Starting /dee2/code/volunteer_pipeline.sh ERR10610837 current disk space = 1549359161344 free memory = 1377994756 ERR10610837 SRAfilesize c2b0e13222832fe7c75613c8529d682a ERR10610837.sra ERR10610837.sra file validated ERR10610837 is paired end ERR10610837 is conventional basespace ERR10610837 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610837_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.83075 33.0 30.0 33.0 18.0 33.0 2 30.695 33.0 31.0 33.0 25.0 34.0 3 30.855 33.0 31.0 33.0 25.0 34.0 4 30.408 33.0 30.0 33.0 25.0 34.0 5 31.05125 33.0 32.0 33.0 27.0 34.0 6 33.74275 37.0 33.0 38.0 16.0 38.0 7 34.3965 38.0 34.0 38.0 26.0 38.0 8 34.66025 38.0 35.0 38.0 26.0 38.0 9 34.86275 38.0 35.0 38.0 27.0 38.0 10-11 34.876625000000004 38.0 35.5 38.0 26.0 38.0 12-13 34.8185 38.0 35.5 38.0 26.5 38.0 14-15 34.705124999999995 38.0 35.0 38.0 26.0 38.0 16-17 34.701375 38.0 35.0 38.0 26.0 38.0 18-19 34.71325 38.0 35.5 38.0 26.0 38.0 20-21 24.212125 22.0 22.0 28.5 15.0 33.0 22-23 32.448750000000004 35.5 30.5 37.0 20.5 37.5 24-25 34.583625 38.0 34.5 38.0 25.5 38.0 26-27 34.814750000000004 38.0 35.5 38.0 26.0 38.0 28-29 34.8155 38.0 36.0 38.0 25.0 38.0 30-31 34.963875 38.0 36.0 38.0 27.0 38.0 32-33 34.90125 38.0 36.0 38.0 25.0 38.0 34-35 34.939750000000004 38.0 36.0 38.0 26.0 38.0 36-37 34.823625 38.0 35.5 38.0 26.0 38.0 38-39 34.893 38.0 36.0 38.0 26.0 38.0 40-41 35.014250000000004 38.0 36.0 38.0 27.0 38.0 42-43 34.819 38.0 36.0 38.0 25.0 38.0 44-45 34.787875 38.0 35.5 38.0 25.0 38.0 46-47 34.815 38.0 36.0 38.0 25.0 38.0 48-49 27.424750000000003 27.0 26.0 31.5 20.5 35.5 50-51 29.871875000000003 32.0 27.5 33.5 16.0 37.5 52-53 33.879000000000005 37.5 33.5 38.0 24.0 38.0 54-55 27.23525 27.0 25.0 31.5 19.5 36.5 56-57 29.64725 31.0 27.5 33.0 20.0 37.5 58-59 33.884625 37.5 33.5 38.0 25.0 38.0 60-61 34.673874999999995 38.0 35.0 38.0 25.0 38.0 62-63 35.05475 38.0 36.0 38.0 27.0 38.0 64-65 34.943375 38.0 36.0 38.0 26.0 38.0 66-67 35.016625000000005 38.0 36.0 38.0 27.0 38.0 68-69 34.88575 38.0 36.0 38.0 25.0 38.0 70-71 34.867999999999995 38.0 35.5 38.0 26.0 38.0 72-73 24.100749999999998 22.0 21.0 27.5 15.0 36.5 74-75 32.019375 35.0 30.5 37.0 20.0 38.0 76-77 34.409375 38.0 34.0 38.0 25.0 38.0 78-79 34.732 38.0 35.5 38.0 25.0 38.0 80-81 34.820625 38.0 36.0 38.0 25.0 38.0 82-83 35.037875 38.0 36.0 38.0 27.0 38.0 84-85 35.00675 38.0 36.0 38.0 27.0 38.0 86-87 34.927125000000004 38.0 36.0 38.0 27.0 38.0 88-89 34.9935 38.0 36.0 38.0 26.5 38.0 90-91 34.761375 38.0 35.0 38.0 26.0 38.0 92-93 34.818875 38.0 35.5 38.0 26.0 38.0 94-95 33.584 37.5 32.5 38.0 20.0 38.0 96-97 34.357875 38.0 34.5 38.0 23.0 38.0 98-99 25.848499999999998 26.5 24.5 26.5 18.5 32.5 100-101 27.349 27.5 25.0 32.5 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 2.0 18 9.0 19 27.0 20 33.0 21 41.0 22 46.0 23 42.0 24 61.0 25 61.0 26 63.0 27 89.0 28 111.0 29 115.0 30 135.0 31 161.0 32 205.0 33 320.0 34 490.0 35 1389.0 36 519.0 37 79.