Starting /dee2/code/volunteer_pipeline.sh ERR10610828 current disk space = 1549524328448 free memory = 1385069280 ERR10610828 SRAfilesize 15e81ff824cf022e26bd783fe24d0356 ERR10610828.sra ERR10610828.sra file validated ERR10610828 is paired end ERR10610828 is conventional basespace ERR10610828 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610828_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.72975 32.0 18.0 33.0 18.0 33.0 2 26.8495 28.0 18.0 32.0 18.0 33.0 3 29.18375 32.0 27.0 33.0 18.0 33.0 4 29.73225 32.0 30.0 33.0 15.0 33.0 5 29.637 32.0 30.0 33.0 15.0 33.0 6 31.55825 35.0 29.0 38.0 16.0 38.0 7 32.342 36.0 29.0 38.0 16.0 38.0 8 32.1115 36.0 29.0 38.0 16.0 38.0 9 32.81 37.0 29.0 38.0 16.0 38.0 10-11 33.139125 37.5 31.0 38.0 16.0 38.0 12-13 33.341750000000005 38.0 32.0 38.0 16.0 38.0 14-15 33.245125 38.0 32.0 38.0 16.0 38.0 16-17 33.147625000000005 38.0 31.0 38.0 16.0 38.0 18-19 33.33225 38.0 33.0 38.0 16.0 38.0 20-21 33.502125 38.0 33.0 38.0 16.0 38.0 22-23 33.62025 38.0 33.5 38.0 16.0 38.0 24-25 33.135999999999996 38.0 32.0 38.0 16.0 38.0 26-27 33.45975 38.0 33.0 38.0 16.0 38.0 28-29 33.68075 38.0 33.5 38.0 16.0 38.0 30-31 33.727875 38.0 34.0 38.0 16.0 38.0 32-33 33.6625 38.0 33.0 38.0 16.0 38.0 34-35 33.658625 38.0 33.0 38.0 16.0 38.0 36-37 33.51475 38.0 33.0 38.0 16.0 38.0 38-39 33.8065 38.0 34.0 38.0 16.0 38.0 40-41 33.640125 38.0 33.0 38.0 16.0 38.0 42-43 33.7745 38.0 33.5 38.0 16.0 38.0 44-45 33.88825 38.0 34.0 38.0 16.0 38.0 46-47 33.618375 38.0 33.5 38.0 16.0 38.0 48-49 33.733375 38.0 33.5 38.0 16.0 38.0 50-51 33.602000000000004 38.0 33.0 38.0 16.0 38.0 52-53 33.5165 38.0 33.0 38.0 16.0 38.0 54-55 33.7055 38.0 33.0 38.0 16.0 38.0 56-57 33.66775 38.0 33.5 38.0 16.0 38.0 58-59 33.389625 38.0 33.0 38.0 16.0 38.0 60-61 33.458375000000004 38.0 33.0 38.0 16.0 38.0 62-63 33.45525 38.0 33.0 38.0 16.0 38.0 64-65 33.602875 38.0 33.0 38.0 16.0 38.0 66-67 33.624875 38.0 33.0 38.0 16.0 38.0 68-69 33.692 38.0 33.0 38.0 16.0 38.0 70-71 33.6235 38.0 33.5 38.0 16.0 38.0 72-73 33.42075 38.0 33.0 38.0 16.0 38.0 74-75 33.571875 38.0 33.0 38.0 16.0 38.0 76-77 33.4375 38.0 33.0 38.0 15.5 38.0 78-79 33.43575 38.0 32.5 38.0 16.0 38.0 80-81 33.508375 38.0 33.0 38.0 15.5 38.0 82-83 33.13775 38.0 32.0 38.0 15.0 38.0 84-85 33.3335 38.0 33.0 38.0 15.5 38.0 86-87 33.239374999999995 38.0 32.5 38.0 15.5 38.0 88-89 33.058875 38.0 33.0 38.0 15.0 38.0 90-91 33.304500000000004 38.0 33.0 38.0 15.0 38.0 92-93 33.093 38.0 32.0 38.0 15.0 38.0 94-95 33.161625 38.0 32.5 38.0 15.0 38.0 96-97 33.12675 38.0 32.0 38.0 15.0 38.0 98-99 32.601124999999996 37.0 30.0 38.0 15.0 38.0 100-101 32.005875 36.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 18.0 19 38.0 20 65.0 21 50.0 22 73.0 23 76.0 24 94.0 25 89.0 26 96.0 27 99.0 28 106.0 29 106.0 30 144.0 31 171.0 32 193.0 33 217.0 34 285.0 35 334.0 36 709.0 37 1034.