Starting /dee2/code/volunteer_pipeline.sh ERR10610835 current disk space = 1549423415296 free memory = 1599941872 ERR10610835 SRAfilesize aacd92eda3403b740130dacf2f20d8f4 ERR10610835.sra ERR10610835.sra file validated ERR10610835 is paired end ERR10610835 is conventional basespace ERR10610835 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610835_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.486 31.0 18.0 33.0 18.0 33.0 2 26.67725 28.0 18.0 32.0 18.0 33.0 3 29.0705 32.0 27.0 33.0 18.0 33.0 4 29.911 32.0 30.0 33.0 15.0 33.0 5 29.57525 32.0 30.0 33.0 15.0 33.0 6 31.6735 36.0 29.0 38.0 16.0 38.0 7 32.5355 37.0 29.0 38.0 16.0 38.0 8 32.0545 36.0 29.0 38.0 16.0 38.0 9 32.90425 37.0 31.0 38.0 16.0 38.0 10-11 33.294125 37.5 32.0 38.0 16.0 38.0 12-13 33.33825 38.0 32.0 38.0 16.0 38.0 14-15 33.276624999999996 38.0 32.0 38.0 16.0 38.0 16-17 33.34625 38.0 32.0 38.0 16.0 38.0 18-19 33.443625 38.0 33.0 38.0 16.0 38.0 20-21 33.4365 38.0 33.0 38.0 16.0 38.0 22-23 33.599625 38.0 33.0 38.0 16.0 38.0 24-25 33.276375 38.0 32.5 38.0 16.0 38.0 26-27 33.62625 38.0 33.0 38.0 16.0 38.0 28-29 33.620625000000004 38.0 33.0 38.0 16.0 38.0 30-31 33.590999999999994 38.0 33.0 38.0 16.0 38.0 32-33 33.684125 38.0 33.5 38.0 16.0 38.0 34-35 33.851 38.0 33.5 38.0 16.0 38.0 36-37 33.71375 38.0 33.5 38.0 16.0 38.0 38-39 33.78675 38.0 33.5 38.0 16.0 38.0 40-41 33.763000000000005 38.0 33.5 38.0 16.0 38.0 42-43 33.75775 38.0 33.5 38.0 16.0 38.0 44-45 33.804125 38.0 34.0 38.0 16.0 38.0 46-47 33.664625 38.0 33.5 38.0 16.0 38.0 48-49 33.735875 38.0 33.5 38.0 16.0 38.0 50-51 33.522375 38.0 33.0 38.0 16.0 38.0 52-53 33.755624999999995 38.0 33.0 38.0 16.0 38.0 54-55 33.715875 38.0 33.0 38.0 16.0 38.0 56-57 33.656125 38.0 33.0 38.0 16.0 38.0 58-59 33.422 38.0 33.0 38.0 16.0 38.0 60-61 33.5245 38.0 33.0 38.0 16.0 38.0 62-63 33.434375 38.0 33.0 38.0 16.0 38.0 64-65 33.61825 38.0 33.5 38.0 16.0 38.0 66-67 33.52075000000001 38.0 33.0 38.0 16.0 38.0 68-69 33.765625 38.0 34.0 38.0 16.0 38.0 70-71 33.683125 38.0 33.5 38.0 16.0 38.0 72-73 33.3905 38.0 33.0 38.0 16.0 38.0 74-75 33.568124999999995 38.0 33.0 38.0 16.0 38.0 76-77 33.448875 38.0 33.0 38.0 15.5 38.0 78-79 33.525625000000005 38.0 33.0 38.0 16.0 38.0 80-81 33.6355 38.0 34.0 38.0 15.5 38.0 82-83 33.310500000000005 38.0 33.0 38.0 15.0 38.0 84-85 33.389125 38.0 33.0 38.0 15.5 38.0 86-87 33.3025 38.0 32.5 38.0 15.5 38.0 88-89 33.009375 38.0 32.0 38.0 15.0 38.0 90-91 33.43625 38.0 33.0 38.0 15.0 38.0 92-93 33.137125 38.0 33.0 38.0 15.0 38.0 94-95 33.160250000000005 38.0 33.0 38.0 15.0 38.0 96-97 33.226 38.0 33.0 38.0 15.0 38.0 98-99 32.688874999999996 37.0 31.0 38.0 15.0 38.0 100-101 31.9155 36.0 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 6.0 18 14.0 19 47.0 20 59.0 21 55.0 22 67.0 23 62.0 24 98.0 25 80.0 26 103.0 27 104.0 28 122.0 29 119.0 30 125.0 31 162.0 32 157.0 33 212.0 34 307.0 35 378.0 36 619.0 37 1104.