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.482061647296614 10.257705912076807 10.434562910560889 54.82566953006569 2 20.7 18.75 36.025 24.525 3 23.525 20.075000000000003 23.425 32.975 4 25.575 28.299999999999997 20.125 26.0 5 24.15 32.975 25.05 17.825 6 18.575 34.55 26.5 20.375 7 15.457728864432216 22.461230615307652 41.82091045522761 20.260130065032516 8 19.650000000000002 22.325 31.15 26.875 9 17.175 21.224999999999998 35.325 26.275 10-11 20.817704426106527 31.48287071767942 23.705926481620406 23.99349837459365 12-13 21.458046767537827 24.821808178066775 28.060522696011002 25.659622358384393 14-15 20.237648530331455 27.07942464040025 28.055034396497813 24.62789243277048 16-17 22.698849424712357 26.300650325162582 26.150575287643825 24.84992496248124 18-19 20.633133133133132 26.851851851851855 27.97797797797798 24.537037037037038 20-21 20.090067550662997 32.18663997998499 21.691268451338505 26.032024018013512 22-23 21.235617808904454 26.40070035017509 26.850925462731368 25.512756378189096 24-25 20.785392696348172 26.813406703351678 27.051025512756375 25.350175087543768 26-27 21.462500000000002 27.5875 26.5375 24.4125 28-29 21.980495123780948 27.131782945736433 26.156539134783696 24.731182795698924 30-31 21.325 26.424999999999997 27.437499999999996 24.8125 32-33 21.275 26.924999999999997 27.1 24.7 34-35 21.765220652581576 27.665958244780597 26.103262907863485 24.46555819477435 36-37 21.54288572143036 26.356589147286826 27.26931732933233 24.831207801950487 38-39 22.0 27.275 26.125 24.6 40-41 21.7 26.5875 26.637499999999996 25.074999999999996 42-43 21.8304576144036 26.481620405101275 26.9567391847962 24.731182795698924 44-45 22.1875 26.85 26.7125 24.25 46-47 21.425 27.1375 26.487500000000004 24.95 48-49 22.775000000000002 25.837500000000002 25.5 25.887500000000003 50-51 20.974999999999998 26.974999999999998 27.275 24.775 52-53 22.287499999999998 26.1 27.0125 24.6 54-55 21.2875 30.5 23.7 24.5125 56-57 21.4125 27.224999999999998 26.9625 24.4 58-59 21.5 27.537499999999998 27.187499999999996 23.775 60-61 22.112499999999997 26.7125 25.8625 25.3125 62-63 21.075 26.637499999999996 26.900000000000002 25.387500000000003 64-65 21.3125 27.05 26.525 25.112499999999997 66-67 20.5625 27.075 27.3375 25.025 68-69 21.512500000000003 27.1625 26.525 24.8 70-71 22.2125 27.675 25.55 24.5625 72-73 22.8 30.2125 23.6875 23.3 74-75 21.375 26.2125 27.3125 25.1 76-77 21.55 26.150000000000002 26.987499999999997 25.3125 78-79 21.2875 26.137500000000003 27.0 25.575 80-81 21.25 26.137500000000003 26.737499999999997 25.874999999999996 82-83 22.025 26.974999999999998 26.375 24.625 84-85 22.15 26.2125 26.400000000000002 25.2375 86-87 22.075 26.674999999999997 26.200000000000003 25.05 88-89 21.345504564211577 26.24734275353258 27.135175690884083 25.271976991371766 90-91 22.4625 26.0625 26.55 24.925 92-93 21.780445111277817 27.53188297074269 26.106526631657918 24.58114528632158 94-95 22.537499999999998 25.8125 26.6 25.05 96-97 22.0125 26.137500000000003 26.6 25.25 98-99 24.2 27.575 24.0 24.224999999999998 100-101 21.587500000000002 26.737499999999997 26.325 25.35 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 1.5 29 2.5 30 3.5 31 10.0 32 15.0 33 15.5 34 26.0 35 44.5 36 55.0 37 67.0 38 89.5 39 121.0 40 147.0 41 182.5 42 207.0 43 233.0 44 253.5 45 232.5 46 224.5 47 229.0 48 228.5 49 227.5 50 211.0 51 179.0 52 160.5 53 130.5 54 110.0 55 109.5 56 94.0 57 79.0 58 71.5 59 57.0 60 41.0 61 33.5 62 28.5 63 26.0 64 21.5 65 12.5 66 5.5 67 5.0 68 4.