Starting /dee2/code/volunteer_pipeline.sh ERR10610838 current disk space = 1549356916736 free memory = 1375258296 ERR10610838 SRAfilesize 27c27a66230548b0e086e3755386df35 ERR10610838.sra ERR10610838.sra file validated ERR10610838 is paired end ERR10610838 is conventional basespace ERR10610838 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610838_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.96775 32.0 18.0 33.0 18.0 33.0 2 29.67225 32.0 28.0 33.0 18.0 33.0 3 30.91925 33.0 32.0 33.0 25.0 33.0 4 30.5385 33.0 31.0 33.0 25.0 34.0 5 31.11025 33.0 32.0 33.0 27.0 34.0 6 33.6615 37.0 33.0 38.0 16.0 38.0 7 34.49175 38.0 34.0 38.0 26.0 38.0 8 34.57525 38.0 35.0 38.0 26.0 38.0 9 34.7205 38.0 35.0 38.0 26.0 38.0 10-11 34.785125 38.0 35.5 38.0 26.0 38.0 12-13 34.72125 38.0 35.0 38.0 26.0 38.0 14-15 34.6365 38.0 35.0 38.0 26.0 38.0 16-17 34.585499999999996 38.0 35.0 38.0 26.0 38.0 18-19 34.696 38.0 35.0 38.0 26.0 38.0 20-21 24.169 22.0 21.5 28.5 15.0 33.5 22-23 32.327125 35.5 30.5 37.0 20.0 37.5 24-25 34.351375 38.0 34.0 38.0 25.0 38.0 26-27 34.604875 38.0 35.0 38.0 25.0 38.0 28-29 34.576499999999996 38.0 35.0 38.0 25.0 38.0 30-31 34.740125 38.0 35.5 38.0 25.0 38.0 32-33 34.779625 38.0 35.5 38.0 25.0 38.0 34-35 34.782250000000005 38.0 35.5 38.0 26.0 38.0 36-37 34.63875 38.0 35.0 38.0 25.0 38.0 38-39 34.88475 38.0 35.5 38.0 26.0 38.0 40-41 34.821375 38.0 35.5 38.0 25.0 38.0 42-43 34.547125 38.0 35.0 38.0 24.5 38.0 44-45 34.6335 38.0 35.0 38.0 25.0 38.0 46-47 34.826750000000004 38.0 35.5 38.0 25.0 38.0 48-49 27.404249999999998 27.0 25.5 31.5 19.5 36.0 50-51 29.79375 31.5 27.5 33.5 16.0 37.5 52-53 33.7545 37.5 33.5 38.0 24.0 38.0 54-55 27.309375000000003 27.0 25.0 32.5 19.5 37.0 56-57 29.615375 31.0 27.5 33.0 16.0 37.5 58-59 33.729749999999996 37.0 33.5 38.0 24.0 38.0 60-61 34.4945 38.0 34.5 38.0 25.0 38.0 62-63 34.88725 38.0 35.5 38.0 26.0 38.0 64-65 34.738749999999996 38.0 35.0 38.0 25.0 38.0 66-67 34.77075 38.0 36.0 38.0 25.0 38.0 68-69 34.882999999999996 38.0 36.0 38.0 26.0 38.0 70-71 34.72025 38.0 35.5 38.0 25.0 38.0 72-73 24.242 22.0 21.0 27.5 15.0 37.0 74-75 31.879125 33.5 29.0 37.0 16.0 38.0 76-77 34.2845 37.5 34.0 38.0 24.5 38.0 78-79 34.637875 38.0 35.0 38.0 25.0 38.0 80-81 34.90675 38.0 35.5 38.0 27.0 38.0 82-83 34.863749999999996 38.0 35.0 38.0 27.0 38.0 84-85 34.88575 38.0 36.0 38.0 26.0 38.0 86-87 34.774125 38.0 36.0 38.0 25.0 38.0 88-89 34.64175 38.0 35.0 38.0 24.5 38.0 90-91 34.539125 38.0 35.0 38.0 24.0 38.0 92-93 34.539625 38.0 35.0 38.0 24.0 38.0 94-95 33.33262499999999 37.0 31.5 38.0 19.0 38.0 96-97 34.380125 38.0 34.5 38.0 23.0 38.0 98-99 25.804375 26.5 24.5 26.5 18.5 32.5 100-101 27.30825 27.5 25.0 32.0 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 5.0 19 26.0 20 34.0 21 40.0 22 57.0 23 57.0 24 69.0 25 77.0 26 72.0 27 96.0 28 106.0 29 100.0 30 134.0 31 192.0 32 237.0 33 299.0 34 470.0 35 1318.0 36 535.0 37 76.