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.1010101010101 8.636363636363637 10.176767676767676 51.08585858585859 2 20.724999999999998 15.725 35.449999999999996 28.1 3 23.175 18.2 25.124999999999996 33.5 4 25.8 28.525 21.8 23.875 5 24.175 31.8 26.3 17.724999999999998 6 20.7 32.2 26.150000000000002 20.95 7 15.950000000000001 22.475 42.625 18.95 8 19.379844961240313 22.20555138784696 31.632908227056767 26.78169542385596 9 19.075 22.125 34.599999999999994 24.2 10-11 21.952744093011624 30.27878484810601 24.278034754344294 23.49043630453807 12-13 21.627703462932867 23.865483185398176 28.6160770096262 25.890736342042754 14-15 21.394591887831748 24.44917376064096 29.031046569854784 25.12518778167251 16-17 22.280570142535634 26.25656414103526 26.9567391847962 24.50612653163291 18-19 22.1875 26.6625 26.474999999999998 24.675 20-21 21.1125 25.887500000000003 27.625 25.374999999999996 22-23 21.95 26.125 27.237499999999997 24.6875 24-25 21.4875 26.4125 26.6 25.5 26-27 21.8125 25.75 27.737499999999997 24.7 28-29 21.987499999999997 25.587500000000002 27.212500000000002 25.2125 30-31 22.325 25.5125 26.6625 25.5 32-33 21.55 26.5625 27.125 24.762500000000003 34-35 22.6375 25.174999999999997 27.150000000000002 25.0375 36-37 21.587500000000002 26.275 26.9625 25.174999999999997 38-39 22.55 26.125 26.687499999999996 24.637500000000003 40-41 23.1 26.5625 26.075 24.2625 42-43 21.712500000000002 25.424999999999997 26.937499999999996 25.924999999999997 44-45 22.575 25.7125 26.5875 25.124999999999996 46-47 21.7875 26.75 26.85 24.6125 48-49 22.95 25.874999999999996 26.5375 24.637500000000003 50-51 22.1875 25.9875 26.8125 25.0125 52-53 22.4375 25.9875 26.674999999999997 24.9 54-55 22.35 26.3125 26.5875 24.75 56-57 22.0125 25.5 26.674999999999997 25.8125 58-59 21.55 26.35 26.6125 25.4875 60-61 22.625 24.675 26.974999999999998 25.724999999999998 62-63 21.9375 26.7125 26.137500000000003 25.2125 64-65 22.4625 26.3 26.4125 24.825 66-67 22.412499999999998 25.775 26.7625 25.05 68-69 22.2625 25.674999999999997 26.5375 25.525 70-71 23.125 25.662499999999998 26.2625 24.95 72-73 22.8 26.200000000000003 26.2625 24.7375 74-75 22.3875 25.5125 26.474999999999998 25.624999999999996 76-77 21.6125 26.4125 26.487500000000004 25.4875 78-79 21.825 25.087500000000002 26.8 26.2875 80-81 22.4375 25.587500000000002 26.474999999999998 25.5 82-83 22.475 25.3125 26.687499999999996 25.525 84-85 22.650000000000002 25.9875 26.275 25.087500000000002 86-87 22.475 25.924999999999997 26.85 24.75 88-89 22.1 25.4375 25.95 26.5125 90-91 23.5875 25.650000000000002 25.937500000000004 24.825 92-93 23.1875 26.3125 25.074999999999996 25.424999999999997 94-95 22.4875 26.0625 26.2875 25.162499999999998 96-97 21.85 26.2625 25.8125 26.075 98-99 23.45 25.387500000000003 26.6125 24.55 100-101 22.675 26.450000000000003 26.025 24.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.5 29 3.0 30 4.5 31 6.5 32 12.0 33 22.5 34 30.5 35 36.5 36 47.0 37 62.0 38 83.0 39 107.5 40 145.0 41 170.5 42 182.0 43 201.0 44 222.0 45 231.5 46 241.0 47 246.0 48 225.5 49 204.0 50 180.0 51 165.5 52 148.5 53 127.0 54 115.5 55 104.0 56 101.5 57 90.0 58 76.0 59 73.0 60 62.5 61 57.0 62 50.0 63 40.5 64 36.0 65 28.5 66 20.5 67 15.0 68 11.5 69 5.0 70 2.5 71 1.