Starting /dee2/code/volunteer_pipeline.sh ERR10610827 current disk space = 1549556678656 free memory = 1599830856 ERR10610827 SRAfilesize cb36adfb79a28f481154b8b913e89cc4 ERR10610827.sra ERR10610827.sra file validated ERR10610827 is paired end ERR10610827 is conventional basespace ERR10610827 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610827_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.1685 25.0 18.0 31.0 18.0 33.0 2 30.68725 32.0 32.0 33.0 25.0 33.0 3 30.347 31.0 29.0 33.0 27.0 33.0 4 31.9285 33.0 32.0 33.0 31.0 33.0 5 32.3995 33.0 33.0 33.0 32.0 34.0 6 36.0605 38.0 36.0 38.0 33.0 38.0 7 36.4325 38.0 37.0 38.0 34.0 38.0 8 36.86975 38.0 38.0 38.0 35.0 38.0 9 37.0995 38.0 38.0 38.0 37.0 38.0 10-11 37.102500000000006 38.0 38.0 38.0 36.5 38.0 12-13 37.061499999999995 38.0 38.0 38.0 36.5 38.0 14-15 37.108375 38.0 38.0 38.0 36.5 38.0 16-17 37.086875 38.0 38.0 38.0 37.0 38.0 18-19 37.1465 38.0 38.0 38.0 36.5 38.0 20-21 37.149375 38.0 38.0 38.0 37.0 38.0 22-23 37.161249999999995 38.0 38.0 38.0 37.0 38.0 24-25 37.156375 38.0 38.0 38.0 37.0 38.0 26-27 37.13975 38.0 38.0 38.0 37.0 38.0 28-29 37.1855 38.0 38.0 38.0 37.0 38.0 30-31 37.157375 38.0 38.0 38.0 37.0 38.0 32-33 37.17700000000001 38.0 38.0 38.0 37.0 38.0 34-35 37.158 38.0 38.0 38.0 37.0 38.0 36-37 37.13275 38.0 38.0 38.0 37.0 38.0 38-39 37.14275 38.0 38.0 38.0 37.0 38.0 40-41 37.103375 38.0 38.0 38.0 37.0 38.0 42-43 37.083 38.0 38.0 38.0 36.5 38.0 44-45 37.083 38.0 38.0 38.0 37.0 38.0 46-47 37.113375000000005 38.0 38.0 38.0 37.0 38.0 48-49 36.918875 38.0 38.0 38.0 36.5 38.0 50-51 36.866 38.0 38.0 38.0 36.0 38.0 52-53 36.710125000000005 38.0 38.0 38.0 36.0 38.0 54-55 36.721000000000004 38.0 38.0 38.0 36.0 38.0 56-57 36.985749999999996 38.0 38.0 38.0 36.0 38.0 58-59 37.0375 38.0 38.0 38.0 36.0 38.0 60-61 37.029375 38.0 38.0 38.0 36.0 38.0 62-63 36.976 38.0 38.0 38.0 36.0 38.0 64-65 36.780625 38.0 38.0 38.0 36.0 38.0 66-67 37.009125 38.0 38.0 38.0 36.0 38.0 68-69 36.957625 38.0 38.0 38.0 36.0 38.0 70-71 37.008625 38.0 38.0 38.0 36.0 38.0 72-73 37.027874999999995 38.0 38.0 38.0 36.0 38.0 74-75 36.991375000000005 38.0 38.0 38.0 36.0 38.0 76-77 36.99875 38.0 38.0 38.0 36.0 38.0 78-79 36.95275 38.0 38.0 38.0 36.0 38.0 80-81 37.001875 38.0 38.0 38.0 36.0 38.0 82-83 36.9675 38.0 38.0 38.0 36.0 38.0 84-85 36.993750000000006 38.0 38.0 38.0 36.0 38.0 86-87 36.95375 38.0 38.0 38.0 36.0 38.0 88-89 36.8975 38.0 38.0 38.0 36.0 38.0 90-91 36.67075 38.0 38.0 38.0 35.5 38.0 92-93 36.596625 38.0 38.0 38.0 35.0 38.0 94-95 36.61575 38.0 38.0 38.0 35.5 38.0 96-97 36.466625 38.0 38.0 38.0 35.0 38.0 98-99 36.37175 38.0 38.0 38.0 35.0 38.0 100-101 36.121875 38.0 37.5 38.0 33.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 0.0 18 3.0 19 6.0 20 4.0 21 13.0 22 12.0 23 14.0 24 9.0 25 11.0 26 15.0 27 21.0 28 21.0 29 25.0 30 24.0 31 31.0 32 44.0 33 61.0 34 115.0 35 151.0 36 367.0 37 3051.