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.718852252705762 8.079536873898817 9.665240372514473 53.53637050088095 2 20.599999999999998 13.825000000000001 37.0 28.575 3 22.2 16.825000000000003 25.2 35.775 4 25.75 26.85 21.55 25.85 5 24.675 29.45 25.924999999999997 19.950000000000003 6 20.599999999999998 32.425 26.35 20.625 7 15.875 22.825 42.9 18.4 8 19.725 22.225 31.775 26.275 9 19.05 21.3 34.825 24.825 10-11 22.162499999999998 29.675 24.6 23.5625 12-13 21.512500000000003 23.3375 28.6125 26.5375 14-15 21.784284284284283 25.713213213213216 27.489989989989986 25.012512512512515 16-17 22.2430607651913 25.506376594148538 26.544136034008503 25.70642660665166 18-19 22.1875 25.624999999999996 27.200000000000003 24.9875 20-21 22.75 25.637500000000003 27.1375 24.474999999999998 22-23 22.412499999999998 25.837500000000002 27.200000000000003 24.55 24-25 21.2625 26.4125 27.1 25.224999999999998 26-27 22.125 26.7125 26.7625 24.4 28-29 22.075 25.9875 27.150000000000002 24.7875 30-31 21.0375 25.775 27.287499999999998 25.900000000000002 32-33 21.825 26.5625 27.025 24.587500000000002 34-35 22.075 26.674999999999997 25.974999999999998 25.275 36-37 21.925 26.200000000000003 26.025 25.85 38-39 22.1875 26.8375 26.1625 24.8125 40-41 22.400000000000002 25.525 27.0625 25.0125 42-43 21.8125 26.650000000000002 26.55 24.9875 44-45 21.95 26.6 26.437500000000004 25.0125 46-47 22.675 26.400000000000002 25.912499999999998 25.0125 48-49 22.1375 25.912499999999998 26.275 25.674999999999997 50-51 22.162499999999998 26.200000000000003 26.7625 24.875 52-53 22.3875 26.650000000000002 26.0625 24.9 54-55 22.2125 26.1625 26.2125 25.412499999999998 56-57 22.112499999999997 26.087500000000002 25.974999999999998 25.825 58-59 22.25 25.85 26.637499999999996 25.2625 60-61 22.025 25.9625 26.5875 25.424999999999997 62-63 22.775000000000002 25.7 26.125 25.4 64-65 23.525 26.525 25.412499999999998 24.5375 66-67 22.2625 26.125 26.3 25.3125 68-69 22.825 25.674999999999997 26.7125 24.7875 70-71 22.5625 25.85 25.25 26.337500000000002 72-73 22.8625 25.662499999999998 26.2625 25.2125 74-75 23.075000000000003 25.4 26.5375 24.9875 76-77 23.325000000000003 26.025 25.525 25.124999999999996 78-79 22.375 26.237500000000004 25.474999999999998 25.912499999999998 80-81 22.25 26.174999999999997 26.6625 24.9125 82-83 23.775 25.85 25.2125 25.162499999999998 84-85 22.125 26.5625 25.575 25.7375 86-87 22.5625 26.9625 25.55 24.925 88-89 21.8875 26.737499999999997 25.35 26.025 90-91 23.125 25.9875 25.4625 25.424999999999997 92-93 23.075000000000003 25.7875 26.85 24.2875 94-95 23.1125 26.137500000000003 25.15 25.6 96-97 23.3375 26.5 26.137500000000003 24.025 98-99 23.0625 25.2625 26.6 25.074999999999996 100-101 23.6375 25.887500000000003 25.8125 24.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 1.0 27 1.5 28 1.0 29 2.0 30 5.0 31 7.5 32 10.0 33 16.0 34 24.0 35 32.5 36 47.0 37 68.5 38 88.0 39 107.0 40 134.0 41 165.5 42 185.0 43 201.5 44 230.5 45 241.0 46 240.0 47 226.0 48 192.0 49 186.5 50 194.5 51 179.0 52 158.5 53 141.0 54 114.5 55 95.0 56 90.5 57 89.0 58 89.0 59 83.0 60 70.0 61 61.5 62 48.0 63 39.0 64 39.0 65 30.0 66 21.5 67 16.0 68 11.0 69 7.5 70 3.5 71 1.