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.025 9 0.0 10-11 0.0125 12-13 0.0125 14-15 0.15 16-17 0.025 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16750756811302 98.275 2 0.7820383451059535 1.55 3 0.025227043390514632 0.075 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.5375 0.0 0.0 0.0 0.0 86-87 0.7125 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTTGT 15 0.009957196 47.5 66-67 >>END_MODULE ERR10610835 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610835_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.299 32.0 27.0 33.0 18.0 33.0 2 29.70575 32.0 27.0 33.0 18.0 33.0 3 26.402 28.0 18.0 33.0 18.0 33.0 4 28.19325 32.0 27.0 33.0 15.0 33.0 5 29.13225 32.0 27.0 33.0 15.0 33.0 6 26.80075 29.0 16.0 37.0 15.0 38.0 7 30.065 33.0 26.0 38.0 16.0 38.0 8 31.88825 36.0 29.0 38.0 16.0 38.0 9 32.47525 37.0 29.0 38.0 16.0 38.0 10-11 32.9165 37.0 30.0 38.0 16.0 38.0 12-13 33.052375 38.0 31.0 38.0 16.0 38.0 14-15 33.212 38.0 32.0 38.0 16.0 38.0 16-17 33.029624999999996 37.5 31.0 38.0 16.0 38.0 18-19 32.8925 38.0 30.0 38.0 16.0 38.0 20-21 32.937124999999995 37.5 30.5 38.0 16.0 38.0 22-23 33.211625 38.0 32.0 38.0 16.0 38.0 24-25 32.696875 37.0 29.0 38.0 16.0 38.0 26-27 32.963875 37.5 31.0 38.0 16.0 38.0 28-29 31.29775 36.0 23.5 38.0 16.0 38.0 30-31 32.47125 37.0 28.5 38.0 16.0 38.0 32-33 33.054125 38.0 31.0 38.0 16.0 38.0 34-35 33.132625000000004 38.0 31.0 38.0 16.0 38.0 36-37 32.7415 37.5 30.0 38.0 16.0 38.0 38-39 32.931250000000006 38.0 30.5 38.0 16.0 38.0 40-41 33.177499999999995 38.0 31.0 38.0 16.0 38.0 42-43 32.951125000000005 38.0 31.0 38.0 16.0 38.0 44-45 33.282125 38.0 32.0 38.0 16.0 38.0 46-47 33.040125 38.0 31.0 38.0 16.0 38.0 48-49 33.311375 38.0 33.0 38.0 16.0 38.0 50-51 33.452375 38.0 33.0 38.0 16.0 38.0 52-53 33.53275 38.0 33.0 38.0 16.0 38.0 54-55 33.290625000000006 38.0 32.0 38.0 16.0 38.0 56-57 33.17825 38.0 31.5 38.0 16.0 38.0 58-59 33.21425 38.0 32.0 38.0 16.0 38.0 60-61 33.292125 38.0 33.0 38.0 16.0 38.0 62-63 33.161874999999995 38.0 32.0 38.0 16.0 38.0 64-65 33.166875 38.0 31.5 38.0 16.0 38.0 66-67 33.13575 38.0 32.0 38.0 16.0 38.0 68-69 33.301625 38.0 32.0 38.0 16.0 38.0 70-71 33.114875 38.0 32.0 38.0 16.0 38.0 72-73 33.193124999999995 38.0 31.5 38.0 16.0 38.0 74-75 32.878125 37.5 31.0 38.0 16.0 38.0 76-77 33.154125 38.0 32.0 38.0 16.0 38.0 78-79 32.5985 37.5 30.0 38.0 15.5 38.0 80-81 32.618875 37.0 29.0 38.0 15.5 38.0 82-83 32.633125 37.0 29.0 38.0 15.5 38.0 84-85 32.928250000000006 38.0 31.0 38.0 15.0 38.0 86-87 32.55625 37.0 29.0 38.0 15.0 38.0 88-89 32.642375 37.0 30.5 38.0 15.0 38.0 90-91 32.6325 37.0 30.0 38.0 15.0 38.0 92-93 32.625 37.0 31.0 38.0 15.0 38.0 94-95 32.748999999999995 37.0 31.0 38.0 15.0 38.0 96-97 32.595749999999995 37.5 30.0 38.0 15.0 38.0 98-99 32.54774999999999 37.0 30.0 38.0 15.0 38.0 100-101 30.570750000000004 35.5 26.0 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 20.0 18 49.0 19 66.0 20 62.0 21 67.0 22 77.0 23 81.0 24 100.0 25 108.0 26 84.0 27 98.0 28 128.0 29 124.0 30 133.0 31 159.0 32 199.0 33 203.0 34 299.0 35 390.0 36 643.0 37 908.