Starting /dee2/code/volunteer_pipeline.sh ERR10610829 current disk space = 1549512867840 free memory = 1603577980 ERR10610829 SRAfilesize b6ee0a225ac9607d2a52554eecb4b63b ERR10610829.sra ERR10610829.sra file validated ERR10610829 is paired end ERR10610829 is conventional basespace ERR10610829 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610829_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.783 32.0 18.0 33.0 18.0 33.0 2 23.67525 18.0 18.0 32.0 18.0 33.0 3 29.1625 30.0 27.0 31.0 25.0 33.0 4 31.632 33.0 32.0 33.0 28.0 33.0 5 31.64575 33.0 32.0 33.0 30.0 33.0 6 34.97625 37.0 34.0 38.0 29.0 38.0 7 36.03025 38.0 36.0 38.0 33.0 38.0 8 36.62875 38.0 38.0 38.0 34.0 38.0 9 36.83725 38.0 38.0 38.0 35.0 38.0 10-11 36.817375 38.0 38.0 38.0 35.5 38.0 12-13 36.739625000000004 38.0 38.0 38.0 35.0 38.0 14-15 36.881125 38.0 38.0 38.0 35.5 38.0 16-17 36.92225 38.0 38.0 38.0 36.0 38.0 18-19 36.96525 38.0 38.0 38.0 36.0 38.0 20-21 36.9795 38.0 38.0 38.0 36.0 38.0 22-23 36.980125 38.0 38.0 38.0 36.0 38.0 24-25 36.975125 38.0 38.0 38.0 36.0 38.0 26-27 36.95375 38.0 38.0 38.0 36.0 38.0 28-29 36.955375 38.0 38.0 38.0 36.0 38.0 30-31 36.965875 38.0 38.0 38.0 36.0 38.0 32-33 37.04474999999999 38.0 38.0 38.0 37.0 38.0 34-35 37.003125 38.0 38.0 38.0 36.0 38.0 36-37 36.945499999999996 38.0 38.0 38.0 36.0 38.0 38-39 36.943 38.0 38.0 38.0 36.0 38.0 40-41 36.95125 38.0 38.0 38.0 36.0 38.0 42-43 36.989875 38.0 38.0 38.0 36.0 38.0 44-45 36.989125 38.0 38.0 38.0 36.0 38.0 46-47 36.963125 38.0 38.0 38.0 36.0 38.0 48-49 36.919 38.0 38.0 38.0 36.0 38.0 50-51 36.72987500000001 38.0 38.0 38.0 35.5 38.0 52-53 36.659625000000005 38.0 38.0 38.0 36.0 38.0 54-55 36.6075 38.0 38.0 38.0 35.5 38.0 56-57 36.768875 38.0 38.0 38.0 35.5 38.0 58-59 36.83925 38.0 38.0 38.0 35.5 38.0 60-61 36.8895 38.0 38.0 38.0 36.0 38.0 62-63 36.914625 38.0 38.0 38.0 36.0 38.0 64-65 36.681375 38.0 38.0 38.0 35.5 38.0 66-67 36.83625000000001 38.0 38.0 38.0 35.5 38.0 68-69 36.844625 38.0 38.0 38.0 36.0 38.0 70-71 36.8205 38.0 38.0 38.0 35.5 38.0 72-73 36.794624999999996 38.0 38.0 38.0 35.5 38.0 74-75 36.81225 38.0 38.0 38.0 36.0 38.0 76-77 36.864875 38.0 38.0 38.0 36.0 38.0 78-79 36.822625 38.0 38.0 38.0 36.0 38.0 80-81 36.722 38.0 38.0 38.0 35.0 38.0 82-83 36.757 38.0 38.0 38.0 35.0 38.0 84-85 36.84225 38.0 38.0 38.0 35.5 38.0 86-87 36.85275 38.0 38.0 38.0 36.0 38.0 88-89 36.730875 38.0 38.0 38.0 35.5 38.0 90-91 36.55575 38.0 38.0 38.0 35.0 38.0 92-93 36.481375 38.0 38.0 38.0 35.0 38.0 94-95 36.51075 38.0 38.0 38.0 35.0 38.0 96-97 36.337374999999994 38.0 38.0 38.0 34.0 38.0 98-99 36.257374999999996 38.0 38.0 38.0 34.0 38.0 100-101 36.012874999999994 38.0 37.5 38.0 32.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 8.0 20 13.0 21 15.0 22 13.0 23 17.0 24 13.0 25 15.0 26 20.0 27 29.0 28 28.0 29 16.0 30 34.0 31 48.0 32 70.0 33 66.0 34 82.0 35 165.0 36 422.0 37 2925.