Starting /dee2/code/volunteer_pipeline.sh ERR10610831 current disk space = 1549500313600 free memory = 1400036444 ERR10610831 SRAfilesize 9c01600970df74a38c3afa985455b33d ERR10610831.sra ERR10610831.sra file validated ERR10610831 is paired end ERR10610831 is conventional basespace ERR10610831 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610831_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.06225 18.0 18.0 30.0 18.0 32.0 2 28.3525 29.0 27.0 31.0 18.0 33.0 3 28.51175 31.0 27.0 33.0 18.0 33.0 4 29.9175 32.0 30.0 33.0 15.0 33.0 5 30.063 32.0 31.0 33.0 15.0 33.0 6 32.0825 36.0 29.0 38.0 16.0 38.0 7 32.99125 37.0 31.0 38.0 16.0 38.0 8 33.41475 37.0 33.0 38.0 16.0 38.0 9 33.5695 38.0 33.0 38.0 16.0 38.0 10-11 30.913375000000002 35.0 23.0 38.0 16.0 38.0 12-13 33.37975 37.5 32.0 38.0 16.0 38.0 14-15 33.8965 38.0 34.0 38.0 16.0 38.0 16-17 34.1065 38.0 34.0 38.0 16.0 38.0 18-19 34.084999999999994 38.0 34.0 38.0 16.0 38.0 20-21 34.037875 38.0 34.0 38.0 16.0 38.0 22-23 34.02475 38.0 34.0 38.0 16.0 38.0 24-25 33.949625 38.0 34.0 38.0 16.0 38.0 26-27 34.037125 38.0 34.0 38.0 16.0 38.0 28-29 33.656375 38.0 33.5 38.0 16.0 38.0 30-31 33.3605 38.0 32.0 38.0 16.0 38.0 32-33 33.927 38.0 34.0 38.0 16.0 38.0 34-35 34.159125 38.0 34.0 38.0 20.0 38.0 36-37 34.014624999999995 38.0 34.0 38.0 16.0 38.0 38-39 34.06975 38.0 34.0 38.0 16.0 38.0 40-41 33.922875000000005 38.0 34.0 38.0 16.0 38.0 42-43 34.121625 38.0 34.0 38.0 16.0 38.0 44-45 34.049125000000004 38.0 34.0 38.0 16.0 38.0 46-47 33.910624999999996 38.0 34.0 38.0 16.0 38.0 48-49 33.9055 38.0 34.0 38.0 16.0 38.0 50-51 34.106125 38.0 34.0 38.0 16.0 38.0 52-53 34.131 38.0 34.0 38.0 20.0 38.0 54-55 34.099875 38.0 34.0 38.0 16.0 38.0 56-57 33.940125 38.0 34.0 38.0 16.0 38.0 58-59 33.921499999999995 38.0 34.0 38.0 16.0 38.0 60-61 34.226625 38.0 34.0 38.0 20.0 38.0 62-63 34.313874999999996 38.0 34.0 38.0 20.0 38.0 64-65 34.272375 38.0 34.0 38.0 20.0 38.0 66-67 34.312124999999995 38.0 34.0 38.0 20.0 38.0 68-69 33.968125 38.0 34.0 38.0 16.0 38.0 70-71 34.152874999999995 38.0 34.0 38.0 20.0 38.0 72-73 34.288250000000005 38.0 34.5 38.0 20.5 38.0 74-75 34.223875 38.0 34.0 38.0 20.0 38.0 76-77 34.236 38.0 34.0 38.0 20.0 38.0 78-79 34.183125000000004 38.0 34.0 38.0 24.0 38.0 80-81 34.119375000000005 38.0 34.0 38.0 20.0 38.0 82-83 34.007000000000005 38.0 34.0 38.0 16.0 38.0 84-85 34.133375 38.0 34.0 38.0 19.0 38.0 86-87 34.036 38.0 34.0 38.0 19.5 38.0 88-89 33.961875 38.0 34.0 38.0 16.0 38.0 90-91 33.88775 38.0 34.0 38.0 16.0 38.0 92-93 33.598 38.0 34.0 38.0 15.0 38.0 94-95 33.721125 38.0 34.0 38.0 15.0 38.0 96-97 33.910375 38.0 34.0 38.0 15.5 38.0 98-99 33.896125 38.0 34.0 38.0 15.0 38.0 100-101 32.993125 37.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 13.0 19 39.0 20 58.0 21 41.0 22 56.0 23 64.0 24 74.0 25 74.0 26 77.0 27 84.0 28 108.0 29 103.0 30 131.0 31 129.0 32 184.0 33 215.0 34 253.0 35 391.0 36 801.0 37 1101.