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.35015136226034 10.418768920282542 11.024217961654895 45.20686175580222 2 20.9 17.05 39.225 22.825 3 20.775 23.525 22.900000000000002 32.800000000000004 4 25.15 28.025 21.099999999999998 25.724999999999998 5 23.5 31.05 26.924999999999997 18.525 6 19.225 33.775 26.474999999999998 20.525 7 15.428857214303576 22.155538884721178 43.71092773193298 18.704676169042262 8 18.875 22.8 30.425 27.900000000000002 9 18.099999999999998 23.275000000000002 34.425 24.2 10-11 20.977622202775347 32.96662082760345 23.415426928366045 22.640330041255158 12-13 20.31503937992249 24.24053006625828 29.366170771346418 26.078259782472806 14-15 21.080270067516878 26.36909227306827 28.169542385596397 24.381095273818453 16-17 21.705426356589147 27.25681420355089 26.219054763690924 24.81870467616904 18-19 20.78019504876219 27.894473618404604 27.094273568392097 24.23105776444111 20-21 20.955238809702426 31.632908227056767 22.06801700425106 25.343835958989747 22-23 21.29282320580145 27.819454863715933 26.069017254313575 24.81870467616904 24-25 20.017504376094024 27.46936734183546 27.131782945736433 25.381345336334082 26-27 21.2 26.6 27.3375 24.8625 28-29 21.540192524065507 26.31578947368421 27.17839729966246 24.965620702587824 30-31 21.45 27.8875 26.474999999999998 24.1875 32-33 22.237499999999997 27.212500000000002 26.275 24.275 34-35 21.337500000000002 27.450000000000003 27.037499999999998 24.175 36-37 21.027628453556694 27.29091136392049 26.465808226028255 25.21565195649456 38-39 21.5625 26.974999999999998 26.637499999999996 24.825 40-41 21.6875 27.0 26.987499999999997 24.325 42-43 21.4 25.724999999999998 27.737499999999997 25.137500000000003 44-45 21.2625 26.887499999999996 27.5875 24.2625 46-47 20.775 27.05 26.637499999999996 25.5375 48-49 22.5 26.437500000000004 26.2125 24.85 50-51 20.9125 26.8375 27.3875 24.8625 52-53 20.7375 27.3375 26.700000000000003 25.224999999999998 54-55 20.8625 29.9875 24.7375 24.4125 56-57 20.6625 26.25 26.2625 26.825 58-59 22.7125 27.5125 25.912499999999998 23.8625 60-61 22.125 27.2625 26.150000000000002 24.462500000000002 62-63 20.875 26.987499999999997 27.625 24.5125 64-65 21.9375 26.575 26.787499999999998 24.7 66-67 21.575 27.1 26.775 24.55 68-69 21.825 27.0125 26.775 24.3875 70-71 20.95 27.275 26.75 25.025 72-73 23.674999999999997 30.4 22.7375 23.1875 74-75 22.0 26.4625 26.387500000000003 25.15 76-77 21.7 26.5875 26.775 24.9375 78-79 21.762500000000003 27.150000000000002 26.275 24.8125 80-81 21.8625 26.7625 26.525 24.85 82-83 22.1 26.400000000000002 25.937500000000004 25.5625 84-85 22.162499999999998 25.724999999999998 26.7625 25.35 86-87 22.4625 26.2125 26.55 24.775 88-89 22.340292536567073 27.25340667583448 26.328291036379547 24.0780097512189 90-91 22.1 27.037499999999998 26.0125 24.85 92-93 21.390173771721464 27.065883235404424 26.16577072134017 25.378172271533945 94-95 22.8875 25.837500000000002 26.75 24.525 96-97 23.5125 