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.1 16-17 0.025 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98887765419616 97.89999999999999 2 0.9605662285136503 1.9 3 0.0 0.0 4 0.05055611729019212 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610828 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610828_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.2655 32.0 27.0 33.0 18.0 33.0 2 29.81175 32.0 28.0 33.0 18.0 34.0 3 26.58775 30.0 18.0 33.0 18.0 33.0 4 28.33875 32.0 27.0 33.0 15.0 33.0 5 29.1615 32.0 27.0 33.0 15.0 34.0 6 26.53925 29.0 16.0 37.0 15.0 38.0 7 29.98 33.0 26.0 38.0 16.0 38.0 8 31.88925 36.0 29.0 38.0 16.0 38.0 9 32.40225 37.0 29.0 38.0 16.0 38.0 10-11 32.929 37.0 30.0 38.0 16.0 38.0 12-13 33.13275 38.0 31.0 38.0 16.0 38.0 14-15 33.243375 38.0 32.0 38.0 16.0 38.0 16-17 33.074125 38.0 31.0 38.0 16.0 38.0 18-19 32.929500000000004 38.0 31.0 38.0 16.0 38.0 20-21 33.042249999999996 38.0 30.5 38.0 16.0 38.0 22-23 33.218625 38.0 32.0 38.0 16.0 38.0 24-25 32.775125 37.0 29.0 38.0 16.0 38.0 26-27 32.993624999999994 37.5 30.0 38.0 16.0 38.0 28-29 31.24275 36.0 23.5 38.0 16.0 38.0 30-31 32.62475 37.0 29.0 38.0 16.0 38.0 32-33 33.223749999999995 38.0 31.5 38.0 16.0 38.0 34-35 33.1745 38.0 31.0 38.0 16.0 38.0 36-37 32.69475 37.5 30.0 38.0 16.0 38.0 38-39 33.146375 37.5 31.0 38.0 16.0 38.0 40-41 33.363 38.0 32.5 38.0 16.0 38.0 42-43 33.099875 38.0 31.0 38.0 16.0 38.0 44-45 33.419624999999996 38.0 33.0 38.0 16.0 38.0 46-47 33.22687500000001 38.0 32.0 38.0 16.0 38.0 48-49 33.406875 38.0 32.5 38.0 16.0 38.0 50-51 33.46 38.0 33.0 38.0 16.0 38.0 52-53 33.494875 38.0 33.0 38.0 16.0 38.0 54-55 33.53175 38.0 33.0 38.0 16.0 38.0 56-57 33.280625 38.0 33.0 38.0 16.0 38.0 58-59 33.445125000000004 38.0 33.0 38.0 16.0 38.0 60-61 33.430375 38.0 33.0 38.0 16.0 38.0 62-63 33.285124999999994 38.0 32.0 38.0 16.0 38.0 64-65 33.346125 38.0 33.0 38.0 16.0 38.0 66-67 33.2775 38.0 33.0 38.0 16.0 38.0 68-69 33.420874999999995 38.0 33.0 38.0 16.0 38.0 70-71 33.22125 38.0 32.5 38.0 16.0 38.0 72-73 33.203125 38.0 31.0 38.0 16.0 38.0 74-75 33.13475 37.5 32.0 38.0 16.0 38.0 76-77 33.3665 38.0 33.0 38.0 16.0 38.0 78-79 32.96525 37.5 31.0 38.0 15.5 38.0 80-81 32.729625 37.0 30.0 38.0 15.5 38.0 82-83 32.785375 37.0 31.0 38.0 15.0 38.0 84-85 33.070750000000004 38.0 31.0 38.0 15.0 38.0 86-87 32.755375 37.5 30.5 38.0 15.0 38.0 88-89 32.9145 38.0 31.0 38.0 15.0 38.0 90-91 32.86125 38.0 31.5 38.0 15.0 38.0 92-93 32.834999999999994 38.0 31.0 38.0 15.0 38.0 94-95 32.7305 38.0 31.0 38.0 15.0 38.0 96-97 32.730625 37.0 30.5 38.0 15.0 38.0 98-99 32.772999999999996 37.5 31.0 38.0 15.0 38.0 100-101 30.878125 36.0 27.0 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 17.0 18 33.0 19 52.0 20 71.0 21 72.0 22 80.0 23 82.0 24 81.0 25 91.0 26 98.0 27 113.0 28 106.0 29 127.0 30 144.0 31 166.0 32 185.0 33 241.0 34 286.0 35 406.0 36 646.0 37 901.