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.0 9 0.0 10-11 0.025 12-13 0.0375 14-15 0.0625 16-17 0.05 18-19 0.1 20-21 0.075 22-23 0.05 24-25 0.05 26-27 0.0 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.025 38-39 0.0 40-41 0.0 42-43 0.025 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.0 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.425 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.6875 0.0 0.0 0.0 0.0 88-89 0.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610837 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610837_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.40975 33.0 31.0 33.0 18.0 34.0 2 30.7405 33.0 31.0 33.0 18.0 34.0 3 30.41175 33.0 29.0 33.0 18.0 34.0 4 30.175 33.0 31.0 33.0 15.0 34.0 5 30.51675 33.0 31.0 33.0 15.0 34.0 6 33.823 38.0 34.0 38.0 16.0 38.0 7 34.36325 38.0 34.0 38.0 26.0 38.0 8 34.2205 38.0 34.0 38.0 16.0 38.0 9 34.184 38.0 34.0 38.0 16.0 38.0 10-11 34.14825 38.0 34.0 38.0 16.0 38.0 12-13 33.97825 38.0 34.0 38.0 16.0 38.0 14-15 34.022125 38.0 34.0 38.0 16.0 38.0 16-17 34.274375000000006 38.0 34.0 38.0 21.0 38.0 18-19 34.096375 38.0 34.0 38.0 20.5 38.0 20-21 33.958625 38.0 33.5 38.0 16.0 38.0 22-23 34.185125 38.0 34.0 38.0 16.0 38.0 24-25 34.262125 38.0 34.0 38.0 20.0 38.0 26-27 34.12875 38.0 34.0 38.0 20.0 38.0 28-29 34.332125000000005 38.0 34.5 38.0 20.5 38.0 30-31 34.4235 38.0 35.0 38.0 24.5 38.0 32-33 34.27725 38.0 34.0 38.0 20.5 38.0 34-35 33.874375 38.0 33.5 38.0 16.0 38.0 36-37 34.10125 38.0 34.0 38.0 16.0 38.0 38-39 34.23275 38.0 34.0 38.0 24.5 38.0 40-41 34.34725 38.0 34.0 38.0 24.0 38.0 42-43 34.563 38.0 35.0 38.0 25.0 38.0 44-45 34.35625 38.0 34.5 38.0 20.5 38.0 46-47 34.535250000000005 38.0 35.0 38.0 25.0 38.0 48-49 34.327375 38.0 34.0 38.0 20.5 38.0 50-51 34.23524999999999 38.0 34.0 38.0 20.5 38.0 52-53 34.2375 38.0 34.5 38.0 20.5 38.0 54-55 34.18875 38.0 34.0 38.0 16.0 38.0 56-57 34.3365 38.0 34.5 38.0 20.5 38.0 58-59 34.353625 38.0 34.0 38.0 25.0 38.0 60-61 34.2175 38.0 34.0 38.0 20.0 38.0 62-63 34.192125000000004 38.0 34.0 38.0 16.0 38.0 64-65 34.183625 38.0 34.0 38.0 16.0 38.0 66-67 34.225125 38.0 34.0 38.0 20.5 38.0 68-69 34.272375 38.0 34.5 38.0 20.0 38.0 70-71 34.298625 38.0 34.0 38.0 24.0 38.0 72-73 34.317875 38.0 34.0 38.0 20.5 38.0 74-75 34.145624999999995 38.0 34.0 38.0 16.0 38.0 76-77 34.131625 38.0 34.0 38.0 20.0 38.0 78-79 34.2545 38.0 34.0 38.0 20.0 38.0 80-81 34.15875 38.0 34.0 38.0 16.0 38.0 82-83 34.238125 38.0 34.0 38.0 23.5 38.0 84-85 34.233000000000004 38.0 34.0 38.0 20.0 38.0 86-87 34.15025 38.0 34.0 38.0 19.5 38.0 88-89 34.187124999999995 38.0 34.0 38.0 23.0 38.0 90-91 34.162125 38.0 34.0 38.0 22.0 38.0 92-93 33.850375 38.0 34.0 38.0 15.0 38.0 94-95 33.935874999999996 38.0 34.0 38.0 18.0 38.0 96-97 25.584249999999997 21.5 19.5 36.0 14.5 38.0 98-99 21.646 20.5 19.0 22.5 14.0 30.5 100-101 28.841749999999998 31.0 24.0 36.5 15.0 37.