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.450000000000003 11.65 8.875 52.025 2 20.625 16.725 39.65 23.0 3 21.099999999999998 18.65 22.55 37.7 4 25.650000000000002 27.275 20.724999999999998 26.35 5 24.425 32.75 23.45 19.375 6 20.375 34.1 24.6 20.925 7 15.275 22.55 42.775 19.400000000000002 8 19.55 21.425 31.55 27.474999999999998 9 18.75 21.75 34.0 25.5 10-11 20.974999999999998 31.6875 23.025000000000002 24.3125 12-13 21.3125 24.075 27.787499999999998 26.825 14-15 21.4 25.387500000000003 28.1125 25.1 16-17 21.85 26.887499999999996 26.200000000000003 25.0625 18-19 21.4375 25.85 25.8625 26.85 20-21 21.725 26.987499999999997 26.0375 25.25 22-23 22.3375 26.075 26.3 25.2875 24-25 22.125 26.237500000000004 26.5 25.137500000000003 26-27 22.05 25.587500000000002 26.575 25.7875 28-29 22.412499999999998 26.5375 25.162499999999998 25.887500000000003 30-31 21.099999999999998 27.1125 26.424999999999997 25.362499999999997 32-33 22.2 25.9625 27.05 24.7875 34-35 21.9 26.2875 26.950000000000003 24.8625 36-37 22.625 25.662499999999998 26.4625 25.25 38-39 21.6625 26.0 25.937500000000004 26.400000000000002 40-41 22.725 26.375 26.2125 24.6875 42-43 21.7 25.35 27.025 25.924999999999997 44-45 22.25 25.2625 27.3375 25.15 46-47 22.4875 25.5125 26.875 25.124999999999996 48-49 21.60974384731291 26.054746358613762 26.393771973882473 25.94173782019086 50-51 21.196882071913503 25.13200905204928 27.369876791551423 26.301232084485793 52-53 22.15629339729832 26.297184698901653 26.32243403610655 25.224087867693473 54-55 22.008305020762553 26.475399521832138 26.110481942871523 25.405813514533786 56-57 22.602053593789133 25.156523916854496 26.458802905083896 25.782619584272474 58-59 21.6625 26.325 27.037499999999998 24.975 60-61 22.037499999999998 25.374999999999996 26.4625 26.125 62-63 21.0125 26.05 27.737499999999997 25.2 64-65 22.31851293644813 26.55111780959558 26.098970108013063 25.03139914594323 66-67 22.18886804252658 26.804252657911192 25.35334584115072 25.65353345841151 68-69 21.824104234527688 26.20897018291155 26.48459032823854 25.482335254322226 70-71 21.987499999999997 26.474999999999998 26.1125 25.424999999999997 72-73 22.1875 25.174999999999997 27.187499999999996 25.45 74-75 22.45 25.7875 26.174999999999997 25.587500000000002 76-77 22.725 26.200000000000003 25.937500000000004 25.137500000000003 78-79 22.525000000000002 26.224999999999998 25.2125 26.0375 80-81 21.55 26.474999999999998 25.974999999999998 26.0 82-83 22.6375 26.325 25.85 25.1875 84-85 22.1875 26.075 26.5375 25.2 86-87 21.725 26.937499999999996 25.974999999999998 25.362499999999997 88-89 22.355739141319315 26.37376392539742 26.073350857428967 25.1971460758543 90-91 22.444612286002013 26.007049345417926 26.611278952668684 24.93705941591138 92-93 22.52297620546393 26.29988669268538 26.36283520080574 24.814301901044942 94-95 22.359310084351 26.211758781316885 26.085861765076167 25.34306936925595 96-97 22.679631266574063 25.584038388685443 25.584038388685443 26.152291956055056 98-99 22.814796047631113 26.247783126425134 25.779072713453253 25.158348112490497 100-101 23.423309788092837 25.70635721493441 