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.324999999999996 14.099999999999998 15.8 38.775 2 26.625 22.15 33.95 17.275 3 20.125 23.125 33.800000000000004 22.95 4 26.25 32.550000000000004 18.975 22.225 5 26.775 33.15 20.5 19.575 6 20.275000000000002 33.825 26.8 19.1 7 19.7 17.299999999999997 40.225 22.775000000000002 8 24.525 22.1 26.625 26.75 9 24.2 21.75 28.849999999999998 25.2 10-11 26.125 29.012500000000003 21.175 23.6875 12-13 24.8 24.1125 26.174999999999997 24.9125 14-15 25.5625 25.650000000000002 25.624999999999996 23.1625 16-17 25.937500000000004 25.6125 24.825 23.625 18-19 26.05 26.1125 24.575 23.2625 20-21 25.5 26.125 25.162499999999998 23.2125 22-23 25.35 25.0375 25.5625 24.05 24-25 25.4375 25.775 25.650000000000002 23.1375 26-27 23.9125 26.275 25.362499999999997 24.45 28-29 25.624999999999996 25.525 24.8125 24.0375 30-31 25.45 26.7125 24.9375 22.900000000000002 32-33 25.15 26.1625 25.2375 23.45 34-35 25.137500000000003 25.7625 25.662499999999998 23.4375 36-37 25.41990473802958 25.3823013286538 25.33216344948609 23.865630483830532 38-39 24.371639364761783 26.672502188320617 25.5220707765412 23.43378767037639 40-41 26.463231615807903 25.337668834417208 24.64982491245623 23.54927463731866 42-43 25.317410433689503 25.883092394720304 26.10936517913262 22.690131992457573 44-45 25.331332833208304 27.106776694173547 24.868717179294826 22.693173293323333 46-47 25.952380952380956 25.513784461152884 25.225563909774433 23.308270676691727 48-49 26.690836354544317 25.59069883735467 24.840605075634453 22.877859732466558 50-51 25.5 26.3 25.5625 22.6375 52-53 25.112499999999997 25.25 26.337500000000002 23.3 54-55 24.3125 26.387500000000003 25.912499999999998 23.3875 56-57 25.85 26.05 25.087500000000002 23.0125 58-59 26.125 25.362499999999997 25.5625 22.95 60-61 25.4 26.687499999999996 24.075 23.8375 62-63 25.2875 26.5 25.974999999999998 22.237499999999997 64-65 25.9625 26.087500000000002 25.887500000000003 22.0625 66-67 24.8625 25.9625 26.200000000000003 22.975 68-69 24.7375 26.637499999999996 25.5375 23.0875 70-71 25.10627656914228 26.231557889472366 25.55638909727432 23.10577644411103 72-73 25.1 26.2125 25.674999999999997 23.0125 74-75 24.7875 26.787499999999998 25.974999999999998 22.45 76-77 25.45 25.95 25.937500000000004 22.662499999999998 78-79 24.525 25.85 26.8625 22.7625 80-81 25.575 26.1 25.75 22.575 82-83 25.587500000000002 25.5 26.5 22.412499999999998 84-85 24.474999999999998 26.8375 26.575 22.112499999999997 86-87 25.3 25.912499999999998 26.5125 22.275 88-89 26.137500000000003 25.7 26.237500000000004 21.925 90-91 24.075 26.724999999999998 25.775 23.425 92-93 24.8625 27.250000000000004 25.3 22.5875 94-95 25.7125 26.387500000000003 25.2 22.7 96-97 25.687500000000004 25.974999999999998 25.775 22.5625 98-99 25.650000000000002 27.05 25.6 21.7 100-101 25.2875 26.137500000000003 25.874999999999996 22.