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.12639029322548 15.621840242669363 10.414560161779574 48.837209302325576 2 22.400000000000002 16.325 40.6 20.674999999999997 3 24.275 20.575 23.474999999999998 31.674999999999997 4 28.325 27.3 19.75 24.625 5 26.674999999999997 29.65 25.575 18.099999999999998 6 18.739054290718038 34.275706780085066 26.21966474856142 20.765574180635475 7 14.786089567175381 23.417563172379285 42.45684263197398 19.339504628471353 8 19.825 22.625 31.3 26.25 9 20.075000000000003 20.3 33.875 25.75 10-11 22.400000000000002 30.75 23.8875 22.9625 12-13 22.141606204653492 23.329997498123593 27.695771828871653 26.832624468351263 14-15 21.503627720790593 25.806855141356017 27.62071553665249 25.068801601200903 16-17 21.934434434434436 26.58908908908909 26.514014014014016 24.96246246246246 18-19 22.3973973973974 25.775775775775777 25.650650650650654 26.176176176176174 20-21 22.241681260945708 26.782586940205157 26.845133850387793 24.130597948461347 22-23 22.04576716268601 27.46029761160435 26.822558459422286 23.67137676628736 24-25 22.095785919719894 25.859697386519947 27.19769913717644 24.84681755658372 26-27 22.10829060897837 26.60997874202826 26.647492809803673 24.634237839189694 28-29 22.358384394147805 26.147305239464803 26.034763036138553 25.459547330248846 30-31 22.375 25.6 26.650000000000002 25.374999999999996 32-33 21.7875 26.474999999999998 27.0875 24.65 34-35 22.1875 26.1 25.837500000000002 25.874999999999996 36-37 22.15 26.650000000000002 25.412499999999998 25.7875 38-39 21.4375 26.487500000000004 26.5625 25.5125 40-41 21.9375 26.85 25.637500000000003 25.575 42-43 21.6625 26.5625 26.825 24.95 44-45 22.875 25.575 26.900000000000002 24.65 46-47 22.3125 25.924999999999997 26.325 25.4375 48-49 22.075 25.324999999999996 27.0 25.6 50-51 22.237499999999997 26.025 25.85 25.887500000000003 52-53 21.987499999999997 25.412499999999998 26.224999999999998 26.375 54-55 22.787499999999998 25.587500000000002 26.6 25.025 56-57 22.787499999999998 26.5375 26.200000000000003 24.474999999999998 58-59 22.1875 25.4625 27.287499999999998 25.0625 60-61 22.275 25.8625 27.200000000000003 24.6625 62-63 22.112499999999997 25.924999999999997 27.1625 24.8 64-65 23.075000000000003 26.75 25.1875 24.9875 66-67 22.9625 26.6625 25.087500000000002 25.2875 68-69 22.2 26.325 25.9875 25.4875 70-71 22.775000000000002 26.2875 26.174999999999997 24.762500000000003 72-73 23.0375 25.5625 25.6 25.8 74-75 22.1875 27.1625 25.85 24.8 76-77 22.95 26.375 26.0 24.675 78-79 22.95 25.424999999999997 26.35 25.275 80-81 22.9375 26.637499999999996 25.575 24.85 82-83 23.875 25.7 25.2125 25.2125 84-85 22.650000000000002 25.025 25.874999999999996 26.450000000000003 86-87 23.125 24.575 26.6 25.7 88-89 22.8375 24.6875 27.575 24.9 90-91 23.4625 25.174999999999997 26.25 25.112499999999997 92-93 23.0432608152038 25.49387346836709 26.694173543385848 24.76869217304326 94-95 23.3625 26.137500000000003 25.55 24.95 96-97 22.825 25.587500000000002 25.55 26.0375 98-99 22.3875 26.55 25.95 25.112499999999997 100-101 22.425 26.275 25.912499999999998 25.387500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 0.5 27 1.0 28 2.0 29 3.0 30 5.0 31 6.5 32 10.5 33 18.5 34 25.5 35 35.5 36 54.0 37 65.5 38 78.0 39 109.0 40 132.5 41 171.5 42 208.0 43 221.5 44 222.0 45 224.0 46 233.0 47 216.5 48 204.0 49 188.0 50 176.0 51 165.5 52 149.5 53 141.0 54 125.5 55 107.5 56 100.0 57 90.0 58 75.0 59 68.5 60 58.5 61 54.5 62 49.5 63 43.5 64 42.0 65 36.0 66 27.5 67 18.5 68 14.5 69 8.5 70 3.0 71 3.5 72 2.