Starting /dee2/code/volunteer_pipeline.sh ERR10610832 current disk space = 1549437730816 free memory = 1419503004 ERR10610832 SRAfilesize 52283a69889b701409bf184b020951bd ERR10610832.sra ERR10610832.sra file validated ERR10610832 is paired end ERR10610832 is conventional basespace ERR10610832 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610832_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.20425 25.0 18.0 31.0 18.0 32.0 2 26.70875 29.0 25.0 31.0 18.0 33.0 3 28.014 29.0 27.0 31.0 18.0 33.0 4 29.55825 32.0 30.0 33.0 15.0 33.0 5 30.16225 33.0 31.0 33.0 15.0 33.0 6 33.01825 37.0 31.0 38.0 16.0 38.0 7 33.05575 37.0 31.0 38.0 16.0 38.0 8 33.40725 38.0 33.0 38.0 16.0 38.0 9 33.376 38.0 33.0 38.0 16.0 38.0 10-11 30.863374999999998 35.0 23.0 38.0 16.0 38.0 12-13 33.325625 37.5 32.0 38.0 16.0 38.0 14-15 33.753875 38.0 33.0 38.0 16.0 38.0 16-17 34.077875000000006 38.0 34.0 38.0 16.0 38.0 18-19 34.046625 38.0 34.0 38.0 16.0 38.0 20-21 33.919250000000005 38.0 34.0 38.0 16.0 38.0 22-23 34.045 38.0 34.0 38.0 16.0 38.0 24-25 33.995375 38.0 34.0 38.0 16.0 38.0 26-27 33.998000000000005 38.0 34.0 38.0 16.0 38.0 28-29 33.828125 38.0 33.5 38.0 16.0 38.0 30-31 33.242875 38.0 31.0 38.0 16.0 38.0 32-33 33.949 38.0 34.0 38.0 16.0 38.0 34-35 34.01025 38.0 34.0 38.0 16.0 38.0 36-37 33.960625 38.0 34.0 38.0 16.0 38.0 38-39 34.09575 38.0 34.0 38.0 20.0 38.0 40-41 34.082875 38.0 34.0 38.0 20.0 38.0 42-43 34.231 38.0 34.0 38.0 20.5 38.0 44-45 34.0005 38.0 34.0 38.0 16.0 38.0 46-47 34.056375 38.0 34.0 38.0 20.0 38.0 48-49 33.892375 38.0 34.0 38.0 16.0 38.0 50-51 34.136624999999995 38.0 34.0 38.0 20.0 38.0 52-53 34.125375 38.0 34.0 38.0 20.0 38.0 54-55 34.141875 38.0 34.0 38.0 16.0 38.0 56-57 34.037000000000006 38.0 34.0 38.0 16.0 38.0 58-59 34.210375 38.0 34.0 38.0 20.0 38.0 60-61 34.255 38.0 34.0 38.0 20.0 38.0 62-63 34.332875 38.0 34.5 38.0 20.0 38.0 64-65 34.361000000000004 38.0 35.0 38.0 20.0 38.0 66-67 34.575625 38.0 35.0 38.0 25.0 38.0 68-69 34.161625 38.0 34.0 38.0 20.0 38.0 70-71 34.231750000000005 38.0 34.0 38.0 20.0 38.0 72-73 34.344375 38.0 34.5 38.0 24.5 38.0 74-75 34.341875 38.0 34.5 38.0 24.0 38.0 76-77 34.36475 38.0 34.5 38.0 20.5 38.0 78-79 34.080625 38.0 34.0 38.0 16.0 38.0 80-81 34.1635 38.0 34.0 38.0 23.5 38.0 82-83 34.064499999999995 38.0 34.0 38.0 16.0 38.0 84-85 34.117000000000004 38.0 34.0 38.0 19.5 38.0 86-87 34.124750000000006 38.0 34.0 38.0 16.0 38.0 88-89 34.0505 38.0 34.0 38.0 20.0 38.0 90-91 34.221875 38.0 34.0 38.0 23.0 38.0 92-93 33.748625000000004 38.0 34.0 38.0 16.0 38.0 94-95 33.885 38.0 34.0 38.0 15.5 38.0 96-97 34.041124999999994 38.0 34.0 38.0 18.0 38.0 98-99 34.028 38.0 34.0 38.0 19.0 38.0 100-101 33.082875 37.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 11.0 19 25.0 20 49.0 21 45.0 22 56.0 23 68.0 24 63.0 25 72.0 26 82.0 27 86.0 28 102.0 29 133.0 30 133.0 31 150.0 32 188.0 33 221.0 34 277.0 35 353.0 36 689.0 37 1194.