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 0.5 27 1.5 28 3.5 29 3.0 30 5.0 31 8.5 32 10.0 33 12.0 34 18.5 35 28.0 36 31.5 37 52.5 38 79.5 39 105.5 40 129.5 41 135.0 42 167.0 43 198.5 44 208.5 45 220.0 46 226.5 47 226.0 48 223.0 49 210.5 50 188.5 51 172.0 52 159.0 53 149.5 54 121.0 55 104.0 56 108.0 57 100.5 58 93.0 59 90.0 60 84.5 61 67.0 62 56.5 63 50.0 64 39.0 65 35.5 66 28.0 67 15.5 68 12.0 69 11.0 70 5.5 71 2.5 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.27499999999999997 38-39 0.0375 40-41 0.05 42-43 0.5625 44-45 0.025 46-47 0.25 48-49 0.0125 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.025 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137046 spots for ERR10610835.sra Written 137046 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra Read 137039 spots for ERR10610835.sra Written 137039 spots for ERR10610835.sra SRR ids: ['ERR10610835.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_azu7a9dp ERR10610835.sra spots: 2740787 blocks: [[1, 137039], [137040, 274078], [274079, 411117], [411118, 548156], [548157, 685195], [685196, 822234], [822235, 959273], [959274, 1096312], [1096313, 1233351], [1233352, 1370390], [1370391, 1507429], [1507430, 1644468], [1644469, 1781507], [1781508, 1918546], [1918547, 2055585], [2055586, 2192624], [2192625, 2329663], [2329664, 2466702], [2466703, 2603741], [2603742, 2740787]] ERR10610835 file size 656262 ERR10610835 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610835 ERR10610835_1.fastq ERR10610835_2.fastq Input file: ERR10610835_1.fastq Paired file: ERR10610835_2.fastq trimmed: ERR10610835-trimmed-pair1.fastq, ERR10610835-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:40:41 2024 >> started Fri Dec 6 20:40:44 2024 >> done (2.614s) 2740787 read pairs processed; of these: 9 ( 0.00%) short read pairs filtered out after trimming by size control 123 ( 0.00%) empty read pairs filtered out after trimming by size control 2740655 (100.00%) read pairs available; of these: 77794 ( 2.84%) trimmed read pairs available after processing 2662861 (97.16%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 4 0.00% 30 0 0.00% 31 2 0.00% 32 0 0.00% 33 2 0.00% 34 3 0.00% 35 0 0.00% 36 0 0.00% 37 4 0.00% 38 5 0.00% 39 10 0.00% 40 5 0.00% 41 12 0.00% 42 15 0.00% 43 18 0.00% 44 13 0.00% 45 11 0.00% 46 10 0.00% 47 15 0.00% 48 29 0.00% 49 29 0.00% 50 31 0.00% 51 32 0.00% 52 41 0.00% 53 43 0.00% 54 49 0.00% 55 52 0.00% 56 62 0.00% 57 48 0.00% 58 62 0.00% 59 97 0.00% 60 87 0.00% 61 81 0.00% 62 118 0.00% 63 132 0.00% 64 145 0.01% 65 184 0.01% 66 186 0.01% 67 194 0.01% 68 204 0.01% 69 260 0.01% 70 309 0.01% 71 312 0.01% 72 388 0.01% 73 452 0.02% 74 475 0.02% 75 535 0.02% 76 661 0.02% 77 670 0.02% 78 814 0.03% 79 878 0.03% 80 1019 0.04% 81 1097 0.04% 82 1276 0.05% 83 1321 0.05% 84 1537 0.06% 85 1771 0.06% 86 1960 0.07% 87 2169 0.08% 88 2456 0.09% 