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.075 7 0.075 8 0.0 9 0.0 10-11 0.0 12-13 0.075 14-15 0.075 16-17 0.1 18-19 0.1 20-21 0.075 22-23 0.0375 24-25 0.0375 26-27 0.0375 28-29 0.0375 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44654088050314 98.825 2 0.4779874213836478 0.95 3 0.07547169811320754 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8999999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610831 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610831_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.88225 33.0 28.0 33.0 18.0 34.0 2 30.21125 33.0 30.0 33.0 18.0 34.0 3 30.31725 33.0 31.0 33.0 18.0 34.0 4 30.13775 33.0 31.0 33.0 15.0 34.0 5 30.08475 33.0 31.0 33.0 15.0 34.0 6 33.38675 38.0 33.0 38.0 16.0 38.0 7 33.883 38.0 33.0 38.0 16.0 38.0 8 33.5205 38.0 33.0 38.0 16.0 38.0 9 33.64275 38.0 33.0 38.0 16.0 38.0 10-11 33.538624999999996 38.0 33.0 38.0 16.0 38.0 12-13 33.610625 38.0 33.0 38.0 16.0 38.0 14-15 33.502250000000004 38.0 33.0 38.0 16.0 38.0 16-17 32.94775 37.5 31.0 38.0 16.0 38.0 18-19 33.335750000000004 38.0 32.0 38.0 16.0 38.0 20-21 33.56175 38.0 33.0 38.0 16.0 38.0 22-23 33.71962499999999 38.0 33.5 38.0 16.0 38.0 24-25 33.593500000000006 38.0 33.0 38.0 16.0 38.0 26-27 33.471125 38.0 33.0 38.0 16.0 38.0 28-29 33.3515 38.0 33.0 38.0 16.0 38.0 30-31 33.41075 38.0 33.0 38.0 16.0 38.0 32-33 33.53175 38.0 33.0 38.0 16.0 38.0 34-35 33.674 38.0 33.5 38.0 16.0 38.0 36-37 33.633375 38.0 33.0 38.0 16.0 38.0 38-39 33.6395 38.0 33.5 38.0 16.0 38.0 40-41 33.687 38.0 33.5 38.0 16.0 38.0 42-43 33.476375000000004 38.0 33.0 38.0 16.0 38.0 44-45 33.56 38.0 33.0 38.0 16.0 38.0 46-47 33.626999999999995 38.0 33.5 38.0 16.0 38.0 48-49 33.760125 38.0 33.5 38.0 16.0 38.0 50-51 33.595 38.0 33.5 38.0 16.0 38.0 52-53 33.477125 38.0 33.0 38.0 16.0 38.0 54-55 33.397375 38.0 33.0 38.0 16.0 38.0 56-57 33.391125 38.0 33.0 38.0 16.0 38.0 58-59 33.54575 38.0 33.0 38.0 16.0 38.0 60-61 33.672875 38.0 33.5 38.0 16.0 38.0 62-63 33.42475 38.0 33.0 38.0 16.0 38.0 64-65 33.660875000000004 38.0 33.5 38.0 16.0 38.0 66-67 33.52075 38.0 33.0 38.0 16.0 38.0 68-69 33.53575 38.0 33.0 38.0 16.0 38.0 70-71 33.574749999999995 38.0 33.0 38.0 16.0 38.0 72-73 33.62775 38.0 33.0 38.0 16.0 38.0 74-75 33.644375 38.0 33.5 38.0 16.0 38.0 76-77 33.43175 38.0 33.0 38.0 16.0 38.0 78-79 33.384875 38.0 33.0 38.0 16.0 38.0 80-81 33.250125 38.0 33.0 38.0 16.0 38.0 82-83 33.34587500000001 38.0 33.0 38.0 16.0 38.0 84-85 33.40675 38.0 33.0 38.0 16.0 38.0 86-87 33.344625 38.0 33.0 38.0 15.0 38.0 88-89 33.1725 38.0 33.0 38.0 15.0 38.0 90-91 33.142250000000004 38.0 32.0 38.0 15.0 38.0 92-93 33.142 38.0 33.0 38.0 15.0 38.0 94-95 33.276624999999996 38.0 33.0 38.0 15.0 38.0 96-97 33.2845 38.0 33.0 38.0 15.0 38.0 98-99 33.10425 38.0 33.0 38.0 15.0 38.0 100-101 32.022875 36.5 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 4.0 18 23.0 19 57.0 20 58.0 21 67.0 22 59.0 23 80.0 24 68.0 25 88.0 26 81.0 27 94.0 28 122.0 29 131.0 30 142.0 31 154.0 32 147.0 33 212.0 34 223.0 35 320.0 36 562.0 37 1307.