25.618062563067607 25.252270433905146 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 0.5 28 2.5 29 3.0 30 3.5 31 8.0 32 11.0 33 10.0 34 18.5 35 39.0 36 51.5 37 62.0 38 82.5 39 103.5 40 132.0 41 162.0 42 183.0 43 207.5 44 221.0 45 226.0 46 235.0 47 231.0 48 215.5 49 223.5 50 209.0 51 168.5 52 160.5 53 147.0 54 135.5 55 127.0 56 112.5 57 91.0 58 75.0 59 65.5 60 52.0 61 49.0 62 43.0 63 38.5 64 29.5 65 21.0 66 16.0 67 9.0 68 6.0 69 5.0 70 3.0 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.44999999999999996 50-51 0.575 52-53 0.9875 54-55 0.6625 56-57 0.17500000000000002 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.475 66-67 0.0625 68-69 0.22499999999999998 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.13749999999999998 90-91 0.7000000000000001 92-93 0.7125 94-95 0.7125 96-97 1.0125 98-99 1.325 100-101 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7060010085728694 1.4000000000000001 3 0.07564296520423601 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610827 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610827_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61225 33.0 33.0 34.0 32.0 34.0 2 32.53475 33.0 33.0 34.0 31.0 34.0 3 32.64425 33.0 33.0 34.0 32.0 34.0 4 32.6 34.0 33.0 34.0 32.0 34.0 5 32.593 33.0 33.0 34.0 32.0 34.0 6 36.38225 38.0 38.0 38.0 34.0 38.0 7 36.1405 38.0 38.0 38.0 34.0 38.0 8 2.0 2.0 2.0 2.0 2.0 2.0 9 28.8145 30.0 30.0 31.0 26.0 31.0 10-11 23.287374999999997 22.5 22.5 23.0 20.5 29.5 12-13 31.141374999999996 33.0 31.5 34.0 27.0 34.0 14-15 35.025375 38.0 36.5 38.0 28.5 38.0 16-17 35.252875 38.0 38.0 38.0 30.0 38.0 18-19 35.3765 38.0 38.0 38.0 31.0 38.0 20-21 35.23075 38.0 38.0 38.0 31.0 38.0 22-23 35.408625 38.0 38.0 38.0 31.5 38.0 24-25 35.371875 38.0 38.0 38.0 31.0 38.0 26-27 35.289500000000004 38.0 38.0 38.0 31.5 38.0 28-29 35.331875 38.0 38.0 38.0 31.0 38.0 30-31 35.143375000000006 38.0 38.0 38.0 30.0 38.0 32-33 35.167375 38.0 38.0 38.0 29.0 38.0 34-35 35.286500000000004 38.0 38.0 38.0 29.0 38.0 36-37 35.55775 38.0 38.0 38.0 31.0 38.0 38-39 35.58125 38.0 38.0 38.0 32.5 38.0 40-41 35.382125 38.0 38.0 38.0 31.0 38.0 42-43 35.416 38.0 38.0 38.0 32.0 38.0 44-45 35.455375000000004 38.0 38.0 38.0 31.0 38.0 46-47 35.55925 38.0 38.0 38.0 32.0 38.0 48-49 35.597375 38.0 38.0 38.0 32.5 38.0 50-51 35.894125 38.0 38.0 38.0 33.0 38.0 52-53 36.121750000000006 38.0 38.0 38.0 33.5 38.0 54-55 36.356125 38.0 38.0 38.0 34.0 38.0 56-57 36.347750000000005 38.0 38.0 38.0 34.0 38.0 58-59 36.2915 38.0 38.0 38.0 34.0 38.0 60-61 36.322125 38.0 38.0 38.0 34.0 38.0 62-63 36.27925 38.0 38.0 38.0 34.0 38.0 64-65 36.337500000000006 38.0 38.0 38.0 34.0 38.0 66-67 36.317125000000004 38.0 38.0 38.0 34.0 38.0 68-69 36.134249999999994 38.0 38.0 38.0 33.5 38.0 70-71 36.053625 38.0 38.0 38.0 34.0 38.0 72-73 35.885625000000005 38.0 38.0 38.0 33.5 38.0 74-75 35.745125 38.0 38.0 38.0 32.0 38.0 76-77 35.75212500000001 38.0 38.0 38.0 32.0 38.0 78-79 35.6255 38.0 38.0 38.0 31.0 38.0 80-81 35.70725 38.0 38.0 38.0 33.0 38.0 82-83 35.6415 38.0 38.0 38.0 31.5 38.0 84-85 35.69175 38.0 38.0 38.0 32.0 38.0 86-87 35.661125 38.0 38.0 38.0 32.0 38.0 88-89 35.558375 38.0 38.0 38.0 31.5 38.0 90-91 35.373625000000004 38.0 38.0 38.0 31.0 38.0 92-93 35.40375 38.0 38.0 38.0 30.0 38.0 94-95 35.3735 38.0 38.0 38.0 31.0 38.0 96-97 35.355125 38.0 38.0 38.0 31.0 38.0 98-99 35.25725 38.0 38.0 38.0 30.5 38.0 100-101 34.615125 38.0 36.5 38.0 26.