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 5.0 17 5.0 18 12.0 19 39.0 20 52.0 21 46.0 22 36.0 23 68.0 24 66.0 25 78.0 26 71.0 27 85.0 28 97.0 29 108.0 30 156.0 31 148.0 32 180.0 33 191.0 34 290.0 35 450.0 36 1192.0 37 624.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.625 15.174999999999999 14.799999999999999 41.4 2 26.875 21.85 34.55 16.725 3 22.7 25.2 26.900000000000002 25.2 4 25.95 31.674999999999997 20.724999999999998 21.65 5 27.35 33.7 20.549999999999997 18.4 6 21.55 36.525 22.425 19.5 7 20.674999999999997 18.05 38.800000000000004 22.475 8 23.674999999999997 22.325 27.375 26.625 9 24.2 23.075000000000003 29.4 23.325000000000003 10-11 25.95 29.8375 21.825 22.3875 12-13 25.874999999999996 24.087500000000002 26.0125 24.025 14-15 24.5125 26.137500000000003 26.474999999999998 22.875 16-17 26.6 24.3625 25.7375 23.3 18-19 24.525 26.674999999999997 26.174999999999997 22.625 20-21 25.874999999999996 26.687499999999996 25.7125 21.725 22-23 25.9875 26.2875 25.2625 22.4625 24-25 25.55 26.150000000000002 26.087500000000002 22.2125 26-27 24.5125 26.575 25.8125 23.1 28-29 25.224999999999998 26.787499999999998 25.474999999999998 22.5125 30-31 24.275 27.250000000000004 26.275 22.2 32-33 25.112499999999997 26.400000000000002 25.900000000000002 22.5875 34-35 25.05 26.1 25.5 23.35 36-37 25.2625 26.6125 25.337500000000002 22.787499999999998 38-39 25.3 26.387500000000003 26.0375 22.275 40-41 25.124999999999996 27.287499999999998 25.55 22.037499999999998 42-43 25.2625 26.525 26.6625 21.55 44-45 24.575 27.287499999999998 25.162499999999998 22.975 46-47 26.0 26.2125 26.5125 21.275 48-49 24.7875 25.95 25.8125 23.45 50-51 25.0125 26.25 26.474999999999998 22.2625 52-53 25.624999999999996 26.1 25.912499999999998 22.3625 54-55 24.712500000000002 26.275 26.5 22.5125 56-57 24.95 26.637499999999996 26.625 21.7875 58-59 25.1875 26.35 25.5375 22.925 60-61 25.0375 26.2625 26.375 22.325 62-63 24.975 26.85 25.7125 22.4625 64-65 25.662499999999998 26.900000000000002 25.825 21.6125 66-67 24.875 26.125 26.2125 22.787499999999998 68-69 24.025 27.500000000000004 26.387500000000003 22.0875 70-71 26.05 25.924999999999997 25.2875 22.7375 72-73 24.3625 27.287499999999998 26.200000000000003 22.15 74-75 25.387500000000003 25.7625 26.7125 22.1375 76-77 24.3625 27.0125 26.0 22.625 78-79 25.275 27.400000000000002 25.825 21.5 80-81 25.6125 27.6 25.7875 21.0 82-83 25.374999999999996 26.55 26.0625 22.0125 84-85 24.25 26.8 26.85 22.1 86-87 25.15 25.374999999999996 26.974999999999998 22.5 88-89 25.6125 26.35 26.5375 21.5 90-91 24.075 26.924999999999997 27.3875 21.6125 92-93 25.1 26.0375 27.35 21.512500000000003 94-95 25.85 26.0375 26.400000000000002 21.712500000000002 96-97 25.387500000000003 26.3625 25.7 22.55 98-99 24.2875 28.1875 24.625 