 33.5 38.0 15.5 38.0 78-79 33.678875000000005 38.0 33.5 38.0 16.0 38.0 80-81 33.652125 38.0 33.5 38.0 15.5 38.0 82-83 33.340875 38.0 33.0 38.0 15.0 38.0 84-85 33.477999999999994 38.0 33.0 38.0 15.5 38.0 86-87 33.422 38.0 33.0 38.0 15.5 38.0 88-89 33.083625 38.0 31.5 38.0 15.0 38.0 90-91 33.464625 38.0 33.0 38.0 15.0 38.0 92-93 33.237 38.0 32.5 38.0 15.0 38.0 94-95 33.252750000000006 38.0 33.0 38.0 15.0 38.0 96-97 33.28525 38.0 33.0 38.0 15.0 38.0 98-99 32.504374999999996 37.0 30.0 38.0 15.0 38.0 100-101 31.802875 36.0 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 17.0 19 45.0 20 57.0 21 51.0 22 59.0 23 64.0 24 75.0 25 94.0 26 99.0 27 102.0 28 114.0 29 112.0 30 132.0 31 169.0 32 183.0 33 241.0 34 295.0 35 392.0 36 677.0 37 1021.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.75449708639473 13.073220167215608 10.007600709399544 50.164682036990115 2 19.825 15.675 43.575 20.925 3 20.7 19.8 24.5 35.0 4 26.75 25.900000000000002 22.075 25.275 5 24.85 31.900000000000002 24.975 18.275 6 20.25 34.475 26.25 19.025 7 16.004001000250064 22.9057264316079 42.385596399099775 18.704676169042262 8 19.809904952476238 22.761380690345174 30.315157578789393 27.113556778389196 9 18.804701175293822 21.230307576894223 35.50887721930482 24.456114028507127 10-11 22.343085771442862 29.94498624656164 24.256064016004 23.455863965991497 12-13 21.705426356589147 24.706176544136035 28.557139284821204 25.03125781445361 14-15 21.100112767823582 25.109635384037087 28.843503320385917 24.946748527753414 16-17 22.030291651020153 25.923144323444735 26.799349105019406 25.24721492051571 18-19 21.867966991747938 26.16904226056514 27.831957989497376 24.131032758189548 20-21 22.42780347543443 26.115764470558823 27.378422302787847 24.0780097512189 22-23 21.5625 26.5875 26.8 25.05 24-25 21.540192524065507 27.065883235404424 26.328291036379547 25.065633204150515 26-27 20.91511438929866 25.565695711963997 28.56607075884486 24.953119139892486 28-29 21.5375 26.700000000000003 26.674999999999997 25.087500000000002 30-31 21.8125 26.8375 25.7875 25.5625 32-33 21.1875 26.400000000000002 27.200000000000003 25.2125 34-35 22.112499999999997 27.037499999999998 26.625 24.224999999999998 36-37 20.8625 26.674999999999997 26.924999999999997 25.5375 38-39 21.2875 26.5375 27.8125 24.3625 40-41 22.1875 25.912499999999998 26.937499999999996 24.962500000000002 42-43 22.2125 26.387500000000003 26.35 25.05 44-45 20.925 26.8375 27.775 24.462500000000002 46-47 21.587500000000002 26.9625 25.937500000000004 25.5125 48-49 21.837500000000002 25.900000000000002 26.775 25.4875 50-51 21.4 26.087500000000002 26.85 25.662499999999998 52-53 21.45 27.125 26.937499999999996 24.4875 54-55 22.7375 25.374999999999996 26.474999999999998 25.412499999999998 56-57 22.5625 26.025 26.775 24.637500000000003 58-59 21.925 26.5125 26.437500000000004 25.124999999999996 60-61 22.25 26.187500000000004 26.8125 24.75 62-63 21.8125 25.7875 27.525 24.875 64-65 21.337500000000002 26.200000000000003 26.85 25.6125 66-67 20.837500000000002 26.637499999999996 26.3 26.224999999999998 68-69 22.0625 26.6125 26.775 24.55 70-71 22.1875 26.200000000000003 25.887500000000003 25.724999999999998 72-73 21.5375 25.724999999999998 27.787499999999998 24.95 74-75 22.0 25.974999999999998 27.4125 24.6125 76-77 22.05 25.6 26.937499999999996 25.412499999999998 78-79 