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 0.0 4 0.0 5 3.0 6 7.0 7 5.0 8 14.0 9 12.0 10 11.0 11 6.0 12 8.0 13 2.0 14 1.0 15 4.0 16 11.0 17 4.0 18 18.0 19 22.0 20 17.0 21 22.0 22 27.0 23 14.0 24 29.0 25 16.0 26 28.0 27 24.0 28 31.0 29 46.0 30 46.0 31 54.0 32 91.0 33 101.0 34 138.0 35 292.0 36 2553.0 37 331.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.857715430861724 15.90681362725451 12.600200400801603 42.635270541082164 2 27.68304914744233 22.542627883650955 33.24974924774323 16.52457372116349 3 21.51454363089268 25.601805416248745 27.883650952858574 25.0 4 26.278836509528585 30.240722166499502 19.78435305917753 23.696088264794383 5 27.933801404212637 34.954864593781345 20.13540621865597 16.975927783350052 6 21.851289833080425 35.912999494183104 22.078907435508345 20.156803237228125 7 22.04905467552376 17.910066428206438 35.973428717424625 24.06745017884517 8 NaN NaN NaN NaN 9 23.52339555100997 22.628483763743287 28.611608284326262 25.23651240092048 10-11 22.80167491435097 29.184113691155943 21.266336759294504 26.747874635198578 12-13 26.272264631043257 24.033078880407125 24.389312977099237 25.305343511450385 14-15 25.805199844780752 25.468891475876344 26.115638339154057 22.61027034018885 16-17 26.804795413083138 25.51472504560855 24.367995830075582 23.312483711232733 18-19 25.337662337662337 26.61038961038961 24.688311688311686 23.363636363636363 20-21 26.4022958518132 25.554396034437776 24.849986955387422 23.193321158361595 22-23 25.253444242266703 26.28021835196257 25.110475695347024 23.355861710423707 24-25 25.859375 26.497395833333332 24.713541666666668 22.9296875 26-27 25.885416666666668 28.020833333333332 23.958333333333336 22.135416666666664 28-29 26.65537017726799 25.96454640250261 25.05213764337852 22.327945776850886 30-31 26.044258216577187 26.044258216577187 24.852690847191305 23.058792719654313 32-33 26.31234454771567 25.67089933237335 25.827987956538813 22.18876816337217 34-35 25.734338445541983 25.79932414868729 24.369638679490514 24.09669872628022 36-37 24.645892351274785 26.113829513262942 26.55163533350502 22.688642801957247 38-39 25.902527075812277 26.534296028880867 25.644662197008767 21.918514698298093 40-41 25.99170339642209 25.823178636245785 25.16204303863106 23.023074928701064 42-43 25.39929879236463 26.542007531489414 25.165562913907287 22.89313076223867 44-45 24.763876310001294 26.41997671108811 25.94126018889895 22.874886790011644 46-47 25.49677419354839 25.961290322580645 24.851612903225806 23.690322580645162 48-49 25.131968585039267 26.22634221707223 26.161967297540876 