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.825000000000003 14.95 14.025000000000002 40.2 2 25.575 22.8 34.75 16.875 3 19.575 23.3 33.95 23.175 4 25.0 31.125000000000004 20.4 23.474999999999998 5 27.125 33.675 21.025 18.175 6 21.4 32.175 26.900000000000002 19.525000000000002 7 21.2 18.5 36.199999999999996 24.099999999999998 8 23.325000000000003 22.15 26.674999999999997 27.85 9 23.425 22.525000000000002 28.425 25.624999999999996 10-11 25.874999999999996 28.7 21.15 24.275 12-13 24.837500000000002 23.150000000000002 25.924999999999997 26.087500000000002 14-15 24.3 25.874999999999996 26.474999999999998 23.35 16-17 24.837500000000002 26.1 25.412499999999998 23.65 18-19 24.9 25.8625 25.5 23.7375 20-21 25.424999999999997 26.1 25.5125 22.9625 22-23 26.437500000000004 25.974999999999998 24.9 22.6875 24-25 24.75 26.5 24.75 24.0 26-27 25.674999999999997 25.7 25.1875 23.4375 28-29 25.0375 26.2875 25.2375 23.4375 30-31 25.0125 26.3 25.0625 23.625 32-33 25.887500000000003 26.8625 24.9375 22.3125 34-35 25.35 25.8625 25.387500000000003 23.400000000000002 36-37 24.708829054477143 25.447714464621164 25.17219787100814 24.671258609893552 38-39 25.168792198049513 26.506626656664167 25.468867216804203 22.85571392848212 40-41 25.568892223055762 25.76894223555889 25.056264066016503 23.605901475368842 42-43 25.323127117580626 25.323127117580626 25.197640858326015 24.156104906512738 44-45 24.74368592148037 26.506626656664167 26.019004751187797 22.73068267066767 46-47 25.942156003505694 26.60573431826718 24.61499937398272 22.837110304244398 48-49 25.090636329541194 25.653206650831358 26.078259782472806 23.177897237154642 50-51 26.150000000000002 25.6125 25.087500000000002 23.150000000000002 52-53 25.900000000000002 25.837500000000002 24.8125 23.45 54-55 25.5625 26.2875 25.0375 23.1125 56-57 25.337500000000002 27.0 25.687500000000004 21.975 58-59 25.937500000000004 26.137500000000003 25.112499999999997 22.8125 60-61 25.25 26.05 25.8625 22.8375 62-63 24.228028503562946 25.815726965870734 26.578322290286287 23.377922240280036 64-65 25.9875 25.074999999999996 25.4375 23.5 66-67 24.349999999999998 26.087500000000002 26.4125 23.150000000000002 68-69 24.637500000000003 26.787499999999998 25.4625 23.1125 70-71 26.040755094386796 25.30316289536192 25.99074884360545 22.665333166645834 72-73 25.874999999999996 25.174999999999997 25.4625 23.4875 74-75 25.0625 26.0 25.95 22.9875 76-77 25.412499999999998 25.587500000000002 26.400000000000002 22.6 78-79 25.174999999999997 25.9625 26.424999999999997 22.4375 80-81 25.162499999999998 26.025 25.5 23.3125 82-83 26.5375 25.8 25.162499999999998 22.5 84-85 24.825 26.637499999999996 25.7125 22.825 86-87 24.887500000000003 26.2625 26.275 22.575 88-89 25.5 25.5625 25.9875 22.95 90-91 25.6125 26.5375 25.624999999999996 22.225 92-93 25.025 26.05 26.150000000000002 22.775000000000002 94-95 26.075 25.9625 24.8625 23.1 96-97 25.2 26.35 26.1 22.35 98-99 25.424999999999997 