25.874999999999996 26.6125 24.0 98-99 23.599999999999998 28.275 23.775 24.349999999999998 100-101 23.025000000000002 27.0125 25.4875 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 2.0 28 2.0 29 4.0 30 6.5 31 8.5 32 12.5 33 19.5 34 30.0 35 43.5 36 61.0 37 71.5 38 94.5 39 130.5 40 160.0 41 175.5 42 195.5 43 209.0 44 224.5 45 231.5 46 248.0 47 269.0 48 237.0 49 217.0 50 200.5 51 182.0 52 164.5 53 142.5 54 118.5 55 102.0 56 89.0 57 76.0 58 71.0 59 55.5 60 43.0 61 30.5 62 21.5 63 17.5 64 9.5 65 8.0 66 7.5 67 3.5 68 2.5 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-11 0.0125 12-13 0.0125 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.025 24-25 0.025 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610838 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610838_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.31975 33.0 31.0 33.0 18.0 34.0 2 30.61075 33.0 31.0 33.0 18.0 34.0 3 30.2865 33.0 29.0 33.0 18.0 34.0 4 29.97525 33.0 31.0 33.0 15.0 34.0 5 30.378 33.0 31.0 33.0 15.0 34.0 6 33.606 38.0 33.0 38.0 16.0 38.0 7 33.96675 38.0 34.0 38.0 16.0 38.0 8 34.022 38.0 34.0 38.0 16.0 38.0 9 34.04825 38.0 34.0 38.0 16.0 38.0 10-11 33.931625 38.0 34.0 38.0 16.0 38.0 12-13 33.941875 38.0 34.0 38.0 16.0 38.0 14-15 33.84825 38.0 33.5 38.0 16.0 38.0 16-17 33.95025 38.0 34.0 38.0 16.0 38.0 18-19 33.852875 38.0 34.0 38.0 16.0 38.0 20-21 33.653875 38.0 33.5 38.0 16.0 38.0 22-23 34.051500000000004 38.0 34.0 38.0 16.0 38.0 24-25 33.96825 38.0 34.0 38.0 16.0 38.0 26-27 33.854 38.0 34.0 38.0 16.0 38.0 28-29 33.960625 38.0 34.0 38.0 16.0 38.0 30-31 34.252375 38.0 34.5 38.0 20.5 38.0 32-33 34.039 38.0 34.0 38.0 16.0 38.0 34-35 33.76775 38.0 33.5 38.0 16.0 38.0 36-37 34.042500000000004 38.0 34.0 38.0 16.0 38.0 38-39 34.05925 38.0 34.0 38.0 16.0 38.0 40-41 34.228125000000006 38.0 34.0 38.0 20.0 38.0 42-43 34.427125000000004 38.0 34.0 38.0 24.5 38.0 44-45 34.21825 38.0 34.0 38.0 16.0 38.0 46-47 34.1745 38.0 34.0 38.0 16.0 38.0 48-49 34.105999999999995 38.0 34.0 38.0 16.0 38.0 50-51 34.067625 38.0 34.0 38.0 16.0 38.0 52-53 34.139375 38.0 34.0 38.0 16.0 38.0 54-55 34.00575 38.0 34.0 38.0 16.0 38.0 56-57 34.10225 38.0 34.0 38.0 20.0 38.0 58-59 34.033249999999995 38.0 34.0 38.0 16.0 38.0 60-61 34.082125000000005 38.0 34.0 38.0 16.0 38.0 62-63 34.005375 38.0 34.0 38.0 16.0 38.0 64-65 33.944125 38.0 34.0 38.0 16.0 38.0 66-67 34.103750000000005 38.0 34.0 38.0 16.0 38.0 68-69 34.207875 38.0 34.0 38.0 20.0 38.0 70-71 33.959374999999994 38.0 34.0 38.0 16.0 38.0 72-73 34.12875 38.0 34.0 38.0 16.0 38.0 74-75 33.843 38.0 34.0 38.0 16.0 38.0 76-77 34.04325 38.0 34.0 38.0 16.0 38.0 78-79 34.060375 38.0 34.0 38.0 16.0 38.0 80-81 34.064625 38.0 34.0 38.0 16.0 38.0 82-83 33.982875 38.0 34.0 38.0 16.0 38.0 84-85 34.06337499999999 38.0 34.0 38.0 16.0 38.0 86-87 33.936625 38.0 34.0 38.0 16.0 38.0 88-89 33.929500000000004 38.0 34.0 38.0 16.0 38.0 90-91 33.912125 38.0 34.0 38.0 18.5 38.0 92-93 33.695750000000004 38.0 34.0 38.0 15.0 38.0 94-95 33.660375 38.0 34.0 38.0 15.0 38.0 96-97 25.862625 21.5 19.5 36.0 14.5 38.0 98-99 21.675874999999998 20.5 19.0 25.0 14.0 29.5 100-101 28.506375 30.5 23.5 35.5 15.