22.287499999999998 25.7 26.5125 25.5 80-81 22.3 25.575 26.2625 25.8625 82-83 21.9 26.6625 26.2125 25.224999999999998 84-85 22.3 25.6125 26.674999999999997 25.412499999999998 86-87 22.425 25.55 27.1375 24.887500000000003 88-89 21.4875 25.95 26.950000000000003 25.6125 90-91 22.275 26.4625 26.237500000000004 25.025 92-93 22.112499999999997 26.187500000000004 27.1375 24.5625 94-95 23.0625 25.5 26.650000000000002 24.7875 96-97 21.8 26.325 26.474999999999998 25.4 98-99 22.537499999999998 26.387500000000003 26.35 24.725 100-101 22.25 26.275 26.0375 25.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 2.0 27 1.0 28 1.0 29 1.5 30 4.0 31 7.0 32 12.5 33 18.0 34 25.0 35 37.5 36 49.0 37 66.0 38 87.0 39 118.0 40 154.0 41 182.5 42 208.0 43 218.0 44 238.5 45 254.0 46 247.5 47 239.0 48 218.5 49 188.0 50 176.5 51 164.0 52 146.0 53 138.5 54 126.5 55 121.5 56 102.5 57 80.0 58 69.5 59 62.5 60 54.0 61 42.0 62 37.5 63 32.5 64 22.5 65 16.5 66 11.5 67 8.0 68 6.0 69 2.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.05 9 0.025 10-11 0.025 12-13 0.025 14-15 0.2375 16-17 0.13749999999999998 18-19 0.025 20-21 0.0125 22-23 0.0 24-25 0.0125 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39577039274926 98.7 2 0.5035246727089627 1.0 3 0.10070493454179255 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610826 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610826_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.27425 32.0 27.0 33.0 18.0 33.0 2 29.684 32.0 27.0 33.0 18.0 33.0 3 26.262 28.0 18.0 33.0 18.0 33.0 4 28.2405 32.0 27.0 33.0 15.0 33.0 5 29.066 32.0 27.0 33.0 15.0 33.0 6 26.46325 29.0 16.0 37.0 15.0 38.0 7 29.87175 33.0 26.0 37.0 16.0 38.0 8 31.94375 36.0 29.0 38.0 16.0 38.0 9 32.4535 37.0 29.0 38.0 16.0 38.0 10-11 32.8135 37.0 30.0 38.0 16.0 38.0 12-13 33.049875 37.5 31.0 38.0 16.0 38.0 14-15 33.33075 38.0 32.0 38.0 16.0 38.0 16-17 33.050625 37.5 31.0 38.0 16.0 38.0 18-19 32.990625 38.0 31.0 38.0 16.0 38.0 20-21 32.887125 37.5 30.0 38.0 16.0 38.0 22-23 33.124750000000006 38.0 31.0 38.0 16.0 38.0 24-25 32.78075 37.0 29.0 38.0 16.0 38.0 26-27 32.80175 37.5 30.0 38.0 16.0 38.0 28-29 31.234375 35.5 22.5 38.0 16.0 38.0 30-31 32.505250000000004 36.5 28.5 38.0 16.0 38.0 32-33 32.944375 37.0 30.5 38.0 16.0 38.0 34-35 33.149875 37.5 31.5 38.0 16.0 38.0 36-37 32.597 37.5 30.5 38.0 16.0 38.0 38-39 32.974374999999995 37.0 30.0 38.0 16.0 38.0 40-41 33.336124999999996 38.0 33.0 38.0 16.0 38.0 42-43 32.96575 38.0 31.0 38.0 16.0 38.0 44-45 33.251999999999995 38.0 32.0 38.0 16.0 38.0 46-47 33.052625 38.0 31.0 38.0 16.0 38.0 48-49 33.306250000000006 38.0 33.0 38.0 16.0 38.0 50-51 33.25175 38.0 32.0 38.0 16.0 38.0 52-53 33.290375 38.0 32.0 38.0 16.0 38.0 54-55 33.297375 38.0 32.0 38.0 16.0 38.0 56-57 33.007999999999996 38.0 31.0 38.0 16.0 38.0 58-59 33.28775 38.0 32.5 38.0 16.0 38.0 60-61 33.302 38.0 32.5 38.0 16.0 38.0 62-63 33.35825 38.0 33.0 38.0 16.0 38.0 64-65 33.245000000000005 38.0 32.5 38.0 16.0 38.0 66-67 33.236125 38.0 32.0 38.0 16.0 38.0 68-69 33.207 38.0 31.5 38.0 16.0 38.0 70-71 33.234125 38.0 32.0 38.0 16.0 38.0 72-73 33.330625 38.0 33.0 38.0 16.0 38.0 74-75 33.055875 38.0 31.0 38.0 16.0 38.0 76-77 33.076499999999996 38.0 31.0 38.0 16.0 38.0 78-79 32.668499999999995 37.5 30.0 38.0 16.0 38.0 80-81 32.69475 37.0 29.0 38.0 16.0 38.0 82-83 32.5325 37.0 29.0 