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.411290322580644 10.987903225806452 15.801411290322582 46.79939516129033 2 19.25 18.975 37.675 24.099999999999998 3 19.925 23.625 22.175 34.275 4 25.324999999999996 28.525 22.45 23.7 5 22.55 34.075 24.425 18.95 6 18.2 35.575 26.474999999999998 19.75 7 14.75 23.225 42.875 19.15 8 19.2 22.7 31.55 26.55 9 19.025 21.925 33.7 25.35 10-11 21.9625 31.424999999999997 24.525 22.0875 12-13 21.24281070267567 24.343585896474117 29.294823705926483 25.11877969492373 14-15 20.667666916729182 27.51937984496124 27.494373593398347 24.318579644911228 16-17 21.892973243310827 26.70667666916729 26.581645411352838 24.81870467616904 18-19 22.005501375343837 27.069267316829208 26.19404851212803 24.731182795698924 20-21 21.590198774846854 27.015876984623077 26.428303537942245 24.965620702587824 22-23 22.177772221527693 26.865858232279034 27.353419177397175 23.6029503687961 24-25 21.402675334416802 27.228403550443808 26.96587073384173 24.40305038129766 26-27 21.45 25.724999999999998 27.737499999999997 25.087500000000002 28-29 22.05 26.400000000000002 26.687499999999996 24.8625 30-31 21.8125 27.05 26.337500000000002 24.8 32-33 21.4375 26.237500000000004 26.674999999999997 25.650000000000002 34-35 21.275 27.3 26.875 24.55 36-37 21.6125 27.800000000000004 25.825 24.762500000000003 38-39 21.4125 26.787499999999998 26.9125 24.887500000000003 40-41 22.537499999999998 27.3125 26.1625 23.9875 42-43 21.9 27.0 25.974999999999998 25.124999999999996 44-45 22.237499999999997 27.474999999999998 25.8625 24.425 46-47 21.337500000000002 26.6 26.85 25.2125 48-49 23.200000000000003 26.400000000000002 26.174999999999997 24.224999999999998 50-51 21.0 26.674999999999997 26.5 25.825 52-53 21.8125 26.3625 26.687499999999996 25.137500000000003 54-55 22.175 26.825 26.575 24.425 56-57 22.275 26.174999999999997 25.900000000000002 25.650000000000002 58-59 21.5375 27.1 26.337500000000002 25.025 60-61 21.3125 26.525 26.325 25.837500000000002 62-63 22.162499999999998 26.3 25.974999999999998 25.5625 64-65 21.75 26.7625 26.174999999999997 25.3125 66-67 21.5375 27.35 26.174999999999997 24.9375 68-69 21.2375 27.3 25.900000000000002 25.5625 70-71 21.7875 27.6625 25.224999999999998 25.324999999999996 72-73 21.6 27.537499999999998 24.8125 26.05 74-75 21.912499999999998 26.775 26.5 24.8125 76-77 22.025 26.924999999999997 26.387500000000003 24.6625 78-79 21.275 26.875 26.325 25.525 80-81 22.3125 26.637499999999996 25.7875 25.2625 82-83 21.5625 26.787499999999998 26.3125 25.337500000000002 84-85 21.212500000000002 26.35 26.85 25.587500000000002 86-87 22.125 26.724999999999998 25.7375 25.412499999999998 88-89 22.175 26.450000000000003 25.724999999999998 25.650000000000002 90-91 23.0625 25.6 26.137500000000003 25.2 92-93 22.45 26.1625 26.200000000000003 25.1875 94-95 22.7 26.4125 25.85 25.0375 96-97 23.25 25.85 25.8 25.1 98-99 22.725 25.575 26.224999999999998 25.474999999999998 100-101 22.75 26.5 26.2625 24.4875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 0.5 26 0.0 27 0.5 28 1.5 29 2.5 30 4.0 31 6.5 32 12.5 33 20.5 34 29.0 35 41.5 36 61.5 37 80.0 38 100.0 39 121.5 40 144.5 41 186.0 42 208.0 43 220.0 44 237.5 45 237.5 46 242.0 47 229.0 48 216.5 49 215.0 50 187.0 51 156.5 52 143.0 53 130.0 54 116.5 55 105.5 56 85.0 57 71.0 58 66.5 59 61.0 60 56.5 61 50.5 62 40.5 63 35.5 64 28.0 65 17.0 66 12.0 67 7.5 68 6.0 69 3.