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 2.0 17 6.0 18 18.0 19 38.0 20 48.0 21 57.0 22 60.0 23 54.0 24 77.0 25 79.0 26 73.0 27 97.0 28 109.0 29 130.0 30 140.0 31 152.0 32 180.0 33 205.0 34 257.0 35 402.0 36 1218.0 37 596.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.8 15.525 14.499999999999998 39.175 2 27.525 20.9 35.125 16.45 3 23.599999999999998 25.275 27.05 24.075 4 26.625 30.475 20.599999999999998 22.3 5 28.575 32.074999999999996 20.424999999999997 18.925 6 20.75 35.725 23.724999999999998 19.8 7 21.275 16.8 39.425 22.5 8 22.375 21.425 27.900000000000002 28.299999999999997 9 23.65 22.225 28.65 25.474999999999998 10-11 26.387500000000003 29.7 21.0625 22.85 12-13 25.7625 23.35 27.1375 23.75 14-15 25.2125 25.3125 26.6625 22.8125 16-17 25.937500000000004 25.45 25.7375 22.875 18-19 25.324999999999996 26.3625 25.7375 22.575 20-21 25.2625 26.737499999999997 25.05 22.95 22-23 24.9375 26.6625 26.55 21.85 24-25 24.962500000000002 25.5375 26.0625 23.4375 26-27 25.45 26.0625 25.575 22.912499999999998 28-29 25.7 26.7625 25.275 22.2625 30-31 24.725 26.7125 25.887500000000003 22.675 32-33 25.025 26.187500000000004 25.825 22.9625 34-35 25.2625 26.75 25.2875 22.7 36-37 24.7375 26.974999999999998 26.150000000000002 22.1375 38-39 24.887500000000003 26.8375 25.7125 22.5625 40-41 24.8 26.8625 25.2625 23.075000000000003 42-43 24.7 26.5125 26.5125 22.275 44-45 25.8625 26.700000000000003 25.5375 21.9 46-47 25.387500000000003 25.775 25.95 22.8875 48-49 24.462500000000002 25.8125 27.725 22.0 50-51 24.4 26.575 26.5125 22.5125 52-53 24.95 26.2875 25.75 23.0125 54-55 23.6625 27.1 26.3625 22.875 56-57 25.775 26.5875 26.0375 21.6 58-59 25.025 26.6625 26.224999999999998 22.0875 60-61 25.825 26.650000000000002 25.7 21.825 62-63 25.112499999999997 26.974999999999998 25.9875 21.925 64-65 24.6125 26.400000000000002 26.674999999999997 22.3125 66-67 24.825 26.375 26.4625 22.3375 68-69 25.8125 27.700000000000003 24.3125 22.175 70-71 24.875 27.287499999999998 26.075 21.762500000000003 72-73 24.325 26.400000000000002 27.200000000000003 22.075 74-75 24.3875 27.275 26.6 21.7375 76-77 24.725 27.187499999999996 26.7125 21.375 78-79 24.087500000000002 26.25 27.3625 22.3 80-81 23.525 27.8375 26.825 21.8125 82-83 24.8125 26.0 27.250000000000004 21.9375 84-85 24.587500000000002 26.137500000000003 27.037499999999998 22.237499999999997 86-87 23.974999999999998 27.6375 26.775 21.6125 88-89 25.1875 26.487500000000004 26.450000000000003 21.875 90-91 24.375 26.85 26.525 22.25 92-93 24.962500000000002 26.55 26.3125 22.175 94-95 25.224999999999998 26.775 27.037499999999998 20.962500000000002 96-97 25.4625 26.187500000000004 26.487500000000004 21.8625 98-99 23.724999999999998 28.712500000000002 25.387500000000003 22.175 100-101 25.912499999999998 26.087500000000002 26.6625 21.