22.900000000000002 100-101 25.662499999999998 26.924999999999997 25.8125 21.6 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.5 29 2.5 30 2.5 31 2.0 32 5.5 33 14.0 34 23.5 35 32.5 36 42.0 37 55.0 38 86.0 39 115.0 40 123.5 41 161.5 42 200.0 43 203.5 44 219.5 45 237.0 46 249.0 47 227.5 48 204.5 49 222.5 50 204.5 51 183.0 52 170.0 53 149.5 54 128.5 55 116.0 56 121.5 57 100.0 58 75.5 59 73.0 60 56.0 61 45.0 62 39.5 63 27.0 64 24.5 65 19.0 66 12.5 67 7.5 68 4.0 69 2.0 70 2.0 71 1.0 72 1.0 73 1.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3963782696177 98.8 2 0.6036217303822937 1.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260799 spots for ERR10610837.sra Written 1260799 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra Read 1260780 spots for ERR10610837.sra Written 1260780 spots for ERR10610837.sra SRR ids: ['ERR10610837.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__t73tz1p ERR10610837.sra spots: 25215619 blocks: [[1, 1260780], [1260781, 2521560], [2521561, 3782340], [3782341, 5043120], [5043121, 6303900], [6303901, 7564680], [7564681, 8825460], [8825461, 10086240], [10086241, 11347020], [11347021, 12607800], [12607801, 13868580], [13868581, 15129360], [15129361, 16390140], [16390141, 17650920], [17650921, 18911700], [18911701, 20172480], [20172481, 21433260], [21433261, 22694040], [22694041, 23954820], [23954821, 25215619]] ERR10610837 file size 6085207 ERR10610837 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610837 ERR10610837_1.fastq ERR10610837_2.fastq Input file: ERR10610837_1.fastq Paired file: ERR10610837_2.fastq trimmed: ERR10610837-trimmed-pair1.fastq, ERR10610837-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:48:28 2024 >> started Fri Dec 6 20:50:23 2024 >> done (115.347s) 25215619 read pairs processed; of these: 75 ( 0.00%) short read pairs filtered out after trimming by size control 2156 ( 0.01%) empty read pairs filtered out after trimming by size control 25213388 (99.99%) read pairs available; of these: 755489 ( 3.00%) trimmed read pairs available after processing 24457899 (97.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 3 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 4 0.00% 28 7 0.00% 29 8 0.00% 30 6 0.00% 31 9 0.00% 32 13 0.00% 33 10 0.00% 34 20 0.00% 35 27 0.00% 36 22 0.00% 37 35 0.00% 38 34 0.00% 39 39 0.00% 40 67 0.00% 41 59 0.00% 42 54 0.00% 43 69 0.00% 44 86 0.00% 45 120 0.00% 46 114 0.00% 47 159 0.00% 48 194 0.00% 49 202 0.00% 50 228 0.00% 51 270 0.00% 52 266 0.00% 53 337 0.00% 54 362 0.00% 55 435 0.00% 56 448 0.00% 57 497 0.00% 58 579 0.00% 59 688 0.00% 60 810 0.00% 61 941 0.00% 62 964 0.00% 63 1144 0.00% 64 1299 0.01% 65 1471 0.01% 66 1710 0.01% 67 1931 0.01% 68 2244 0.01% 69 2456 0.01% 70 2736 0.01% 71 2985 0.01% 72 3657 0.01% 73 4193 0.02% 74 4757 0.02% 75 5287 0.02% 76 5961 0.02% 77 6726 0.03% 78 7402 0.03% 79 8421 0.03% 80 9631 0.04% 81 10598 0.04% 82 12025 0.05% 83 13593 0.05% 84 15248 0.06% 85 17110 0.07% 86 19149 0.08% 87 21065 0.08% 88 23456 0.09% 89 26345 0.10% 90 