Starting /dee2/code/volunteer_pipeline.sh ERR10610833 current disk space = 1549415989248 free memory = 1399419468 ERR10610833 SRAfilesize 50856c95023c63b021539ec56eb4543d ERR10610833.sra ERR10610833.sra file validated ERR10610833 is paired end ERR10610833 is conventional basespace ERR10610833 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610833_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.42675 18.0 18.0 28.0 18.0 32.0 2 27.94675 31.0 25.0 32.0 18.0 33.0 3 29.123 32.0 27.0 33.0 18.0 33.0 4 29.6175 32.0 30.0 33.0 15.0 33.0 5 30.31275 33.0 31.0 33.0 25.0 33.0 6 31.528 35.0 29.0 38.0 16.0 38.0 7 31.55325 36.0 29.0 38.0 16.0 38.0 8 31.6635 36.0 29.0 38.0 16.0 38.0 9 32.298 37.0 29.0 38.0 16.0 38.0 10-11 33.00175 37.0 30.0 38.0 16.0 38.0 12-13 33.275999999999996 38.0 32.0 38.0 16.0 38.0 14-15 33.13675 38.0 32.0 38.0 16.0 38.0 16-17 33.280875 38.0 32.0 38.0 16.0 38.0 18-19 33.4435 38.0 33.0 38.0 16.0 38.0 20-21 33.22425 38.0 32.0 38.0 16.0 38.0 22-23 33.3845 38.0 33.0 38.0 16.0 38.0 24-25 32.858 37.5 30.5 38.0 16.0 38.0 26-27 33.21425 37.5 31.5 38.0 16.0 38.0 28-29 33.276624999999996 38.0 33.0 38.0 16.0 38.0 30-31 33.462875 38.0 33.0 38.0 16.0 38.0 32-33 33.528125 38.0 33.0 38.0 16.0 38.0 34-35 33.56825 38.0 33.0 38.0 16.0 38.0 36-37 33.352999999999994 38.0 32.5 38.0 16.0 38.0 38-39 33.41975 38.0 33.0 38.0 16.0 38.0 40-41 33.38225 38.0 32.5 38.0 16.0 38.0 42-43 33.494749999999996 38.0 33.0 38.0 16.0 38.0 44-45 33.640625 38.0 33.0 38.0 16.0 38.0 46-47 33.525875 38.0 33.0 38.0 16.0 38.0 48-49 33.417500000000004 38.0 33.0 38.0 16.0 38.0 50-51 33.414375 38.0 33.0 38.0 16.0 38.0 52-53 33.336875 38.0 32.5 38.0 16.0 38.0 54-55 33.248999999999995 38.0 32.0 38.0 16.0 38.0 56-57 33.433499999999995 38.0 33.0 38.0 16.0 38.0 58-59 33.215 38.0 31.5 38.0 16.0 38.0 60-61 33.246375 38.0 32.0 38.0 16.0 38.0 62-63 33.25925 38.0 32.0 38.0 16.0 38.0 64-65 33.325625 38.0 33.0 38.0 16.0 38.0 66-67 33.3635 38.0 33.0 38.0 16.0 38.0 68-69 33.424875 38.0 33.0 38.0 16.0 38.0 70-71 33.3605 38.0 33.0 38.0 16.0 38.0 72-73 33.139875 38.0 31.0 38.0 16.0 38.0 74-75 33.245000000000005 38.0 32.5 38.0 16.0 38.0 76-77 33.13175 38.0 32.0 38.0 15.5 38.0 78-79 33.12875 38.0 32.0 38.0 16.0 38.0 80-81 33.24925 38.0 33.0 38.0 15.5 38.0 82-83 33.094625 38.0 32.0 38.0 15.0 38.0 84-85 33.232375000000005 38.0 33.0 38.0 15.5 38.0 86-87 33.114374999999995 37.5 33.0 38.0 15.5 38.0 88-89 32.737375 37.0 30.5 38.0 15.0 38.0 90-91 33.106625 38.0 33.0 38.0 15.0 38.0 92-93 32.84475 37.5 31.0 38.0 15.0 38.0 94-95 32.778875 37.0 31.0 38.0 15.0 38.0 96-97 32.852875 38.0 31.0 38.0 15.0 38.0 98-99 32.214375000000004 37.0 29.0 38.0 15.0 38.0 100-101 31.509875 36.0 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 22.0 19 48.0 20 59.0 21 67.0 22 77.0 23 79.0 24 88.0 25 92.0 26 103.0 27 107.0 28 126.0 29 130.0 30 149.0 31 148.0 32 190.0 33 234.0 34 247.0 35 412.0 36 718.0 37 900.