22.479721900347624 50-51 25.528393175451995 26.165011459129104 25.65571683218742 22.650878533231474 52-53 25.833754421424963 26.806467913087417 25.631632137443155 21.728145528044468 54-55 25.63812397837294 26.354834653589844 25.084873632591474 22.922167735445743 56-57 25.119496855345915 25.92452830188679 26.113207547169807 22.842767295597486 58-59 25.522012578616355 26.767295597484274 25.572327044025155 22.138364779874216 60-61 25.937106918238996 26.113207547169807 25.119496855345915 22.830188679245282 62-63 25.547169811320753 26.60377358490566 25.78616352201258 22.062893081761008 64-65 25.32394011825387 25.90262926154233 25.739086677569507 23.034343942634294 66-67 24.515479486534105 26.340297004782283 25.91240875912409 23.231814749559526 68-69 25.7460799190693 26.378351036924634 25.923115832068795 21.95245321193728 70-71 25.155318879168252 26.993787244833268 25.61176619754026 22.239127678458225 72-73 25.03176620076239 26.67090216010165 25.679796696315123 22.61753494282084 74-75 24.639714322152788 27.10113505930366 26.48896824384645 21.770182374697107 76-77 25.85459183673469 26.377551020408163 25.931122448979593 21.836734693877553 78-79 26.152073732718893 25.678443420378905 25.819252432155658 22.350230414746544 80-81 24.817984416911482 26.618980712734704 26.04419466087623 22.518840209477585 82-83 25.653448935356373 25.908453397934462 25.85745250541884 22.58064516129032 84-85 25.216947422154163 26.391015824400206 26.02092904543134 22.371107708014293 86-87 24.936126724578436 26.647930505876342 26.060296371997953 22.355646397547265 88-89 26.654717705799513 25.83536038919473 25.156830111381385 22.353091793624376 90-91 24.572016990603682 26.129488994722617 25.807697258334407 23.490796756339297 92-93 25.121951219512194 26.482670089858797 26.08472400513479 22.310654685494224 94-95 26.19721936148301 26.416065911431513 25.077239958805354 22.309474768280126 96-97 24.98386888630791 26.99703187508066 25.70654277971351 22.312556458897923 98-99 24.97417355371901 27.853822314049587 24.870867768595044 22.301136363636363 100-101 25.89239524055872 26.55199172271081 25.646663217796174 21.908949818934296 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 6.0 2 3.5 3 0.5 4 1.0 5 1.0 6 2.5 7 3.5 8 5.5 9 5.5 10 4.5 11 5.5 12 5.5 13 5.0 14 4.0 15 3.5 16 3.5 17 4.0 18 5.5 19 4.5 20 4.0 21 4.5 22 3.0 23 4.0 24 4.0 25 3.5 26 3.5 27 5.0 28 4.0 29 3.5 30 7.0 31 9.5 32 10.0 33 12.5 34 20.5 35 26.0 36 36.5 37 54.5 38 78.0 39 104.5 40 139.0 41 163.5 42 170.0 43 196.0 44 214.5 45 229.0 46 232.5 47 221.0 48 220.0 49 206.0 50 188.0 51 177.5 52 158.5 53 149.0 54 132.5 55 108.5 56 110.0 57 101.0 58 81.5 59 68.0 60 57.5 61 43.5 62 40.5 63 37.5 64 26.0 65 21.0 66 12.0 67 8.0 68 7.0 69 3.