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.025 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.0125 22-23 0.0125 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06542056074767 98.05 2 0.8335438241980297 1.6500000000000001 3 0.10103561505430665 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3875 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCACCA 15 0.009967554 47.487495 26-27 >>END_MODULE ERR10610832 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610832_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.03825 33.0 30.0 33.0 18.0 34.0 2 30.4425 33.0 31.0 33.0 18.0 34.0 3 30.4405 33.0 31.0 33.0 18.0 34.0 4 30.387 33.0 31.0 33.0 15.0 34.0 5 30.238 33.0 31.0 33.0 15.0 34.0 6 33.8435 38.0 33.0 38.0 16.0 38.0 7 33.9975 38.0 34.0 38.0 16.0 38.0 8 33.72175 38.0 34.0 38.0 16.0 38.0 9 33.998 38.0 34.0 38.0 16.0 38.0 10-11 33.929125 38.0 33.5 38.0 16.0 38.0 12-13 33.894875 38.0 33.5 38.0 16.0 38.0 14-15 33.864000000000004 38.0 33.5 38.0 16.0 38.0 16-17 33.235749999999996 38.0 32.0 38.0 16.0 38.0 18-19 33.907875000000004 38.0 33.5 38.0 20.0 38.0 20-21 33.871125 38.0 34.0 38.0 16.0 38.0 22-23 33.888374999999996 38.0 34.0 38.0 16.0 38.0 24-25 33.949375 38.0 33.5 38.0 16.0 38.0 26-27 33.9525 38.0 34.0 38.0 16.0 38.0 28-29 33.639250000000004 38.0 33.0 38.0 16.0 38.0 30-31 33.851625 38.0 34.0 38.0 16.0 38.0 32-33 33.988 38.0 34.0 38.0 16.0 38.0 34-35 34.179125 38.0 34.0 38.0 16.0 38.0 36-37 33.926874999999995 38.0 34.0 38.0 16.0 38.0 38-39 34.159499999999994 38.0 34.0 38.0 20.0 38.0 40-41 34.000625 38.0 34.0 38.0 16.0 38.0 42-43 33.885625000000005 38.0 33.5 38.0 16.0 38.0 44-45 34.039874999999995 38.0 34.0 38.0 16.0 38.0 46-47 34.015875 38.0 34.0 38.0 16.0 38.0 48-49 34.074749999999995 38.0 34.0 38.0 16.0 38.0 50-51 34.013374999999996 38.0 34.0 38.0 16.0 38.0 52-53 33.9155 38.0 34.0 38.0 16.0 38.0 54-55 33.9125 38.0 34.0 38.0 16.0 38.0 56-57 33.9895 38.0 34.0 38.0 16.0 38.0 58-59 33.924625 38.0 34.0 38.0 16.0 38.0 60-61 34.07775 38.0 34.0 38.0 16.0 38.0 62-63 33.727374999999995 38.0 33.5 38.0 16.0 38.0 64-65 34.1 38.0 34.0 38.0 20.0 38.0 66-67 33.927125000000004 38.0 34.0 38.0 16.0 38.0 68-69 34.044 38.0 34.0 38.0 16.0 38.0 70-71 33.977375 38.0 34.0 38.0 16.0 38.0 72-73 33.899 38.0 33.5 38.0 16.0 38.0 74-75 34.023375 38.0 34.0 38.0 16.0 38.0 76-77 33.889624999999995 38.0 34.0 38.0 20.0 38.0 78-79 33.964375000000004 38.0 34.0 38.0 16.0 38.0 80-81 33.762 38.0 34.0 38.0 16.0 38.0 82-83 33.850125 38.0 34.0 38.0 16.0 38.0 84-85 33.874125 38.0 34.0 38.0 16.0 38.0 86-87 33.888875 38.0 34.0 38.0 15.5 38.0 88-89 33.881125 38.0 34.0 38.0 15.0 38.0 90-91 33.75475 38.0 33.5 38.0 16.0 38.0 92-93 33.748875 38.0 34.0 38.0 15.5 38.0 94-95 33.68625 38.0 34.0 38.0 15.0 38.0 96-97 33.685625 38.0 34.0 38.0 15.0 38.0 98-99 33.667375 38.0 34.0 38.0 15.0 38.0 100-101 32.560625 37.0 30.