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.0 27 0.5 28 1.0 29 0.5 30 1.0 31 1.5 32 4.0 33 11.0 34 18.5 35 28.0 36 40.5 37 60.0 38 77.0 39 95.5 40 126.0 41 157.0 42 196.0 43 226.0 44 233.5 45 244.0 46 257.5 47 250.5 48 233.5 49 232.0 50 215.0 51 195.0 52 171.5 53 145.5 54 131.0 55 107.0 56 98.0 57 90.5 58 75.0 59 63.5 60 53.0 61 41.0 62 32.5 63 27.5 64 21.0 65 12.5 66 6.5 67 7.0 68 6.0 69 2.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.375 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327250 spots for ERR10610838.sra Written 1327250 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra Read 1327239 spots for ERR10610838.sra Written 1327239 spots for ERR10610838.sra SRR ids: ['ERR10610838.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n5n5mika ERR10610838.sra spots: 26544791 blocks: [[1, 1327239], [1327240, 2654478], [2654479, 3981717], [3981718, 5308956], [5308957, 6636195], [6636196, 7963434], [7963435, 9290673], [9290674, 10617912], [10617913, 11945151], [11945152, 13272390], [13272391, 14599629], [14599630, 15926868], [15926869, 17254107], [17254108, 18581346], [18581347, 19908585], [19908586, 21235824], [21235825, 22563063], [22563064, 23890302], [23890303, 25217541], [25217542, 26544791]] ERR10610838 file size 6407116 ERR10610838 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610838 ERR10610838_1.fastq ERR10610838_2.fastq Input file: ERR10610838_1.fastq Paired file: ERR10610838_2.fastq trimmed: ERR10610838-trimmed-pair1.fastq, ERR10610838-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:46:58 2024 >> started Fri Dec 6 20:47:22 2024 >> done (24.479s) 26544791 read pairs processed; of these: 130 ( 0.00%) short read pairs filtered out after trimming by size control 7308 ( 0.03%) empty read pairs filtered out after trimming by size control 26537353 (99.97%) read pairs available; of these: 868532 ( 3.27%) trimmed read pairs available after processing 25668821 (96.73%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 4 0.00% 26 5 0.00% 27 2 0.00% 28 8 0.00% 29 2 0.00% 30 9 0.00% 31 4 0.00% 32 19 0.00% 33 23 0.00% 34 22 0.00% 35 30 0.00% 36 45 0.00% 37 45 0.00% 38 47 0.00% 39 46 0.00% 40 63 0.00% 41 83 0.00% 42 89 0.00% 43 105 0.00% 44 115 0.00% 45 120 0.00% 46 141 0.00% 47 158 0.00% 48 202 0.00% 49 299 0.00% 50 287 0.00% 51 320 0.00% 52 388 0.00% 53 416 0.00% 54 487 0.00% 55 565 0.00% 56 538 0.00% 57 588 0.00% 58 745 0.00% 59 842 0.00% 60 952 0.00% 61 1127 0.00% 62 1288 0.00% 63 1445 0.01% 64 1625 0.01% 65 1834 0.01% 66 2032 0.01% 67 2286 0.01% 68 2666 0.01% 69 2860 0.01% 70 3246 0.01% 71 3630 0.01% 72 4147 0.02% 73 4758 0.02% 74 5529 0.02% 75 6197 0.02% 76 7108 0.03% 77 7915 0.03% 78 8637 0.03% 79 9958 0.04% 80 11169 0.04% 81 12329 0.05% 82 14125 0.05% 83 15909 0.06% 84 17587 0.07% 85 19683 0.07% 86 22047 0.08% 87 24401 0.09% 