26.637499999999996 25.662499999999998 22.275 100-101 25.7625 26.637499999999996 25.637500000000003 21.9625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 1.5 27 2.0 28 3.0 29 3.5 30 4.0 31 6.5 32 7.5 33 10.5 34 17.5 35 22.5 36 33.0 37 50.0 38 74.0 39 114.0 40 145.0 41 146.5 42 174.0 43 210.5 44 206.5 45 208.5 46 208.5 47 210.0 48 212.0 49 185.5 50 164.5 51 161.5 52 167.0 53 149.0 54 131.5 55 134.5 56 123.0 57 106.0 58 94.5 59 91.5 60 81.0 61 68.0 62 65.5 63 55.0 64 40.5 65 34.5 66 28.0 67 16.5 68 10.5 69 6.0 70 2.5 71 3.0 72 1.5 73 0.0 74 1.0 75 1.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.1875 38-39 0.025 40-41 0.025 42-43 0.3875 44-45 0.025 46-47 0.1625 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0125 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127762 spots for ERR10610828.sra Written 127762 spots for ERR10610828.sra Read 127781 spots for ERR10610828.sra Written 127781 spots for ERR10610828.sra SRR ids: ['ERR10610828.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8tlzsdlp ERR10610828.sra spots: 2555259 blocks: [[1, 127762], [127763, 255524], [255525, 383286], [383287, 511048], [511049, 638810], [638811, 766572], [766573, 894334], [894335, 1022096], [1022097, 1149858], [1149859, 1277620], [1277621, 1405382], [1405383, 1533144], [1533145, 1660906], [1660907, 1788668], [1788669, 1916430], [1916431, 2044192], [2044193, 2171954], [2171955, 2299716], [2299717, 2427478], [2427479, 2555259]] ERR10610828 file size 611691 ERR10610828 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610828 ERR10610828_1.fastq ERR10610828_2.fastq Input file: ERR10610828_1.fastq Paired file: ERR10610828_2.fastq trimmed: ERR10610828-trimmed-pair1.fastq, ERR10610828-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:26:22 2024 >> started Fri Dec 6 20:26:37 2024 >> done (14.271s) 2555259 read pairs processed; of these: 8 ( 0.00%) short read pairs filtered out after trimming by size control 128 ( 0.01%) empty read pairs filtered out after trimming by size control 2555123 (99.99%) read pairs available; of these: 56776 ( 2.22%) trimmed read pairs available after processing 2498347 (97.78%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 1 0.00% 31 1 0.00% 32 0 0.00% 33 1 0.00% 34 0 0.00% 35 1 0.00% 36 3 0.00% 37 5 0.00% 38 5 0.00% 39 4 0.00% 40 0 0.00% 41 6 0.00% 42 4 0.00% 43 7 0.00% 44 11 0.00% 45 6 0.00% 46 7 0.00% 47 10 0.00% 48 10 0.00% 49 10 0.00% 50 17 0.00% 51 14 0.00% 52 18 0.00% 53 26 0.00% 54 26 0.00% 55 25 0.00% 56 27 0.00% 57 45 0.00% 58 57 0.00% 59 38 0.00% 60 47 0.00% 61 76 0.00% 62 72 0.00% 63 92 0.00% 64 71 0.00% 65 117 0.00% 66 108 0.00% 67 122 0.00% 68 137 0.01% 69 176 0.01% 70 193 0.01% 71 216 0.01% 72 236 0.01% 73 268 0.01% 74 351 0.01% 75 374 0.01% 76 418 0.02% 77 482 0.02% 78 542 0.02% 79 652 0.03% 80 669 0.03% 81 780 0.03% 82 914 0.04% 83 968 0.04% 84 1068 0.04% 85 1212 0.05% 86 1344 0.05% 87 1503 0.06% 88 1787 0.07% 89 1955 0.08% 90 2124 0.08% 91 2409 0.09% 92 