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.996469994957135 12.708018154311649 11.169944528492183 47.12556732223903 2 21.9 15.75 39.75 22.6 3 21.5 21.85 22.95 33.7 4 25.724999999999998 27.55 21.349999999999998 25.374999999999996 5 24.575 32.9 23.724999999999998 18.8 6 21.275 32.125 26.924999999999997 19.675 7 16.179044761190298 22.405601400350086 41.76044011002751 19.654913728432106 8 20.51025512756378 22.461230615307652 30.09004502251126 26.93846923461731 9 20.230057514378593 21.630407601900476 33.9584896224056 24.18104526131533 10-11 21.930482620655166 30.582645661415352 22.768192048012004 24.718679669917478 12-13 21.117779444861213 23.99349837459365 28.86971742935734 26.019004751187797 14-15 21.66291009266216 24.830954169797145 27.823691460055095 25.6824442774856 16-17 21.69941183831811 26.629958703541483 26.56738831185083 25.103241146289573 18-19 21.402675334416802 27.090886360795096 26.415801975246904 25.090636329541194 20-21 21.512500000000003 26.075 26.075 26.337500000000002 22-23 22.5 26.3625 26.0625 25.074999999999996 24-25 22.2 25.137500000000003 27.474999999999998 25.1875 26-27 21.877734716839605 25.890736342042754 27.15339417427178 25.078134766845857 28-29 21.8 26.3625 26.1125 25.724999999999998 30-31 21.25 26.6625 26.950000000000003 25.137500000000003 32-33 21.975 25.624999999999996 26.937499999999996 25.4625 34-35 22.275 26.174999999999997 27.1625 24.3875 36-37 21.6 25.25 27.125 26.025 38-39 21.575 25.887500000000003 26.575 25.9625 40-41 22.125 26.325 25.55 26.0 42-43 21.5625 25.174999999999997 27.55 25.7125 44-45 22.2125 25.575 26.687499999999996 25.525 46-47 21.912499999999998 26.150000000000002 26.7125 25.224999999999998 48-49 22.55 25.8625 26.275 25.3125 50-51 22.400000000000002 26.575 26.3125 24.712500000000002 52-53 21.712500000000002 26.05 25.5625 26.674999999999997 54-55 22.0875 25.0625 26.3625 26.487500000000004 56-57 22.425 25.7375 26.6 25.2375 58-59 22.5625 26.85 25.275 25.3125 60-61 22.8125 25.575 26.2875 25.324999999999996 62-63 22.5625 26.5625 26.1625 24.712500000000002 64-65 23.0375 25.825 25.45 25.687500000000004 66-67 22.1375 25.387500000000003 25.900000000000002 26.575 68-69 22.650000000000002 26.1 26.8375 24.4125 70-71 21.9 26.1 26.375 25.624999999999996 72-73 22.025 25.937500000000004 25.1875 26.85 74-75 22.55 26.275 26.2875 24.887500000000003 76-77 21.987499999999997 25.7375 26.437500000000004 25.837500000000002 78-79 22.1875 26.625 25.474999999999998 25.7125 80-81 23.4125 25.624999999999996 25.837500000000002 25.124999999999996 82-83 22.8875 25.525 25.7875 25.8 84-85 23.150000000000002 25.837500000000002 25.95 25.0625 86-87 22.1 25.5125 26.387500000000003 26.0 88-89 22.7125 25.7875 26.487500000000004 25.0125 90-91 23.2375 25.124999999999996 26.525 25.112499999999997 92-93 23.075000000000003 25.7875 25.674999999999997 25.4625 94-95 22.7125 25.7125 25.837500000000002 25.7375 96-97 22.625 26.05 26.1 25.224999999999998 98-99 23.799999999999997 25.374999999999996 25.874999999999996 24.95 100-101 23.5875 25.324999999999996 25.687500000000004 25.