89 2651 0.10% 90 2932 0.11% 91 3279 0.12% 92 3416 0.12% 93 3940 0.14% 94 4223 0.15% 95 4656 0.17% 96 5025 0.18% 97 5593 0.20% 98 6087 0.22% 99 6532 0.24% 100 7060 0.26% 101 2662861 97.16% 2740655 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=15 prefix-density=0.31 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=39.81 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=8.9 sequence=TTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.57 fanout-score-rank=7 prefix-density=0.38 prefix-fanout=4.2 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=69.76 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.9 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTG ERR10610835 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:41:39 Started mapping on | Dec 06 20:41:39 Finished on | Dec 06 20:42:21 Mapping speed, Million of reads per hour | 234.91 Number of input reads | 2740655 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 2475891 Uniquely mapped reads % | 90.34% Average mapped length | 200.06 Number of splices: Total | 1743110 Number of splices: Annotated (sjdb) | 1640656 Number of splices: GT/AG | 1720090 Number of splices: GC/AG | 20492 Number of splices: AT/AC | 611 Number of splices: Non-canonical | 1917 Mismatch rate per base, % | 0.86% Deletion rate per base | 0.01% Deletion average length | 2.18 Insertion rate per base | 0.01% Insertion average length | 1.77 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 49419 % of reads mapped to multiple loci | 1.80% Number of reads mapped to too many loci | 2275 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.94% % of reads unmapped: other | 0.83% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 215345 215345 215345 N_multimapping 49419 49419 49419 N_noFeature 85193 2411675 99603 N_ambiguous 58488 209 8888 UnstrandedReadsAssigned:2332210 PositiveStrandReadsAssigned:64007 NegativeStrandReadsAssigned:2367400 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610835 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610835-trimmed-pair1.fastq ERR10610835-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,740,655 reads, 2,437,511 reads pseudoaligned [quant] estimated average fragment length: 173.964 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,072 rounds 52973 ERR10610835.ke.tsv 35125 ERR10610835.se.tsv 88098 total ==> ERR10610835.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 763.147 0 0 PNS24247 1044 871.036 10.2001 7.38453 PNS24249 1928 1755.04 0 0 PNS24246 1044 871.036 10.2001 7.38453 PNS24248 1044 871.036 10.2001 7.38453 PNS24244 1471 1298.04 11.3998 5.53816 PNS24243 293 127.199 0 0 KQK14069 1603 1430.04 56.6438 24.9782 KQK14071 474 302.413 1.06928 2.2297 ==> ERR10610835.se.tsv <== BRADI_1g14170v3 72 BRADI_1g53295v3 18 BRADI_1g59795v3 68 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 44 BRADI_1g74790v3 15 BRADI_1g09890v3 0 BRADI_1g77505v3 65 BRADI_1g48960v3 0 ERR10610835 completed mapping pipeline successfully