38.0 15.5 38.0 84-85 33.0095 37.5 31.0 38.0 15.5 38.0 86-87 32.7735 37.0 30.0 38.0 15.0 38.0 88-89 32.779375 37.5 31.0 38.0 15.0 38.0 90-91 32.7495 37.5 30.0 38.0 15.0 38.0 92-93 32.49725 37.0 30.0 38.0 15.0 38.0 94-95 32.6265 37.0 31.0 38.0 15.0 38.0 96-97 32.56925 37.0 30.0 38.0 15.0 38.0 98-99 32.5375 37.0 31.0 38.0 15.0 38.0 100-101 30.870375000000003 35.0 27.0 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 12.0 18 26.0 19 62.0 20 59.0 21 61.0 22 79.0 23 95.0 24 87.0 25 101.0 26 126.0 27 107.0 28 117.0 29 137.0 30 152.0 31 164.0 32 192.0 33 240.0 34 319.0 35 387.0 36 640.0 37 836.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.975 15.65 14.299999999999999 42.075 2 26.55 22.925 34.65 15.875 3 20.75 23.799999999999997 32.75 22.7 4 25.7 32.25 20.775 21.275 5 27.05 33.25 21.8 17.9 6 21.15 33.1 26.700000000000003 19.05 7 20.424999999999997 17.549999999999997 38.574999999999996 23.45 8 23.150000000000002 22.675 26.125 28.050000000000004 9 25.0 22.275 28.675 24.05 10-11 25.7625 29.8375 21.7375 22.662499999999998 12-13 25.7875 23.775 25.95 24.4875 14-15 24.4 26.5625 26.3625 22.675 16-17 25.112499999999997 27.1125 25.137500000000003 22.6375 18-19 25.2 27.175 24.2375 23.3875 20-21 25.8125 26.8625 25.412499999999998 21.912499999999998 22-23 25.05 26.8 25.0125 23.1375 24-25 24.7 26.724999999999998 25.8625 22.7125 26-27 25.5 26.387500000000003 26.2625 21.85 28-29 25.362499999999997 26.387500000000003 25.937500000000004 22.3125 30-31 25.2125 25.837500000000002 25.912499999999998 23.0375 32-33 25.0 27.212500000000002 24.8625 22.925 34-35 24.453056632079008 26.24078009751219 26.453306663332913 22.852856607075882 36-37 25.407983931709765 26.24905849861913 24.767762992719057 23.575194576952047 38-39 25.719289467100324 26.482361771328495 25.756817613209908 22.041531148361273 40-41 25.22826766729206 26.25390869293308 25.215759849906195 23.30206378986867 42-43 23.81492687846697 27.25668179525971 26.31114473020676 22.617246596066565 44-45 23.91494684177611 27.091932457786115 26.416510318949342 22.57661038148843 46-47 25.357411587659897 26.824680210684726 25.696012039127165 22.121896162528216 48-49 25.28132033008252 27.369342335583895 25.156289072268066 22.193048262065513 50-51 25.4 25.6125 25.874999999999996 23.1125 52-53 24.525 27.187499999999996 25.412499999999998 22.875 54-55 24.625 26.375 26.4625 22.537499999999998 56-57 25.75 26.625 25.324999999999996 22.3 58-59 25.087500000000002 26.75 25.05 23.1125 60-61 25.5625 27.0625 24.962500000000002 22.412499999999998 62-63 26.1125 26.174999999999997 25.8 21.912499999999998 64-65 25.374999999999996 26.937499999999996 26.437500000000004 21.25 66-67 25.937500000000004 26.200000000000003 24.837500000000002 23.025000000000002 68-69 25.3125 26.974999999999998 25.5125 22.2 70-71 25.365670708838607 26.440805100637583 25.765720715089387 22.42780347543443 72-73 25.874999999999996 26.5375 25.4875 22.1 74-75 24.75 27.0125 26.325 21.912499999999998 76-77 24.7875 25.837500000000002 26.825 22.55 78-79 23.9375 26.687499999999996 25.525 23.849999999999998 80-81 24.7375 26.6625 26.125 22.475 82-83 25.362499999999997 27.3 25.05 22.287499999999998 84-85 24.925 27.9125 25.5 21.6625 86-87 25.112499999999997 26.1625 26.825 21.9 88-89 24.7 27.3375 25.924999999999997 22.037499999999998 90-91 24.9875 26.275 27.6625 21.075 92-93 25.825 