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.0 8.225 10.125 50.64999999999999 2 21.0 13.8 36.6 28.599999999999998 3 22.375 17.224999999999998 23.7 36.7 4 26.75 27.200000000000003 21.05 25.0 5 25.525 28.799999999999997 25.650000000000002 20.025000000000002 6 20.575 33.2 25.6 20.625 7 16.650000000000002 22.925 40.125 20.3 8 20.175 22.05 30.725 27.05 9 20.150000000000002 20.349999999999998 33.800000000000004 25.7 10-11 22.5875 29.4125 23.6875 24.3125 12-13 22.112499999999997 24.15 27.0125 26.724999999999998 14-15 22.0625 25.324999999999996 26.7125 25.900000000000002 16-17 23.175 24.887500000000003 26.700000000000003 25.2375 18-19 22.0 25.387500000000003 26.7625 25.85 20-21 22.565320665083135 25.690711338917367 25.653206650831358 26.090761345168147 22-23 22.400000000000002 25.7125 26.5875 25.3 24-25 22.6875 25.05 25.5375 26.724999999999998 26-27 22.0 26.237500000000004 26.6 25.162499999999998 28-29 22.2625 25.662499999999998 26.5375 25.5375 30-31 21.6875 25.374999999999996 26.187500000000004 26.75 32-33 21.762500000000003 26.05 26.687499999999996 25.5 34-35 22.650000000000002 25.2875 26.0375 26.025 36-37 22.0 26.0375 25.4 26.5625 38-39 21.762500000000003 26.0125 27.287499999999998 24.9375 40-41 22.425 26.474999999999998 25.05 26.05 42-43 23.025000000000002 25.587500000000002 26.4625 24.925 44-45 22.237499999999997 25.7125 26.7125 25.337500000000002 46-47 23.1 25.5375 25.9875 25.374999999999996 48-49 22.479939819458377 25.175526579739216 25.852557673019056 26.49197592778335 50-51 23.326215299585478 25.28576811958297 26.11480969727421 25.273206883557343 52-53 22.59894126543988 26.506175951600706 25.40962944290396 25.485253340055458 54-55 23.598189590143324 25.660045260246417 24.566255971838068 26.175509177772188 56-57 23.15776304266233 25.634930564243714 25.234580257725508 25.972726135368447 58-59 23.1 26.125 25.5625 25.2125 60-61 22.037499999999998 26.674999999999997 25.55 25.7375 62-63 22.7 25.637500000000003 25.85 25.8125 64-65 23.28148519819368 24.73657802308078 26.555444054189664 25.426492724535876 66-67 22.893223305826456 24.90622655663916 26.294073518379594 25.906476619154787 68-69 22.8592889334001 24.59939909864797 26.53980971457186 26.00150225338007 70-71 23.6125 25.912499999999998 25.85 24.625 72-73 22.537499999999998 26.0625 25.45 25.95 74-75 22.4375 25.75 27.5125 24.3 76-77 23.0 26.275 25.825 24.9 78-79 22.8 25.775 25.2125 26.2125 80-81 23.200000000000003 25.0 25.4625 26.337500000000002 82-83 23.525 25.8625 25.412499999999998 25.2 84-85 22.2 25.575 25.4875 26.737499999999997 86-87 22.85 26.087500000000002 25.55 25.5125 88-89 23.09904952476238 25.587793896948476 25.850425212606304 25.46273136568284 90-91 22.831279859190346 24.867990947950716 26.338948956499873 25.96178023635907 92-93 23.562712290854197 26.003270851679456 25.58812429236382 24.845892565102528 94-95 23.14756573153856 24.933953956472514 24.984274751541076 26.934205560447854 96-97 23.310640443772062 25.151285930408473 25.819465456379227 25.718608169440245 98-99 23.506378678792473 24.693697107490213 26.310471138057345 25.489453075659974 100-101 22.72612748803225 26.3920382968002 25.686570924666164 25.195263290501384 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 1.5 27 1.5 28 1.5 29 2.0 30 4.5 31 8.0 32 14.0 33 16.0 34 17.0 35 29.0 36 45.0 37 59.0 38 80.0 39 96.0 40 111.5 41 143.5 42 177.0 43 195.0 44 211.0 45 219.0 46 214.5 47 206.0 48 196.0 49 182.5 50 171.0 51 178.0 52 167.5 53 139.5 54 130.5 55 127.0 56 120.5 57 108.0 58 90.0 59 88.0 60 83.0 61 75.0 62 65.5 63 57.5 64 49.5 65 32.0 66 20.5 67 22.5 68 20.5 69 10.0 70 5.5 71 3.0 72 2.