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.2 2 0.3 3 0.3 4 0.3 5 0.3 6 1.15 7 2.15 8 100.0 9 2.225 10-11 1.4874999999999998 12-13 1.7500000000000002 14-15 3.3625000000000003 16-17 4.075 18-19 3.75 20-21 4.175 22-23 3.8249999999999997 24-25 4.0 26-27 4.0 28-29 4.1000000000000005 30-31 4.5375 32-33 4.5125 34-35 3.8249999999999997 36-37 2.9250000000000003 38-39 3.05 40-41 3.5749999999999997 42-43 3.7375 44-45 3.3875 46-47 3.125 48-49 2.9125 50-51 1.825 52-53 1.05 54-55 0.5875 56-57 0.625 58-59 0.625 60-61 0.625 62-63 0.625 64-65 0.6375 66-67 0.675 68-69 1.15 70-71 1.4125 72-73 1.625 74-75 1.9875 76-77 2.0 78-79 2.35 80-81 2.1375 82-83 1.9625 84-85 2.0500000000000003 86-87 2.15 88-89 2.3625 90-91 2.8875 92-93 2.625 94-95 2.9000000000000004 96-97 3.1375 98-99 3.2 100-101 3.35 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150582 spots for ERR10610827.sra Written 1150582 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra Read 1150571 spots for ERR10610827.sra Written 1150571 spots for ERR10610827.sra SRR ids: ['ERR10610827.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x8tya0jv ERR10610827.sra spots: 23011431 blocks: [[1, 1150571], [1150572, 2301142], [2301143, 3451713], [3451714, 4602284], [4602285, 5752855], [5752856, 6903426], [6903427, 8053997], [8053998, 9204568], [9204569, 10355139], [10355140, 11505710], [11505711, 12656281], [12656282, 13806852], [13806853, 14957423], [14957424, 16107994], [16107995, 17258565], [17258566, 18409136], [18409137, 19559707], [19559708, 20710278], [20710279, 21860849], [21860850, 23011431]] ERR10610827 file size 5551380 ERR10610827 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610827 ERR10610827_1.fastq ERR10610827_2.fastq Input file: ERR10610827_1.fastq Paired file: ERR10610827_2.fastq trimmed: ERR10610827-trimmed-pair1.fastq, ERR10610827-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:28:20 2024 >> started Fri Dec 6 20:28:42 2024 >> done (21.689s) 23011431 read pairs processed; of these: 91375 ( 0.40%) short read pairs filtered out after trimming by size control 7385 ( 0.03%) empty read pairs filtered out after trimming by size control 22912671 (99.57%) read pairs available; of these: 684888 ( 2.99%) trimmed read pairs available after processing 22227783 (97.01%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 4 0.00% 25 6 0.00% 26 5 0.00% 27 6 0.00% 28 11 0.00% 29 7 0.00% 30 3 0.00% 31 16 0.00% 32 12 0.00% 33 9 0.00% 34 18 0.00% 35 21 0.00% 36 24 0.00% 37 39 0.00% 38 41 0.00% 39 53 0.00% 40 50 0.00% 41 68 0.00% 42 64 0.00% 43 79 0.00% 44 88 0.00% 45 109 0.00% 46 140 0.00% 47 153 0.00% 48 189 0.00% 49 202 0.00% 50 283 0.00% 51 297 0.00% 52 362 0.00% 53 352 0.00% 54 441 0.00% 55 453 0.00% 56 547 0.00% 57 595 0.00% 58 891 0.00% 59 3211 0.01% 60 45467 0.20% 61 966 0.00% 62 977 0.00% 63 1397 0.01% 64 1619 0.01% 65 2519 0.01% 66 2236 0.01% 67 4364 0.02% 68 3416 0.01% 69 2245 0.01% 70 2369 0.01% 71 2933 0.01% 72 3137 0.01% 73 3921 0.02% 74 4065 0.02% 75 4732 0.02% 76 4936 0.02% 77 5578 0.02% 78 6265 0.03% 79 7576 0.03% 80 8555 0.04% 81 8984 0.04% 82 10482 0.05% 83 12489 0.05% 84 13434 0.06% 85 14624 0.06% 86 15577 0.07% 87 16935 0.07% 88 19088 0.08% 89 21061 0.09% 90 23038 0.10% 91 26209 0.11% 92 28077 0.12% 93 31498 0.14% 94 34316 0.15% 95 37551 0.16% 96 39686 