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.7 13.900000000000002 14.099999999999998 42.3 2 27.925 22.45 32.65 16.975 3 22.55 24.725 27.6 25.124999999999996 4 25.874999999999996 31.674999999999997 20.0 22.45 5 27.55 32.4 21.2 18.85 6 21.275 35.25 22.525000000000002 20.95 7 21.725 16.25 38.175 23.849999999999998 8 23.025000000000002 22.125 26.575 28.275 9 23.225 22.3 29.349999999999998 25.124999999999996 10-11 27.725 28.1 20.849999999999998 23.325000000000003 12-13 24.925 22.8 26.125 26.150000000000002 14-15 25.0625 25.2 25.412499999999998 24.325 16-17 26.7625 25.4875 24.212500000000002 23.5375 18-19 25.637500000000003 24.762500000000003 25.6 24.0 20-21 25.6125 25.1 25.8 23.4875 22-23 25.25 25.9625 25.0125 23.775 24-25 25.7375 25.7625 24.4 24.099999999999998 26-27 24.6125 25.8 25.474999999999998 24.1125 28-29 25.587500000000002 25.5125 25.424999999999997 23.474999999999998 30-31 26.0125 25.7875 24.8125 23.3875 32-33 25.124999999999996 26.487500000000004 25.35 23.0375 34-35 25.937500000000004 25.85 24.575 23.6375 36-37 24.6125 26.375 25.45 23.5625 38-39 25.38451919469801 26.13480055020633 24.609228460672753 23.87145179442291 40-41 25.993998499624904 25.731432858214554 25.70642660665166 22.568142035508878 42-43 25.4625 24.85 25.874999999999996 23.8125 44-45 24.83741870935468 26.788394197098548 24.824912456228116 23.54927463731866 46-47 26.087500000000002 25.4625 24.9125 23.5375 48-49 24.4 25.837500000000002 25.974999999999998 23.7875 50-51 25.412499999999998 25.75 25.650000000000002 23.1875 52-53 25.7875 26.625 24.587500000000002 23.0 54-55 24.325 25.5375 26.0625 24.075 56-57 24.275 27.2625 25.587500000000002 22.875 58-59 26.5875 25.2875 25.2125 22.912499999999998 60-61 25.837500000000002 25.4375 25.637500000000003 23.0875 62-63 25.2625 26.687499999999996 26.025 22.025 64-65 25.6 26.1125 25.55 22.7375 66-67 25.3 25.3 26.275 23.125 68-69 25.2 26.375 25.087500000000002 23.3375 70-71 26.1125 25.112499999999997 25.75 23.025000000000002 72-73 25.5375 25.624999999999996 25.974999999999998 22.8625 74-75 25.2125 26.075 26.5625 22.15 76-77 26.200000000000003 25.937500000000004 25.4375 22.425 78-79 25.25 25.624999999999996 26.575 22.55 80-81 24.525 26.924999999999997 25.112499999999997 23.4375 82-83 25.174999999999997 26.8 25.724999999999998 22.3 84-85 25.2 26.200000000000003 26.125 22.475 86-87 25.0375 26.087500000000002 26.0375 22.8375 88-89 25.4875 25.8625 26.150000000000002 22.5 90-91 25.974999999999998 26.0125 25.662499999999998 22.35 92-93 26.1625 26.875 24.9875 21.975 94-95 25.624999999999996 26.375 25.7125 22.287499999999998 96-97 25.5625 27.35 25.174999999999997 21.912499999999998 98-99 25.4 26.387500000000003 25.5375 