2669 0.10% 93 2908 0.11% 94 3145 0.12% 95 3429 0.13% 96 3540 0.14% 97 4186 0.16% 98 4588 0.18% 99 5025 0.20% 100 5416 0.21% 101 2498347 97.78% 2555123 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=14 prefix-density=0.38 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=49.66 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=2.4 sequence=TATATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.71 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=2.4 sequence=CCTAAGCAAGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=42.36 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.6 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC ERR10610828 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:28:16 Started mapping on | Dec 06 20:28:17 Finished on | Dec 06 20:32:21 Mapping speed, Million of reads per hour | 37.70 Number of input reads | 2555123 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 2291128 Uniquely mapped reads % | 89.67% Average mapped length | 200.10 Number of splices: Total | 1560387 Number of splices: Annotated (sjdb) | 1460370 Number of splices: GT/AG | 1536192 Number of splices: GC/AG | 18701 Number of splices: AT/AC | 506 Number of splices: Non-canonical | 4988 Mismatch rate per base, % | 0.93% Deletion rate per base | 0.02% Deletion average length | 2.27 Insertion rate per base | 0.01% Insertion average length | 1.89 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 61924 % of reads mapped to multiple loci | 2.42% Number of reads mapped to too many loci | 2514 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.91% % of reads unmapped: other | 0.90% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 202071 202071 202071 N_multimapping 61924 61924 61924 N_noFeature 76744 2230236 88357 N_ambiguous 57429 206 8399 UnstrandedReadsAssigned:2156955 PositiveStrandReadsAssigned:60686 NegativeStrandReadsAssigned:2194372 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610828 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610828-trimmed-pair1.fastq ERR10610828-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,555,123 reads, 2,256,390 reads pseudoaligned [quant] estimated average fragment length: 180.157 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,034 rounds 52973 ERR10610828.ke.tsv 35125 ERR10610828.se.tsv 88098 total ==> ERR10610828.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 757.015 0 0 PNS24247 1044 864.843 7.3092 5.65964 PNS24249 1928 1748.84 10.0724 3.8569 PNS24246 1044 864.843 7.3092 5.65964 PNS24248 1044 864.843 7.3092 5.65964 PNS24244 1471 1291.84 0 0 PNS24243 293 124.123 0 0 KQK14069 1603 1423.84 64.3027 30.2429 KQK14071 474 296.488 2.66371 6.01639 ==> ERR10610828.se.tsv <== BRADI_1g14170v3 87 BRADI_1g53295v3 22 BRADI_1g59795v3 45 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 48 BRADI_1g74790v3 13 BRADI_1g09890v3 0 BRADI_1g77505v3 40 BRADI_1g48960v3 0 ERR10610828 completed mapping pipeline successfully