0.17% 97 44928 0.20% 98 48635 0.21% 99 52864 0.23% 100 57276 0.25% 101 22227783 97.01% 22912671 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=1.00 fanout-score-rank=32 prefix-density=0.01 prefix-fanout=1.0 sequence=ATCGGAAGAGCACACGTCTGAACTCCAGTCACTAATGCGCATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=67.23 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=11.5 sequence=ATCATCATCATCCCCGCACCCCATCAACTGCTACGTACGGATGAACTAATTAACACACGCATGCATGCAAATATACGATGCTTAATTAATTAACACCGATCGATCCCCATTAAAACCAAACCACATCGATCAGACGTCGAAGGTGTTCTTG criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=30 prefix-density=0.17 prefix-fanout=2.0 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=8 fanout-score=11.70 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.7 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA ERR10610827 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:29:30 Started mapping on | Dec 06 20:29:30 Finished on | Dec 06 20:31:11 Mapping speed, Million of reads per hour | 816.69 Number of input reads | 22912671 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 21350696 Uniquely mapped reads % | 93.18% Average mapped length | 200.52 Number of splices: Total | 15200911 Number of splices: Annotated (sjdb) | 14270241 Number of splices: GT/AG | 14967443 Number of splices: GC/AG | 181071 Number of splices: AT/AC | 6136 Number of splices: Non-canonical | 46261 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 714556 % of reads mapped to multiple loci | 3.12% Number of reads mapped to too many loci | 47402 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.18% % of reads unmapped: other | 1.31% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 897867 897867 897867 N_multimapping 714556 714556 714556 N_noFeature 853695 20756335 976577 N_ambiguous 546301 2161 76018 UnstrandedReadsAssigned:19950700 PositiveStrandReadsAssigned:592200 NegativeStrandReadsAssigned:20298101 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610827 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610827-trimmed-pair1.fastq ERR10610827-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,912,671 reads, 20,559,821 reads pseudoaligned [quant] estimated average fragment length: 188.672 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52973 ERR10610827.ke.tsv 35125 ERR10610827.se.tsv 88098 total ==> ERR10610827.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 748.543 0 0 PNS24247 1044 856.328 98.5798 8.45653 PNS24249 1928 1740.33 52.0831 2.19842 PNS24246 1044 856.328 98.5798 8.45653 PNS24248 1044 856.328 98.5798 8.45653 PNS24244 1471 1283.33 68.1774 3.90254 PNS24243 293 122.398 0 0 KQK14069 1603 1415.33 3195.14 165.835 KQK14071 474 289.3 48.8795 12.4115 ==> ERR10610827.se.tsv <== BRADI_1g14170v3 3732 BRADI_1g53295v3 546 BRADI_1g59795v3 621 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 677 BRADI_1g74790v3 45 BRADI_1g09890v3 0 BRADI_1g77505v3 454 BRADI_1g48960v3 0 ERR10610827 completed mapping pipeline successfully