28106 0.11% 91 31587 0.13% 92 34512 0.14% 93 37673 0.15% 94 40888 0.16% 95 45872 0.18% 96 49091 0.19% 97 54899 0.22% 98 59367 0.24% 99 63690 0.25% 100 69006 0.27% 101 24457899 97.00% 25213388 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=28 prefix-density=0.11 prefix-fanout=2.7 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=85.27 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=9.4 sequence=CAACAACATTCAGACACATATATTAAAACGTACAGCCTTGATCGAGCGAGGCATGAGGAAGGACATGGATCGTGTCGGATGAACAATACGGTCGTGATCGAGTTGGTGACTTGACAGAAGATTTTATTTTATTTAGCAGCTAACTGGCTAGTAAGCTAGCTAGC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=5.22 fanout-score-rank=16 prefix-density=0.25 prefix-fanout=3.7 sequence=TGATGAACTTGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=164.94 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=23.3 sequence=CAAGAAGAAGGTG ERR10610837 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:51:31 Started mapping on | Dec 06 20:51:32 Finished on | Dec 06 21:05:22 Mapping speed, Million of reads per hour | 109.36 Number of input reads | 25213388 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 23431775 Uniquely mapped reads % | 92.93% Average mapped length | 200.35 Number of splices: Total | 14772412 Number of splices: Annotated (sjdb) | 13776138 Number of splices: GT/AG | 14578911 Number of splices: GC/AG | 178787 Number of splices: AT/AC | 5606 Number of splices: Non-canonical | 9108 Mismatch rate per base, % | 0.68% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 351714 % of reads mapped to multiple loci | 1.39% Number of reads mapped to too many loci | 23598 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.82% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1429899 1429899 1429899 N_multimapping 351714 351714 351714 N_noFeature 818952 22704211 961837 N_ambiguous 672063 2331 89675 UnstrandedReadsAssigned:21940760 PositiveStrandReadsAssigned:725233 NegativeStrandReadsAssigned:22380263 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610837 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610837-trimmed-pair1.fastq ERR10610837-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,213,388 reads, 22,884,173 reads pseudoaligned [quant] estimated average fragment length: 175.049 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 ERR10610837.ke.tsv 35125 ERR10610837.se.tsv 88098 total ==> ERR10610837.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 762.09 0 0 PNS24247 1044 869.951 82.8863 6.30506 PNS24249 1928 1753.95 17.2383 0.650398 PNS24246 1044 869.951 82.8863 6.30506 PNS24248 1044 869.951 82.8863 6.30506 PNS24244 1471 1296.95 152.103 7.76095 PNS24243 293 128.556 0 0 KQK14069 1603 1428.95 3820.14 176.914 KQK14071 474 301.505 78.9248 17.3229 ==> ERR10610837.se.tsv <== BRADI_1g14170v3 4317 BRADI_1g53295v3 526 BRADI_1g59795v3 587 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 519 BRADI_1g74790v3 182 BRADI_1g09890v3 0 BRADI_1g77505v3 645 BRADI_1g48960v3 0 ERR10610837 completed mapping pipeline successfully