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0125 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.3 50-51 0.4875 52-53 0.8250000000000001 54-55 0.575 56-57 0.08750000000000001 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.35000000000000003 66-67 0.025 68-69 0.15 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.05 90-91 0.575 92-93 0.6375 94-95 0.6375 96-97 0.8500000000000001 98-99 1.0375 100-101 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.70558375634518 97.225 2 1.116751269035533 2.1999999999999997 3 0.12690355329949238 0.375 4 0.050761421319796954 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610829 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610829_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4595 33.0 33.0 34.0 32.0 34.0 2 32.43175 33.0 33.0 34.0 31.0 34.0 3 32.5095 33.0 33.0 34.0 31.0 34.0 4 32.4375 33.0 33.0 34.0 32.0 34.0 5 32.43975 33.0 33.0 34.0 32.0 34.0 6 36.2115 38.0 38.0 38.0 34.0 38.0 7 35.965 38.0 38.0 38.0 34.0 38.0 8 2.0 2.0 2.0 2.0 2.0 2.0 9 28.712 30.0 30.0 31.0 26.0 31.0 10-11 23.08 22.5 22.5 23.0 20.5 29.5 12-13 31.1235 33.0 31.5 34.0 27.0 34.0 14-15 35.0155 38.0 36.5 38.0 28.0 38.0 16-17 35.285124999999994 38.0 38.0 38.0 30.0 38.0 18-19 35.447 38.0 38.0 38.0 31.0 38.0 20-21 35.23825 38.0 38.0 38.0 29.0 38.0 22-23 35.37975 38.0 38.0 38.0 30.0 38.0 24-25 35.267875000000004 38.0 38.0 38.0 30.0 38.0 26-27 35.267375 38.0 38.0 38.0 29.5 38.0 28-29 35.228375 38.0 38.0 38.0 30.0 38.0 30-31 35.159000000000006 38.0 38.0 38.0 29.0 38.0 32-33 35.091875 38.0 38.0 38.0 28.5 38.0 34-35 35.272999999999996 38.0 38.0 38.0 29.0 38.0 36-37 35.551249999999996 38.0 38.0 38.0 30.0 38.0 38-39 35.64725 38.0 38.0 38.0 32.5 38.0 40-41 35.569375 38.0 38.0 38.0 32.0 38.0 42-43 35.36525 38.0 38.0 38.0 30.0 38.0 44-45 35.49225 38.0 38.0 38.0 31.0 38.0 46-47 35.565 38.0 38.0 38.0 31.5 38.0 48-49 35.635125 38.0 38.0 38.0 32.0 38.0 50-51 35.777 38.0 38.0 38.0 32.0 38.0 52-53 35.973625 38.0 38.0 38.0 33.0 38.0 54-55 36.112375 38.0 38.0 38.0 33.5 38.0 56-57 36.124875 38.0 38.0 38.0 33.0 38.0 58-59 36.094875 38.0 38.0 38.0 33.5 38.0 60-61 36.0985 38.0 38.0 38.0 33.5 38.0 62-63 36.113125 38.0 38.0 38.0 33.5 38.0 64-65 36.076375 38.0 38.0 38.0 34.0 38.0 66-67 36.08 38.0 38.0 38.0 33.5 38.0 68-69 35.985125 38.0 38.0 38.0 33.5 38.0 70-71 35.854625 38.0 38.0 38.0 33.0 38.0 72-73 35.760625000000005 38.0 38.0 38.0 32.5 38.0 74-75 35.623374999999996 38.0 38.0 38.0 31.5 38.0 76-77 35.601625 38.0 38.0 38.0 31.5 38.0 78-79 35.4785 38.0 38.0 38.0 31.0 38.0 80-81 35.502125 38.0 38.0 38.0 30.0 38.0 82-83 35.54774999999999 38.0 38.0 