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 1.0 26 1.0 27 1.0 28 2.0 29 4.5 30 4.0 31 2.5 32 10.0 33 19.5 34 25.0 35 38.0 36 58.5 37 62.5 38 90.5 39 118.0 40 126.5 41 162.0 42 190.5 43 219.0 44 219.5 45 203.5 46 220.0 47 222.0 48 204.0 49 191.0 50 176.0 51 163.0 52 149.5 53 133.5 54 113.0 55 105.5 56 120.5 57 111.0 58 91.5 59 81.0 60 67.5 61 58.5 62 53.5 63 47.5 64 39.5 65 28.5 66 20.0 67 15.0 68 8.5 69 7.5 70 7.5 71 3.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.05 9 0.025 10-11 0.025 12-13 0.025 14-15 0.17500000000000002 16-17 0.11249999999999999 18-19 0.0125 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78419452887537 97.5 2 1.1144883485309016 2.1999999999999997 3 0.10131712259371835 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610833 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610833_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.4765 32.0 27.0 33.0 18.0 33.0 2 28.817 32.0 27.0 33.0 18.0 33.0 3 25.5075 27.0 18.0 32.0 18.0 33.0 4 27.204 30.0 25.0 33.0 15.0 33.0 5 27.91775 32.0 25.0 33.0 15.0 33.0 6 25.2605 26.0 16.0 36.0 14.0 38.0 7 28.58 29.0 16.0 37.0 16.0 38.0 8 30.62725 34.0 26.0 37.0 16.0 38.0 9 31.11975 36.0 28.0 38.0 16.0 38.0 10-11 31.488374999999998 36.0 28.0 38.0 16.0 38.0 12-13 31.604 36.5 28.0 38.0 16.0 38.0 14-15 31.789 36.5 28.0 38.0 16.0 38.0 16-17 31.603875000000002 36.5 27.5 38.0 16.0 38.0 18-19 31.5545 36.0 27.5 38.0 16.0 38.0 20-21 31.667250000000003 36.5 28.0 38.0 16.0 38.0 22-23 31.742874999999998 36.5 28.0 38.0 16.0 38.0 24-25 31.19875 36.0 27.0 38.0 16.0 38.0 26-27 31.352249999999998 36.0 26.5 38.0 16.0 38.0 28-29 29.69025 33.5 21.5 38.0 15.5 38.0 30-31 30.975875000000002 35.5 27.0 38.0 16.0 38.0 32-33 31.640375 36.5 27.0 38.0 16.0 38.0 34-35 31.77875 36.5 28.0 38.0 16.0 38.0 36-37 31.39025 36.5 26.5 38.0 16.0 38.0 38-39 31.5235 36.0 27.0 38.0 16.0 38.0 40-41 31.762875 37.0 28.0 38.0 16.0 38.0 42-43 31.665375 36.5 27.5 38.0 16.0 38.0 44-45 31.877125 37.0 28.0 38.0 16.0 38.0 46-47 31.582375 37.0 27.0 38.0 16.0 38.0 48-49 31.899124999999998 37.0 28.0 38.0 16.0 38.0 50-51 32.063625 37.0 28.0 38.0 16.0 38.0 52-53 31.94925 37.0 28.0 38.0 16.0 38.0 54-55 31.847125 37.0 28.0 38.0 16.0 38.0 56-57 31.62075 36.5 27.5 38.0 16.0 38.0 58-59 31.820500000000003 37.0 28.0 38.0 16.0 38.0 60-61 31.779625 37.0 27.5 38.0 16.0 38.0 62-63 31.641875 36.5 27.0 38.0 16.0 38.0 64-65 31.637 36.5 27.5 38.0 16.0 38.0 66-67 31.61675 36.0 27.5 38.0 16.0 38.0 68-69 31.78575 36.5 28.0 38.0 16.0 38.0 70-71 31.738 36.5 27.5 38.0 15.5 38.0 72-73 31.623874999999998 36.5 27.0 38.0 15.5 38.0 74-75 31.2895 36.0 26.5 38.0 15.0 38.0 76-77 31.619875 36.0 27.0 38.0 15.0 38.0 78-79 30.973875 36.0 26.0 38.0 15.0 38.0 80-81 30.889 36.0 25.5 38.0 15.0 38.0 82-83 30.81875 36.0 25.0 38.0 15.0 38.0 84-85 31.265124999999998 36.0 26.5 38.0 15.0 38.0 86-87 30.913625 36.0 26.0 38.0 15.0 38.0 88-89 31.16375 36.0 26.0 38.0 15.0 38.0 90-91 30.920250000000003 36.0 25.5 38.0 15.0 38.0 92-93 30.773 35.5 25.0 38.0 15.0 38.0 94-95 30.85875 36.0 25.5 38.0 15.0 38.0 96-97 30.833125000000003 35.5 25.0 38.0 15.0 38.0 98-99 30.88325 36.0 25.0 38.0 15.0 38.0 100-101 29.110625 32.0 20.0 37.