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 18.0 19 41.0 20 47.0 21 57.0 22 62.0 23 59.0 24 80.0 25 66.0 26 88.0 27 89.0 28 84.0 29 112.0 30 121.0 31 153.0 32 173.0 33 190.0 34 263.0 35 320.0 36 522.0 37 1454.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.85 15.325 15.950000000000001 40.875 2 28.625 21.625 33.074999999999996 16.675 3 23.3 25.05 27.575 24.075 4 27.450000000000003 29.599999999999998 20.275000000000002 22.675 5 26.05 33.074999999999996 20.4 20.474999999999998 6 22.1 35.525 21.775 20.599999999999998 7 20.8 16.325 38.75 24.125 8 24.05 21.125 25.624999999999996 29.2 9 23.325000000000003 22.55 28.799999999999997 25.324999999999996 10-11 26.487500000000004 29.1875 20.599999999999998 23.724999999999998 12-13 26.337500000000002 24.0625 25.837500000000002 23.7625 14-15 25.275 25.674999999999997 25.874999999999996 23.175 16-17 26.35 25.474999999999998 25.162499999999998 23.0125 18-19 25.9625 25.937500000000004 25.2875 22.8125 20-21 25.4 27.1125 24.1625 23.325000000000003 22-23 26.025 26.1 24.6875 23.1875 24-25 25.2 26.8 26.05 21.95 26-27 25.687500000000004 25.35 25.7875 23.175 28-29 26.125 25.887500000000003 25.3 22.6875 30-31 24.762500000000003 25.35 26.5 23.3875 32-33 25.025 25.7 25.724999999999998 23.549999999999997 34-35 25.674999999999997 24.85 25.575 23.9 36-37 25.8125 26.2125 26.1125 21.8625 38-39 25.0625 26.5875 25.8125 22.537499999999998 40-41 25.1875 25.2125 26.25 23.35 42-43 24.7 26.5125 26.4125 22.375 44-45 25.5125 26.1125 25.7625 22.6125 46-47 25.7 26.2875 25.825 22.1875 48-49 24.8125 26.5875 26.0625 22.537499999999998 50-51 24.474999999999998 26.2875 26.6625 22.575 52-53 25.2125 26.337500000000002 25.8125 22.6375 54-55 25.324999999999996 26.5125 25.837500000000002 22.325 56-57 24.2625 27.3875 25.887500000000003 22.4625 58-59 26.487500000000004 24.875 26.387500000000003 22.25 60-61 25.1 25.825 26.55 22.525000000000002 62-63 25.1 25.687500000000004 26.174999999999997 23.0375 64-65 25.224999999999998 26.687499999999996 25.9875 22.1 66-67 24.5125 26.625 26.575 22.287499999999998 68-69 25.224999999999998 26.787499999999998 25.85 22.1375 70-71 25.0625 26.5 25.7125 22.725 72-73 24.725 26.3125 27.200000000000003 21.762500000000003 74-75 24.887500000000003 25.637500000000003 27.425 22.05 76-77 25.8625 26.1 26.4125 21.625 78-79 25.7875 25.6 26.3625 22.25 80-81 24.825 25.650000000000002 26.900000000000002 22.625 82-83 25.15 26.637499999999996 26.687499999999996 21.525 84-85 25.0 26.3125 26.5625 22.125 86-87 24.55 26.0125 27.6375 21.8 88-89 25.324999999999996 25.374999999999996 26.2875 23.0125 90-91 24.65 27.150000000000002 26.525 21.675 92-93 25.55 27.237499999999997 26.3 20.9125 94-95 25.45 25.674999999999997 26.4125 22.4625 96-97 25.95 26.2625 26.200000000000003 21.587500000000002 98-99 25.825 26.0375 26.325 21.8125 100-101 25.2875 26.1625 26.400000000000002 22.