38.0 30.5 38.0 84-85 35.550375 38.0 38.0 38.0 31.0 38.0 86-87 35.507125 38.0 38.0 38.0 31.0 38.0 88-89 35.486375 38.0 38.0 38.0 31.0 38.0 90-91 35.410125 38.0 38.0 38.0 31.0 38.0 92-93 35.2875 38.0 38.0 38.0 29.0 38.0 94-95 35.299375 38.0 38.0 38.0 29.0 38.0 96-97 35.231125 38.0 38.0 38.0 29.0 38.0 98-99 35.236125 38.0 38.0 38.0 30.0 38.0 100-101 34.448625 38.0 36.0 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 0.0 4 1.0 5 5.0 6 13.0 7 1.0 8 14.0 9 11.0 10 10.0 11 5.0 12 5.0 13 4.0 14 2.0 15 1.0 16 3.0 17 7.0 18 12.0 19 16.0 20 20.0 21 22.0 22 25.0 23 26.0 24 25.0 25 28.0 26 35.0 27 31.0 28 47.0 29 51.0 30 50.0 31 60.0 32 75.0 33 86.0 34 139.0 35 257.0 36 2597.0 37 299.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.852130325814535 15.43859649122807 12.656641604010025 41.05263157894737 2 28.822495606326886 22.495606326889277 31.282952548330407 17.398945518453427 3 22.24453929199096 26.110971629425055 26.36203866432337 25.28245041426061 4 27.84333417022345 31.107205623901578 18.15214662314838 22.89731358272659 5 27.943760984182774 33.26638212402712 19.332161687170473 19.457695204619633 6 22.295414238662275 37.19280466176843 19.55915885482645 20.952622244742845 7 22.79580884232047 16.943521594684384 35.57372859698441 24.686940966010734 8 NaN NaN NaN NaN 9 23.657289002557544 22.225063938618923 28.286445012787727 25.831202046035806 10-11 23.164057528318697 28.560519282168766 21.445844469899452 26.829578719613085 12-13 25.361766945925364 23.61005331302361 25.095201827875098 25.932977913175932 14-15 25.251094514550605 26.139582796806593 24.182333247489055 24.426989441153747 16-17 26.382757725266163 26.29187224097637 23.539340431056868 23.786029602700598 18-19 26.428017575600933 24.79968984233652 24.399069527009562 24.373223055052986 20-21 26.086390840489198 25.787145459276605 24.069737184491284 24.05672651574291 22-23 25.605805364779062 26.020474277569004 24.5691330828042 23.804587274847737 24-25 26.345204055107875 25.65635560176761 23.888744476215233 24.10969586690928 26-27 25.399506301156293 26.33493568922957 24.931791607119656 23.33376640249448 28-29 26.217130955480343 25.90471231450143 23.53553762041135 24.342619109606872 30-31 25.649393029630595 26.040986816342514 24.99673671844407 23.31288343558282 32-33 25.453833093901007 25.179574245788167 24.696356275303643 24.670236385007183 34-35 25.69354420534094 25.36945812807882 24.41016333938294 24.526834327197303 36-37 24.9582530507386 26.589595375722542 25.09955041746949 23.352601156069362 38-39 25.69739041007842 25.414577709217124 24.97750353515876 23.9105283455457 40-41 26.058884297520663 25.012913223140497 25.206611570247933 23.72159090909091 42-43 25.938389852446285 25.550090603158164 24.47579601346104 24.035723530934508 44-45 25.432258064516127 26.670967741935485 23.780645161290323 24.116129032258065 46-47 26.22508038585209 25.569131832797424 24.79742765273312 23.408360128617364 48-49 26.412429378531073 25.051361068310218 25.462249614791986 23.073959938366716 50-51 25.564197373454036 26.290960091801608 