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 21.0 18 61.0 19 73.0 20 93.0 21 121.0 22 124.0 23 136.0 24 124.0 25 143.0 26 147.0 27 143.0 28 138.0 29 154.0 30 177.0 31 175.0 32 222.0 33 235.0 34 307.0 35 359.0 36 568.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.55 14.299999999999999 15.125 40.025 2 27.775 21.099999999999998 32.125 19.0 3 23.549999999999997 21.625 31.15 23.674999999999997 4 26.900000000000002 31.1 18.85 23.150000000000002 5 27.525 32.2 20.375 19.900000000000002 6 22.625 31.374999999999996 25.7 20.3 7 21.875 16.2 36.5 25.424999999999997 8 23.549999999999997 21.525 26.375 28.549999999999997 9 24.925 21.5 28.95 24.625 10-11 27.250000000000004 27.650000000000002 21.3125 23.7875 12-13 25.5125 23.625 24.875 25.9875 14-15 25.4625 25.374999999999996 25.55 23.6125 16-17 26.7125 25.337500000000002 23.45 24.5 18-19 25.3 25.8625 25.412499999999998 23.425 20-21 25.387500000000003 25.45 25.05 24.1125 22-23 25.662499999999998 25.624999999999996 24.5625 24.15 24-25 25.374999999999996 25.124999999999996 24.837500000000002 24.6625 26-27 25.362499999999997 26.8375 25.0125 22.787499999999998 28-29 25.8125 25.900000000000002 24.75 23.5375 30-31 25.662499999999998 26.125 24.349999999999998 23.8625 32-33 25.7125 25.362499999999997 24.675 24.25 34-35 25.765720715089387 25.753219152394045 24.990623827978496 23.49043630453807 36-37 25.43815723585378 26.089133700550825 25.162744116174263 23.309964947421133 38-39 26.06629143214509 26.12883051907442 24.552845528455283 23.2520325203252 40-41 25.9819864898674 25.769326995246434 24.455841881411057 23.792844633475106 42-43 24.805618259342864 26.824680210684726 24.5673438675696 23.80235766240281 44-45 24.752970606629145 26.70419011882427 24.978111319574733 23.564727954971858 46-47 25.30060120240481 26.44038076152305 24.862224448897795 23.39679358717435 48-49 24.421658121795673 25.809678629486054 26.072277103913965 23.6963861448043 50-51 25.575 25.9875 25.687500000000004 22.75 52-53 25.3 26.237500000000004 24.5 23.962500000000002 54-55 24.5625 27.187499999999996 24.875 23.375 56-57 25.0125 26.1625 25.724999999999998 23.1 58-59 26.1125 25.637500000000003 25.162499999999998 23.0875 60-61 24.887500000000003 25.7875 24.9375 24.3875 62-63 24.953119139892486 26.303287910988875 25.478184773096636 23.265408176022003 64-65 25.4375 25.587500000000002 25.5375 23.4375 66-67 25.3 26.3 25.337500000000002 23.0625 68-69 24.837500000000002 26.375 25.4625 23.325000000000003 70-71 25.803225403175396 26.715839479934996 24.928116014501814 22.552819102387797 72-73 25.4375 26.05 25.974999999999998 22.537499999999998 74-75 25.775 27.200000000000003 25.0375 21.987499999999997 76-77 26.2875 25.112499999999997 25.2625 23.3375 78-79 24.625 25.15 26.887499999999996 23.3375 80-81 25.7875 26.0625 25.4375 22.7125 82-83 26.200000000000003 25.825 24.837500000000002 23.1375 84-85 25.825 24.9125 26.424999999999997 22.8375 86-87 26.0 26.224999999999998 25.4875 22.287499999999998 88-89 26.525 24.462500000000002 26.2125 22.8 90-91 25.937500000000004 26.275 25.2375 22.55 92-93 24.9875 26.424999999999997 25.7125 22.875 94-95 26.150000000000002 26.75 25.15 21.95 96-97 25.724999999999998 26.237500000000004 25.6 22.4375 98-99 25.8 26.85 25.424999999999997 21.925 100-101 25.525 25.424999999999997 25.6 23.