22.675 100-101 25.900000000000002 26.575 25.0125 22.5125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 0.0 29 0.0 30 1.5 31 4.0 32 7.0 33 11.5 34 18.5 35 25.0 36 33.0 37 53.5 38 75.0 39 86.5 40 118.0 41 159.5 42 173.5 43 188.5 44 206.5 45 228.5 46 230.5 47 217.0 48 207.0 49 182.0 50 184.5 51 186.5 52 167.0 53 139.5 54 113.5 55 113.5 56 114.5 57 114.0 58 95.0 59 80.0 60 95.0 61 82.0 62 62.5 63 54.5 64 43.0 65 35.5 66 29.0 67 23.0 68 16.0 69 11.0 70 7.0 71 4.0 72 2.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0375 40-41 0.025 42-43 0.0 44-45 0.05 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.16249999999999998 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.47500000000000003 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707646 spots for ERR10610831.sra Written 707646 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra Read 707640 spots for ERR10610831.sra Written 707640 spots for ERR10610831.sra SRR ids: ['ERR10610831.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vz9znnsv ERR10610831.sra spots: 14152806 blocks: [[1, 707640], [707641, 1415280], [1415281, 2122920], [2122921, 2830560], [2830561, 3538200], [3538201, 4245840], [4245841, 4953480], [4953481, 5661120], [5661121, 6368760], [6368761, 7076400], [7076401, 7784040], [7784041, 8491680], [8491681, 9199320], [9199321, 9906960], [9906961, 10614600], [10614601, 11322240], [11322241, 12029880], [12029881, 12737520], [12737521, 13445160], [13445161, 14152806]] ERR10610831 file size 3405932 ERR10610831 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610831 ERR10610831_1.fastq ERR10610831_2.fastq Input file: ERR10610831_1.fastq Paired file: ERR10610831_2.fastq trimmed: ERR10610831-trimmed-pair1.fastq, ERR10610831-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:30:46 2024 >> started Fri Dec 6 20:30:58 2024 >> done (12.921s) 14152806 read pairs processed; of these: 37 ( 0.00%) short read pairs filtered out after trimming by size control 897 ( 0.01%) empty read pairs filtered out after trimming by size control 14151872 (99.99%) read pairs available; of these: 421527 ( 2.98%) trimmed read pairs available after processing 13730345 (97.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 0 0.00% 27 3 0.00% 28 3 0.00% 29 9 0.00% 30 5 0.00% 31 5 0.00% 32 8 0.00% 33 10 0.00% 34 17 0.00% 35 23 0.00% 36 17 0.00% 37 21 0.00% 38 19 0.00% 39 98 0.00% 40 38 0.00% 41 58 0.00% 42 40 0.00% 43 51 0.00% 44 49 0.00% 45 62 0.00% 46 73 0.00% 47 94 0.00% 48 96 0.00% 49 117 0.00% 50 143 0.00% 51 142 0.00% 52 181 0.00% 53 163 0.00% 54 204 0.00% 55 226 0.00% 56 273 0.00% 57 338 0.00% 58 352 0.00% 59 400 0.00% 60 416 0.00% 61 503 0.00% 62 548 0.00% 63 661 0.00% 64 725 0.01% 65 831 0.01% 66 978 0.01% 67 1091 0.01% 68 1253 0.01% 69 1288 0.01% 70 1596 0.01% 71 1832 0.01% 72 2000 0.01% 73 2227 0.02% 74 2560 0.02% 75 2872 0.02% 76 3333 0.02% 77 3788 0.03% 78 4189 0.03% 79 4909 0.03% 80 5258 0.04% 81 5895 0.04% 82 6749 0.05% 83 7445 0.05% 84 8488 0.06% 85 9531 0.07% 86 10682 0.08% 87 11493 0.08% 88 12828 