24.760933316333038 23.383909218411322 52-53 26.397161323026232 26.016981371182357 24.12875427702446 23.457103028766948 54-55 25.151438667339725 26.097930338213022 24.86118122160525 23.889449772842 56-57 26.786165109820754 25.637465286543804 25.170411512244385 22.405958091391064 58-59 27.752525252525253 24.86111111111111 25.012626262626263 22.373737373737374 60-61 24.747474747474747 26.338383838383837 24.747474747474747 24.166666666666668 62-63 26.565656565656564 26.300505050505052 24.57070707070707 22.56313131313131 64-65 26.613616268788682 26.057850195781228 24.188455222937982 23.140078312492104 66-67 25.606366851945427 26.667508842849923 25.16422435573522 22.56189994946943 68-69 25.20613979449448 26.550805530889253 24.850945071673223 23.39210960294304 70-71 25.92215721190537 26.36733655558382 24.2686339353854 23.441872297125414 72-73 25.646249840825163 25.786323697949825 25.455240035655162 23.112186425569845 74-75 25.220165922144222 26.12635609444799 25.564773452456922 23.088704530950864 76-77 25.440613026819925 26.015325670498086 24.738186462324393 23.8058748403576 78-79 25.620363264261957 25.518035303146586 25.185469429521618 23.67613200306984 80-81 26.65814696485623 25.08626198083067 24.562300319488816 23.69329073482428 82-83 26.371523347792802 26.06532278642511 25.019137535085477 22.544016330696607 84-85 24.54348103690461 25.858766441067555 25.654450261780106 23.943302260247734 86-87 24.939312635748053 26.459690813849495 25.42481154976364 23.176185000638814 88-89 25.819252432155658 26.12647209421403 25.60163850486431 22.452636968766 90-91 25.496986020264206 25.676542259843533 26.510196229318968 22.316275490573297 92-93 25.691952844695027 25.871348026652996 25.512557662737056 22.924141465914914 94-95 25.917843388960204 26.03337612323492 25.057766367137358 22.991014120667522 96-97 25.25096525096525 25.855855855855857 25.353925353925355 23.539253539253536 98-99 26.034282768397986 26.57558963783993 25.11921639386519 22.270911199896894 100-101 26.363988133625693 26.33819166774152 24.86779311234361 22.43002708628918 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 8.0 1 8.0 2 4.5 3 0.5 4 0.5 5 1.0 6 3.0 7 4.5 8 7.5 9 8.0 10 7.0 11 8.5 12 6.5 13 3.5 14 3.5 15 5.0 16 4.0 17 1.5 18 1.0 19 2.5 20 2.0 21 0.5 22 2.0 23 3.0 24 2.0 25 2.5 26 3.0 27 2.5 28 4.0 29 5.5 30 6.5 31 7.5 32 8.5 33 9.0 34 15.5 35 26.0 36 40.0 37 59.0 38 78.5 39 88.0 40 97.0 41 135.0 42 170.5 43 186.5 44 197.0 45 225.5 46 218.0 47 188.0 48 196.0 49 188.5 50 168.5 51 157.5 52 151.5 53 146.0 54 128.5 55 120.5 56 123.5 57 109.5 58 113.5 59 109.0 60 79.5 61 66.5 62 61.5 63 55.5 64 47.0 65 38.0 66 26.5 67 18.5 68 13.0 69 7.0 70 4.