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 1.0 29 1.5 30 2.0 31 3.0 32 5.0 33 9.0 34 14.0 35 24.0 36 40.0 37 49.0 38 63.5 39 96.5 40 118.0 41 136.0 42 167.0 43 189.0 44 209.5 45 213.5 46 214.5 47 212.0 48 195.5 49 184.5 50 179.5 51 164.5 52 145.5 53 141.5 54 147.0 55 142.5 56 124.5 57 114.0 58 118.5 59 116.5 60 96.5 61 77.0 62 65.0 63 58.0 64 42.5 65 32.0 66 28.0 67 21.0 68 12.0 69 8.5 70 7.5 71 3.5 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.15 38-39 0.0625 40-41 0.075 42-43 0.325 44-45 0.0625 46-47 0.2 48-49 0.0375 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0125 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.30000000000000004 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.6625 0.0 0.0 0.0 0.0 88-89 0.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139607 spots for ERR10610833.sra Written 139607 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra Read 139604 spots for ERR10610833.sra Written 139604 spots for ERR10610833.sra SRR ids: ['ERR10610833.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__t5xrmko ERR10610833.sra spots: 2792083 blocks: [[1, 139604], [139605, 279208], [279209, 418812], [418813, 558416], [558417, 698020], [698021, 837624], [837625, 977228], [977229, 1116832], [1116833, 1256436], [1256437, 1396040], [1396041, 1535644], [1535645, 1675248], [1675249, 1814852], [1814853, 1954456], [1954457, 2094060], [2094061, 2233664], [2233665, 2373268], [2373269, 2512872], [2512873, 2652476], [2652477, 2792083]] ERR10610833 file size 668585 ERR10610833 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610833 ERR10610833_1.fastq ERR10610833_2.fastq Input file: ERR10610833_1.fastq Paired file: ERR10610833_2.fastq trimmed: ERR10610833-trimmed-pair1.fastq, ERR10610833-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:31:35 2024 >> started Fri Dec 6 20:31:39 2024 >> done (3.469s) 2792083 read pairs processed; of these: 6 ( 0.00%) short read pairs filtered out after trimming by size control 164 ( 0.01%) empty read pairs filtered out after trimming by size control 2791913 (99.99%) read pairs available; of these: 86703 ( 3.11%) trimmed read pairs available after processing 2705210 (96.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 24 1 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 5 0.00% 32 0 0.00% 33 2 0.00% 34 4 0.00% 35 4 0.00% 36 5 0.00% 37 4 0.00% 38 7 0.00% 39 7 0.00% 40 4 0.00% 41 14 0.00% 42 11 0.00% 43 16 0.00% 44 17 0.00% 45 14 0.00% 46 19 0.00% 47 28 0.00% 48 25 0.00% 49 29 0.00% 50 31 0.00% 51 39 0.00% 52 52 0.00% 53 45 0.00% 54 44 0.00% 55 61 0.00% 56 63 0.00% 57 60 0.00% 58 96 0.00% 59 90 0.00% 60 119 0.00% 61 139 0.00% 62 128 0.00% 63 130 0.00% 64 179 0.01% 65 181 0.01% 66 259 0.01% 67 254 0.01% 68 255 0.01% 69 327 0.01% 70 329 0.01% 71 374 0.01% 72 412 0.01% 73 493 0.02% 74 596 0.02% 75 638 0.02% 76 724 0.03% 77 769 0.03% 78 811 0.03% 79 1014 0.04% 80 