88 27339 0.10% 89 29904 0.11% 90 32836 0.12% 91 36557 0.14% 92 39169 0.15% 93 43665 0.16% 94 47591 0.18% 95 51629 0.19% 96 56497 0.21% 97 62513 0.24% 98 67157 0.25% 99 72504 0.27% 100 77812 0.29% 101 25668821 96.73% 26537353 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.83 fanout-score-rank=19 prefix-density=0.14 prefix-fanout=3.2 sequence=ACAAGTTCATCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=75.86 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=9.2 sequence=TTTCTTCTCCGGCGCCATGCCGAGAACCAGCACCTGGGCCTGGGTGCTGCTGGTGGTGCTGGCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.1 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=37.15 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.7 sequence=AAGAAGGAGTACCCGGACGCCTA ERR10610838 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:48:45 Started mapping on | Dec 06 20:48:45 Finished on | Dec 06 20:51:19 Mapping speed, Million of reads per hour | 620.35 Number of input reads | 26537353 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 23309114 Uniquely mapped reads % | 87.84% Average mapped length | 192.38 Number of splices: Total | 15433058 Number of splices: Annotated (sjdb) | 14568065 Number of splices: GT/AG | 15211127 Number of splices: GC/AG | 196631 Number of splices: AT/AC | 8173 Number of splices: Non-canonical | 17127 Mismatch rate per base, % | 0.67% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 468142 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 51262 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.29% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2760097 2760097 2760097 N_multimapping 468142 468142 468142 N_noFeature 764995 22665195 873479 N_ambiguous 622078 2068 89800 UnstrandedReadsAssigned:21922041 PositiveStrandReadsAssigned:641851 NegativeStrandReadsAssigned:22345835 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610838 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610838-trimmed-pair1.fastq ERR10610838-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,537,353 reads, 24,031,211 reads pseudoaligned [quant] estimated average fragment length: 163.749 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,246 rounds 52973 ERR10610838.ke.tsv 35125 ERR10610838.se.tsv 88098 total ==> ERR10610838.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 773.354 24.5016 2.02313 PNS24247 1044 881.251 69.7568 5.05469 PNS24249 1928 1765.25 38.8785 1.40641 PNS24246 1044 881.251 69.7568 5.05469 PNS24248 1044 881.251 69.7568 5.05469 PNS24244 1471 1308.25 89.3496 4.36123 PNS24243 293 137.475 0 0 KQK14069 1603 1440.25 1141.92 50.6296 KQK14071 474 312.373 22.2187 4.54206 ==> ERR10610838.se.tsv <== BRADI_1g14170v3 1126 BRADI_1g53295v3 220 BRADI_1g59795v3 492 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 852 BRADI_1g74790v3 237 BRADI_1g09890v3 0 BRADI_1g77505v3 664 BRADI_1g48960v3 0 ERR10610838 completed mapping pipeline successfully