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.25 2 0.42500000000000004 3 0.42500000000000004 4 0.42500000000000004 5 0.42500000000000004 6 1.325 7 2.175 8 100.0 9 2.25 10-11 1.7874999999999999 12-13 1.525 14-15 2.9250000000000003 16-17 3.7249999999999996 18-19 3.2750000000000004 20-21 3.925 22-23 3.5374999999999996 24-25 3.8249999999999997 26-27 3.7875 28-29 3.975 30-31 4.237500000000001 32-33 4.2875000000000005 34-35 3.5749999999999997 36-37 2.6875 38-39 2.7625 40-41 3.2 42-43 3.4250000000000003 44-45 3.125 46-47 2.8125 48-49 2.65 50-51 1.9625 52-53 1.3625 54-55 0.95 56-57 0.975 58-59 1.0 60-61 1.0 62-63 1.0 64-65 1.0375 66-67 1.05 68-69 1.4625000000000001 70-71 1.725 72-73 1.8375 74-75 2.0625 76-77 2.125 78-79 2.275 80-81 2.1875 82-83 2.025 84-85 2.1125000000000003 86-87 2.1624999999999996 88-89 2.35 90-91 2.5375 92-93 2.45 94-95 2.625 96-97 2.875 98-99 3.0124999999999997 100-101 3.0875 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67369477911646 99.275 2 0.2761044176706827 0.5499999999999999 3 0.0251004016064257 0.075 4 0.0251004016064257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974062 spots for ERR10610829.sra Written 974062 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra Read 974060 spots for ERR10610829.sra Written 974060 spots for ERR10610829.sra SRR ids: ['ERR10610829.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_to1sunpg ERR10610829.sra spots: 19481202 blocks: [[1, 974060], [974061, 1948120], [1948121, 2922180], [2922181, 3896240], [3896241, 4870300], [4870301, 5844360], [5844361, 6818420], [6818421, 7792480], [7792481, 8766540], [8766541, 9740600], [9740601, 10714660], [10714661, 11688720], [11688721, 12662780], [12662781, 13636840], [13636841, 14610900], [14610901, 15584960], [15584961, 16559020], [16559021, 17533080], [17533081, 18507140], [18507141, 19481202]] ERR10610829 file size 4696403 ERR10610829 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610829 ERR10610829_1.fastq ERR10610829_2.fastq Input file: ERR10610829_1.fastq Paired file: ERR10610829_2.fastq trimmed: ERR10610829-trimmed-pair1.fastq, ERR10610829-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:29:52 2024 >> started Fri Dec 6 20:30:10 2024 >> done (18.357s) 19481202 read pairs processed; of these: 78017 ( 0.40%) short read pairs filtered out after trimming by size control 6576 ( 0.03%) empty read pairs filtered out after trimming by size control 19396609 (99.57%) read pairs available; of these: 436984 ( 2.25%) trimmed read pairs available after processing 18959625 (97.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 0 0.00% 22 7 0.00% 23 3 0.00% 24 5 0.00% 25 4 0.00% 26 2 0.00% 27 4 0.00% 28 2 0.00% 29 6 0.00% 30 7 0.00% 31 6 0.00% 32 6 0.00% 33 10 0.00% 34 13 0.00% 35 21 0.00% 36 14 0.00% 37 18 0.00% 38 15 0.00% 39 28 0.00% 40 27 0.00% 41 40 0.00% 42 46 0.00% 43 42 0.00% 44 33 0.00% 45 59 0.00% 46 55 0.00% 47 82 0.00% 48 89 0.00% 49 102 0.00% 50 129 0.00% 51 149 0.00% 52 165 0.00% 53 205 0.00% 54 254 0.00% 55 231 0.00% 56 296 0.00% 57 349 0.00% 58 537 0.00% 59 2529 0.01% 60 38681 0.20% 61 544 0.00% 62 501 0.00% 63 819 0.00% 64 1022 0.01% 65 1720 0.01% 66 1402 0.01% 67 3278 0.02% 68 2381 0.01% 69 1199 0.01% 70 1315 0.01% 71 1685 0.01% 72 1636 0.01% 73 2372 0.01% 74 2387 0.01% 75 2702 0.01% 76 2895 0.01% 77 3346 0.02% 78 3550 0.02% 79 4272 0.02% 80 5246 0.03% 81 5460 0.03% 82 6211 0.03% 83 7633 