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.0 29 1.5 30 2.0 31 3.5 32 5.5 33 9.0 34 16.5 35 23.5 36 36.5 37 55.5 38 72.0 39 104.5 40 137.5 41 162.0 42 188.0 43 222.5 44 223.5 45 217.5 46 232.0 47 231.0 48 223.0 49 194.0 50 182.0 51 179.5 52 161.0 53 148.5 54 132.5 55 131.5 56 115.0 57 86.5 58 85.0 59 84.5 60 74.0 61 59.0 62 51.0 63 46.0 64 37.0 65 22.0 66 12.5 67 9.5 68 8.0 69 6.0 70 2.0 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.575 0.0 0.0 0.0 0.0 88-89 0.7250000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801832 spots for ERR10610832.sra Written 801832 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra Read 801827 spots for ERR10610832.sra Written 801827 spots for ERR10610832.sra SRR ids: ['ERR10610832.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gbn_31pw ERR10610832.sra spots: 16036545 blocks: [[1, 801827], [801828, 1603654], [1603655, 2405481], [2405482, 3207308], [3207309, 4009135], [4009136, 4810962], [4810963, 5612789], [5612790, 6414616], [6414617, 7216443], [7216444, 8018270], [8018271, 8820097], [8820098, 9621924], [9621925, 10423751], [10423752, 11225578], [11225579, 12027405], [12027406, 12829232], [12829233, 13631059], [13631060, 14432886], [14432887, 15234713], [15234714, 16036545]] ERR10610832 file size 3862150 ERR10610832 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610832 ERR10610832_1.fastq ERR10610832_2.fastq Input file: ERR10610832_1.fastq Paired file: ERR10610832_2.fastq trimmed: ERR10610832-trimmed-pair1.fastq, ERR10610832-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:32:04 2024 >> started Fri Dec 6 20:32:18 2024 >> done (14.181s) 16036545 read pairs processed; of these: 53 ( 0.00%) short read pairs filtered out after trimming by size control 1747 ( 0.01%) empty read pairs filtered out after trimming by size control 16034745 (99.99%) read pairs available; of these: 437301 ( 2.73%) trimmed read pairs available after processing 15597444 (97.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 4 0.00% 29 3 0.00% 30 4 0.00% 31 2 0.00% 32 8 0.00% 33 4 0.00% 34 2 0.00% 35 17 0.00% 36 12 0.00% 37 12 0.00% 38 16 0.00% 39 18 0.00% 40 28 0.00% 41 42 0.00% 42 38 0.00% 43 53 0.00% 44 46 0.00% 45 67 0.00% 46 62 0.00% 47 80 0.00% 48 93 0.00% 49 121 0.00% 50 121 0.00% 51 131 0.00% 52 185 0.00% 53 186 0.00% 54 220 0.00% 55 220 0.00% 56 255 0.00% 57 284 0.00% 58 348 0.00% 59 391 0.00% 60 431 0.00% 61 541 0.00% 62 599 0.00% 63 678 0.00% 64 763 0.00% 65 798 0.00% 66 976 0.01% 67 1069 0.01% 68 1135 0.01% 69 1333 0.01% 70 1566 0.01% 71 1790 0.01% 72 2022 0.01% 73 2360 0.01% 74 2565 0.02% 75 2868 0.02% 76 3328 0.02% 77 3632 0.02% 78 4311 0.03% 79 4689 0.03% 80 5335 0.03% 81 5927 0.04% 82 6824 0.04% 83 7618 0.05% 84 8429 0.05% 85 9650 0.06% 86 10980 0.07% 87 12073 0.08% 88 13267 0.08% 89 14624 0.09% 90 16514 0.10% 91 18315 0.11% 92 19846 0.12% 93 21749 0.14% 94 24224 0.15% 95 26525 