26.650000000000002 25.4625 22.0625 94-95 25.95 27.1625 24.762500000000003 22.125 96-97 24.712500000000002 27.2625 26.687499999999996 21.337500000000002 98-99 26.474999999999998 26.575 25.2125 21.7375 100-101 26.2625 26.987499999999997 25.0125 21.7375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 1.5 29 2.0 30 3.0 31 6.5 32 8.0 33 6.5 34 15.5 35 29.5 36 38.0 37 54.5 38 88.0 39 112.5 40 127.0 41 159.5 42 191.5 43 213.0 44 231.0 45 238.0 46 233.0 47 226.5 48 221.5 49 209.5 50 192.0 51 172.5 52 161.5 53 156.5 54 141.0 55 123.0 56 110.0 57 104.5 58 99.0 59 78.5 60 59.5 61 47.0 62 38.5 63 29.0 64 19.0 65 14.0 66 11.5 67 11.0 68 7.5 69 3.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.42500000000000004 38-39 0.075 40-41 0.0625 42-43 0.8500000000000001 44-45 0.0625 46-47 0.325 48-49 0.025 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.4 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.9624999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142901 spots for ERR10610826.sra Written 142901 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra Read 142900 spots for ERR10610826.sra Written 142900 spots for ERR10610826.sra SRR ids: ['ERR10610826.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3iajvnj_ ERR10610826.sra spots: 2858001 blocks: [[1, 142900], [142901, 285800], [285801, 428700], [428701, 571600], [571601, 714500], [714501, 857400], [857401, 1000300], [1000301, 1143200], [1143201, 1286100], [1286101, 1429000], [1429001, 1571900], [1571901, 1714800], [1714801, 1857700], [1857701, 2000600], [2000601, 2143500], [2143501, 2286400], [2286401, 2429300], [2429301, 2572200], [2572201, 2715100], [2715101, 2858001]] ERR10610826 file size 684420 ERR10610826 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610826 ERR10610826_1.fastq ERR10610826_2.fastq Input file: ERR10610826_1.fastq Paired file: ERR10610826_2.fastq trimmed: ERR10610826-trimmed-pair1.fastq, ERR10610826-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:44:28 2024 >> started Fri Dec 6 21:44:30 2024 >> done (2.819s) 2858001 read pairs processed; of these: 6 ( 0.00%) short read pairs filtered out after trimming by size control 93 ( 0.00%) empty read pairs filtered out after trimming by size control 2857902 (100.00%) read pairs available; of these: 83189 ( 2.91%) trimmed read pairs available after processing 2774713 (97.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 1 0.00% 33 1 0.00% 34 3 0.00% 35 2 0.00% 36 4 0.00% 37 7 0.00% 38 4 0.00% 39 4 0.00% 40 6 0.00% 41 8 0.00% 42 6 0.00% 43 7 0.00% 44 12 0.00% 45 12 0.00% 46 12 0.00% 47 15 0.00% 48 16 0.00% 49 29 0.00% 50 30 0.00% 51 41 0.00% 52 32 0.00% 53 41 0.00% 54 60 0.00% 55 48 0.00% 56 41 0.00% 57 74 0.00% 58 76 0.00% 59 80 0.00% 60 85 0.00% 61 93 0.00% 62 115 0.00% 63 149 0.01% 64 168 0.01% 65 169 0.01% 66 175 0.01% 67 233 0.01% 68 240 0.01% 69 290 0.01% 70 328 0.01% 71 351 0.01% 72 431 0.02% 73 491 0.02% 74 495 0.02% 75 559 0.02% 76 648 0.02% 77 744 0.03% 78 825 0.03% 79 871 0.03% 80 1103 0.04% 81 1202 0.04% 82 1339 0.05% 83 1463 0.05% 84 1677 0.06% 85 1968 0.07% 86 2124 0.07% 87 2193 0.08% 88 2428 0.08% 89 2807 0.10% 90 3059 0.11% 91 3614 0.13% 92 3846 0.13% 93 4225 0.15% 94 4631 0.16% 95 5027 0.18% 96 5262 0.18% 97 6052 0.21% 98 6313 0.22% 99 7094 0.25% 100 7627 0.27% 101 2774713 97.09% 2857902 