0.04% 84 8338 0.04% 85 8692 0.04% 86 9382 0.05% 87 10111 0.05% 88 11262 0.06% 89 12693 0.07% 90 14217 0.07% 91 16037 0.08% 92 17423 0.09% 93 19741 0.10% 94 21249 0.11% 95 23770 0.12% 96 25049 0.13% 97 28565 0.15% 98 30571 0.16% 99 34465 0.18% 100 37569 0.19% 101 18959625 97.75% 19396609 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=16 prefix-density=0.46 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=18.32 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=1.4 sequence=GCCTCCTGGGCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=3.34 fanout-score-rank=14 prefix-density=0.40 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=63.69 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC ERR10610829 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:30:45 Started mapping on | Dec 06 20:30:45 Finished on | Dec 06 20:32:10 Mapping speed, Million of reads per hour | 821.50 Number of input reads | 19396609 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 18335990 Uniquely mapped reads % | 94.53% Average mapped length | 200.66 Number of splices: Total | 12705717 Number of splices: Annotated (sjdb) | 11893275 Number of splices: GT/AG | 12503996 Number of splices: GC/AG | 157675 Number of splices: AT/AC | 4408 Number of splices: Non-canonical | 39638 Mismatch rate per base, % | 0.48% Deletion rate per base | 0.02% Deletion average length | 2.31 Insertion rate per base | 0.01% Insertion average length | 1.93 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 466995 % of reads mapped to multiple loci | 2.41% Number of reads mapped to too many loci | 28145 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.08% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 636986 636986 636986 N_multimapping 466995 466995 466995 N_noFeature 598352 17847636 691392 N_ambiguous 464689 1712 71366 UnstrandedReadsAssigned:17272949 PositiveStrandReadsAssigned:486642 NegativeStrandReadsAssigned:17573232 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610829 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610829-trimmed-pair1.fastq ERR10610829-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,396,609 reads, 17,783,625 reads pseudoaligned [quant] estimated average fragment length: 193.014 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52973 ERR10610829.ke.tsv 35125 ERR10610829.se.tsv 88098 total ==> ERR10610829.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 744.126 43.311 4.85658 PNS24247 1044 851.986 51.0213 4.99687 PNS24249 1928 1735.99 13.1566 0.632379 PNS24246 1044 851.986 51.0213 4.99687 PNS24248 1044 851.986 51.0213 4.99687 PNS24244 1471 1278.99 50.4685 3.29256 PNS24243 293 118.871 0 0 KQK14069 1603 1410.99 746.841 44.1656 KQK14071 474 284.706 21.1247 6.19117 ==> ERR10610829.se.tsv <== BRADI_1g14170v3 930 BRADI_1g53295v3 224 BRADI_1g59795v3 292 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 328 BRADI_1g74790v3 72 BRADI_1g09890v3 0 BRADI_1g77505v3 341 BRADI_1g48960v3 0 ERR10610829 completed mapping pipeline successfully