1174 0.04% 81 1264 0.05% 82 1456 0.05% 83 1630 0.06% 84 1765 0.06% 85 1968 0.07% 86 2160 0.08% 87 2457 0.09% 88 2759 0.10% 89 3054 0.11% 90 3202 0.11% 91 3642 0.13% 92 3887 0.14% 93 4341 0.16% 94 4773 0.17% 95 5137 0.18% 96 5443 0.19% 97 6213 0.22% 98 6569 0.24% 99 7200 0.26% 100 7678 0.28% 101 2705210 96.89% 2791913 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=24 prefix-density=0.41 prefix-fanout=2.1 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=70.09 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.4 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=15 prefix-density=0.36 prefix-fanout=3.2 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=15.67 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.0 sequence=AGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCT ERR10610833 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:32:22 Started mapping on | Dec 06 20:32:22 Finished on | Dec 06 20:33:24 Mapping speed, Million of reads per hour | 162.11 Number of input reads | 2791913 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 2414941 Uniquely mapped reads % | 86.50% Average mapped length | 199.83 Number of splices: Total | 1529707 Number of splices: Annotated (sjdb) | 1436204 Number of splices: GT/AG | 1508864 Number of splices: GC/AG | 18522 Number of splices: AT/AC | 465 Number of splices: Non-canonical | 1856 Mismatch rate per base, % | 0.96% Deletion rate per base | 0.01% Deletion average length | 2.02 Insertion rate per base | 0.01% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 111982 % of reads mapped to multiple loci | 4.01% Number of reads mapped to too many loci | 4580 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.58% % of reads unmapped: other | 1.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 264990 264990 264990 N_multimapping 111982 111982 111982 N_noFeature 99081 2352312 111583 N_ambiguous 58741 192 8740 UnstrandedReadsAssigned:2257119 PositiveStrandReadsAssigned:62437 NegativeStrandReadsAssigned:2294618 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610833 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610833-trimmed-pair1.fastq ERR10610833-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,791,913 reads, 2,384,504 reads pseudoaligned [quant] estimated average fragment length: 170.25 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52973 ERR10610833.ke.tsv 35125 ERR10610833.se.tsv 88098 total ==> ERR10610833.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 766.883 0 0 PNS24247 1044 874.75 4.70685 3.27304 PNS24249 1928 1758.75 2.29226 0.792802 PNS24246 1044 874.75 4.70685 3.27304 PNS24248 1044 874.75 4.70685 3.27304 PNS24244 1471 1301.75 12.5872 5.88174 PNS24243 293 130.299 0 0 KQK14069 1603 1433.75 23 9.75797 KQK14071 474 306.171 0 0 ==> ERR10610833.se.tsv <== BRADI_1g14170v3 23 BRADI_1g53295v3 7 BRADI_1g59795v3 71 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 26 BRADI_1g74790v3 20 BRADI_1g09890v3 0 BRADI_1g77505v3 44 BRADI_1g48960v3 0 ERR10610833 completed mapping pipeline successfully