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=23 prefix-density=0.12 prefix-fanout=2.0 sequence=GCAAGACATCTTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=68.72 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=11.3 sequence=ATCATCATCATCCCCGCACCCCATCAACTGCTACGTACGGATGAACTAATTAACACACGCATGCATGCAAATATACGATGCTTAATTAATTAACACCGATCGATCCCCATTAAAACCAAACCACATCGATCAGACGTCGAAGGTGTTCTTGCCGGTG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=2.0 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=39.56 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=8.3 sequence=AAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCACTCATCCGTGACGGTCGTATGGAGAAGTTCTACTGGGCCCCCACCCGCGAAGACCGTATCGGTGTCTGCAGGGGTATCTTCCAAACTGACAACATCAGCGACGAGTCCGTCATCAAGATCGTAGACACCTTCCCAGGCCAATCCATCGACTTTTTCGGAGCGCTGCGTGCCCGGGTGTACGACGATGAGGTGCGCAAGTGGGTCAGCTCAACCGGAATAGAGAACATCGGCAAGAAGCTGGTGAACTCGAAGGATGGACCGGTGTCCTTTGAGCAGCCAAAGATGACAATCGAGAAGCTCCTGGAGTACGGCCACATGCTCGTCCAAGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACAAGTACATGAGCGAGGCTGCTCTGGGAGATGCTAACTCAGATGCCATGAAGACTGGTTCCTTCTACGGTTAGAACACTCTTC ERR10610826 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:45:19 Started mapping on | Dec 06 21:45:19 Finished on | Dec 06 21:46:02 Mapping speed, Million of reads per hour | 239.27 Number of input reads | 2857902 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 2540403 Uniquely mapped reads % | 88.89% Average mapped length | 199.93 Number of splices: Total | 1771211 Number of splices: Annotated (sjdb) | 1665297 Number of splices: GT/AG | 1744690 Number of splices: GC/AG | 20447 Number of splices: AT/AC | 741 Number of splices: Non-canonical | 5333 Mismatch rate per base, % | 0.94% Deletion rate per base | 0.02% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 86041 % of reads mapped to multiple loci | 3.01% Number of reads mapped to too many loci | 3841 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.61% % of reads unmapped: other | 1.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 231458 231458 231458 N_multimapping 86041 86041 86041 N_noFeature 102356 2469572 117212 N_ambiguous 64641 270 8783 UnstrandedReadsAssigned:2373406 PositiveStrandReadsAssigned:70561 NegativeStrandReadsAssigned:2414408 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610826 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610826-trimmed-pair1.fastq ERR10610826-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,857,902 reads, 2,485,673 reads pseudoaligned [quant] estimated average fragment length: 177.429 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,017 rounds 52973 ERR10610826.ke.tsv 35125 ERR10610826.se.tsv 88098 total ==> ERR10610826.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 759.714 0.00055464 0.000451482 PNS24247 1044 867.571 11.6948 8.33615 PNS24249 1928 1751.57 0 0 PNS24246 1044 867.571 11.6948 8.33615 PNS24248 1044 867.571 11.6948 8.33615 PNS24244 1471 1294.57 12.9151 6.16952 PNS24243 293 127.296 0 0 KQK14069 1603 1426.57 385.943 167.305 KQK14071 474 299.5 12.4551 25.7176 ==> ERR10610826.se.tsv <== BRADI_1g14170v3 444 BRADI_1g53295v3 82 BRADI_1g59795v3 96 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 82 BRADI_1g74790v3 2 BRADI_1g09890v3 0 BRADI_1g77505v3 55 BRADI_1g48960v3 0 ERR10610826 completed mapping pipeline successfully