0.17% 96 28986 0.18% 97 32312 0.20% 98 34576 0.22% 99 37876 0.24% 100 41116 0.26% 101 15597444 97.27% 16034745 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=25 prefix-density=0.36 prefix-fanout=2.1 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=59.21 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.6 sequence=TTCCTTTTCGAAATATACAATATTGCATTGGTCCATGTGTAAATCGATTTCACCCGGCCAGCTGAGAAATCAACACCCCCAAGTAACAAGTTTACAACTTACAAGTACAACAAACATTGACGCGAATCATCATCTACCCGATGCATATCACCATCACAAAACTCTTTCTACTTGAAGAAG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=28 prefix-density=0.31 prefix-fanout=1.9 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=74.36 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC ERR10610832 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:33:12 Started mapping on | Dec 06 20:33:13 Finished on | Dec 06 20:35:56 Mapping speed, Million of reads per hour | 354.14 Number of input reads | 16034745 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 14586634 Uniquely mapped reads % | 90.97% Average mapped length | 200.07 Number of splices: Total | 9345363 Number of splices: Annotated (sjdb) | 8745633 Number of splices: GT/AG | 9207767 Number of splices: GC/AG | 114297 Number of splices: AT/AC | 3085 Number of splices: Non-canonical | 20214 Mismatch rate per base, % | 0.92% Deletion rate per base | 0.03% Deletion average length | 2.30 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 343052 % of reads mapped to multiple loci | 2.14% Number of reads mapped to too many loci | 16538 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.95% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1105059 1105059 1105059 N_multimapping 343052 343052 343052 N_noFeature 539055 14146434 626784 N_ambiguous 404243 1327 52941 UnstrandedReadsAssigned:13643336 PositiveStrandReadsAssigned:438873 NegativeStrandReadsAssigned:13906909 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610832 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610832-trimmed-pair1.fastq ERR10610832-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,034,745 reads, 14,198,658 reads pseudoaligned [quant] estimated average fragment length: 171.449 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,165 rounds 52973 ERR10610832.ke.tsv 35125 ERR10610832.se.tsv 88098 total ==> ERR10610832.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 765.651 15.5207 2.13065 PNS24247 1044 873.551 22.8408 2.74824 PNS24249 1928 1757.55 30.9105 1.84855 PNS24246 1044 873.551 22.8408 2.74824 PNS24248 1044 873.551 22.8408 2.74824 PNS24244 1471 1300.55 95.0462 7.68137 PNS24243 293 129.165 0 0 KQK14069 1603 1432.55 2869.43 210.531 KQK14071 474 304.818 74.4238 25.6627 ==> ERR10610832.se.tsv <== BRADI_1g14170v3 3363 BRADI_1g53295v3 1045 BRADI_1g59795v3 151 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 258 BRADI_1g74790v3 90 BRADI_1g09890v3 0 BRADI_1g77505v3 421 BRADI_1g48960v3 0 ERR10610832 completed mapping pipeline successfully