0.09% 89 14176 0.10% 90 15650 0.11% 91 17342 0.12% 92 19197 0.14% 93 21157 0.15% 94 23579 0.17% 95 25429 0.18% 96 27456 0.19% 97 30982 0.22% 98 32861 0.23% 99 35859 0.25% 100 38526 0.27% 101 13730345 97.02% 14151872 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=21 prefix-density=0.47 prefix-fanout=3.0 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=21 fanout-score=49.79 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=9.9 sequence=ATCATCATCATCCCCGCACCCCATCAACTGCTACGTACGGATGAACTAATTAACACACGCATGCATGCAAATATACGATGCTTAATTAATTAACACCGATCGATCCCCATTAAAACCAAACC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.41 fanout-score-rank=18 prefix-density=0.45 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=55.11 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=5.3 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC ERR10610831 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:31:50 Started mapping on | Dec 06 20:31:50 Finished on | Dec 06 20:34:32 Mapping speed, Million of reads per hour | 314.49 Number of input reads | 14151872 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 12933454 Uniquely mapped reads % | 91.39% Average mapped length | 200.02 Number of splices: Total | 8690598 Number of splices: Annotated (sjdb) | 8167616 Number of splices: GT/AG | 8565547 Number of splices: GC/AG | 106280 Number of splices: AT/AC | 2931 Number of splices: Non-canonical | 15840 Mismatch rate per base, % | 0.93% Deletion rate per base | 0.02% Deletion average length | 2.32 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 243531 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 12451 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.18% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 974887 974887 974887 N_multimapping 243531 243531 243531 N_noFeature 413471 12574172 488260 N_ambiguous 330630 1216 46952 UnstrandedReadsAssigned:12189353 PositiveStrandReadsAssigned:358066 NegativeStrandReadsAssigned:12398242 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610831 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610831-trimmed-pair1.fastq ERR10610831-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,151,872 reads, 12,640,453 reads pseudoaligned [quant] estimated average fragment length: 173.857 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52973 ERR10610831.ke.tsv 35125 ERR10610831.se.tsv 88098 total ==> ERR10610831.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 763.272 0 0 PNS24247 1044 871.143 39.7454 5.3815 PNS24249 1928 1755.14 14.679 0.986482 PNS24246 1044 871.143 39.7454 5.3815 PNS24248 1044 871.143 39.7454 5.3815 PNS24244 1471 1298.14 46.0848 4.18737 PNS24243 293 128.51 0 0 KQK14069 1603 1430.14 1340.21 110.535 KQK14071 474 302.695 21.4302 8.3508 ==> ERR10610831.se.tsv <== BRADI_1g14170v3 1426 BRADI_1g53295v3 599 BRADI_1g59795v3 88 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 192 BRADI_1g74790v3 104 BRADI_1g09890v3 0 BRADI_1g77505v3 370 BRADI_1g48960v3 0 ERR10610831 completed mapping pipeline successfully