Starting /dee2/code/volunteer_pipeline.sh ERR10610839 current disk space = 1549375623168 free memory = 1399192404 ERR10610839 SRAfilesize b44374f1a19a9e8c819df0e226d85402 ERR10610839.sra ERR10610839.sra file validated ERR10610839 is paired end ERR10610839 is conventional basespace ERR10610839 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610839_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.41525 32.0 30.0 33.0 18.0 34.0 2 32.46675 33.0 33.0 33.0 32.0 34.0 3 32.60675 33.0 33.0 34.0 31.0 34.0 4 32.89825 34.0 33.0 34.0 32.0 34.0 5 33.10325 34.0 33.0 34.0 32.0 34.0 6 36.70275 38.0 37.0 38.0 35.0 38.0 7 37.01425 38.0 38.0 38.0 36.0 38.0 8 37.12425 38.0 38.0 38.0 36.0 38.0 9 37.15775 38.0 38.0 38.0 37.0 38.0 10-11 37.209875 38.0 38.0 38.0 37.0 38.0 12-13 37.174125000000004 38.0 38.0 38.0 37.0 38.0 14-15 37.195875 38.0 38.0 38.0 37.0 38.0 16-17 37.212125 38.0 38.0 38.0 37.0 38.0 18-19 37.193625 38.0 38.0 38.0 37.0 38.0 20-21 37.152 38.0 38.0 38.0 37.0 38.0 22-23 37.16425 38.0 38.0 38.0 37.0 38.0 24-25 37.10525 38.0 38.0 38.0 37.0 38.0 26-27 37.144875 38.0 38.0 38.0 37.0 38.0 28-29 37.122875 38.0 38.0 38.0 37.0 38.0 30-31 37.105000000000004 38.0 38.0 38.0 37.0 38.0 32-33 37.20075 38.0 38.0 38.0 37.0 38.0 34-35 37.143625 38.0 38.0 38.0 37.0 38.0 36-37 37.125 38.0 38.0 38.0 37.0 38.0 38-39 37.164125 38.0 38.0 38.0 37.0 38.0 40-41 37.159875 38.0 38.0 38.0 37.0 38.0 42-43 37.117999999999995 38.0 38.0 38.0 37.0 38.0 44-45 37.11225 38.0 38.0 38.0 37.0 38.0 46-47 37.12075 38.0 38.0 38.0 37.0 38.0 48-49 36.943625 38.0 38.0 38.0 37.0 38.0 50-51 36.78 38.0 38.0 38.0 36.0 38.0 52-53 36.538875000000004 38.0 38.0 38.0 36.0 38.0 54-55 36.613 38.0 38.0 38.0 35.5 38.0 56-57 36.797 38.0 38.0 38.0 36.0 38.0 58-59 36.917625 38.0 38.0 38.0 35.5 38.0 60-61 37.054375 38.0 38.0 38.0 36.0 38.0 62-63 37.01049999999999 38.0 38.0 38.0 36.0 38.0 64-65 36.832625 38.0 38.0 38.0 36.0 38.0 66-67 36.941500000000005 38.0 38.0 38.0 36.0 38.0 68-69 36.866875 38.0 38.0 38.0 36.0 38.0 70-71 36.994749999999996 38.0 38.0 38.0 36.0 38.0 72-73 36.97225 38.0 38.0 38.0 36.0 38.0 74-75 36.986125 38.0 38.0 38.0 36.0 38.0 76-77 36.9525 38.0 38.0 38.0 36.0 38.0 78-79 36.915375 38.0 38.0 38.0 36.0 38.0 80-81 36.916 38.0 38.0 38.0 36.0 38.0 82-83 36.956 38.0 38.0 38.0 36.0 38.0 84-85 37.0055 38.0 38.0 38.0 36.0 38.0 86-87 37.038250000000005 38.0 38.0 38.0 36.0 38.0 88-89 36.87475 38.0 38.0 38.0 36.0 38.0 90-91 36.509874999999994 38.0 38.0 38.0 35.0 38.0 92-93 36.529375 38.0 38.0 38.0 35.0 38.0 94-95 36.5045 38.0 38.0 38.0 35.0 38.0 96-97 36.336 38.0 38.0 38.0 34.5 38.0 98-99 36.185625 38.0 38.0 38.0 34.5 38.0 100-101 35.986625000000004 38.0 37.5 38.0 32.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 6.0 20 6.0 21 6.0 22 8.0 23 8.0 24 14.0 25 9.0 26 15.0 27 23.0 28 34.0 29 22.0 30 40.0 31 41.0 32 70.0 33 57.0 34 80.0 35 125.0 36 298.0 37 3136.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.05 10.75 11.075 47.125 2 21.575 17.875 36.55 24.0 3 22.6 22.475 22.45 32.475 4 25.25 29.825000000000003 20.150000000000002 24.775 5 23.625 31.924999999999997 23.474999999999998 20.974999999999998 6 19.55 33.25 25.775 21.425 7 15.375 21.775 41.75 21.099999999999998 8 20.75 22.8 28.999999999999996 27.450000000000003 9 19.02975743935984 21.580395098774694 32.733183295823956 26.65666416604151 10-11 22.25 30.55 23.0625 24.1375 12-13 21.85 24.025 27.400000000000002 26.724999999999998 14-15 21.0625 25.887500000000003 27.237499999999997 25.8125 16-17 22.3625 25.2875 26.650000000000002 25.7 18-19 22.66816704176044 26.431607901975497 25.593898474618655 25.30632658164541 20-21 21.767941985496375 26.469117279319832 27.74443610902726 24.01850462615654 22-23 21.975 26.5875 25.8625 25.575 24-25 21.640205025628205 27.403425428178522 25.62820352544068 25.328166020752597 26-27 21.462500000000002 25.7625 26.2875 26.487500000000004 28-29 22.175 26.25 26.0625 25.5125 30-31 22.075 26.7125 25.8125 25.4 32-33 22.650000000000002 26.150000000000002 25.887500000000003 25.3125 34-35 21.4875 26.387500000000003 26.35 25.775 36-37 22.0 26.25 26.650000000000002 25.1 38-39 21.9375 26.1625 26.4125 25.4875 40-41 22.575 26.450000000000003 25.2625 25.7125 42-43 22.518129532383096 26.544136034008503 26.281570392598148 24.656164041010253 44-45 21.94298574643661 26.569142285571395 25.36884221055264 26.11902975743936 46-47 22.3875 26.474999999999998 26.1125 25.025 48-49 21.803093172387776 26.95838048535144 25.26090783352194 25.977618508738843 50-51 21.82414532610067 27.24864387536268 25.268071149236786 25.65913964929986 52-53 22.782564622402433 26.013684744044603 25.874303091738472 25.3294475418145 54-55 21.88131313131313 26.57828282828283 26.666666666666668 24.873737373737374 56-57 21.64328657314629 26.064629258517037 26.452905811623246 25.839178356713425 58-59 21.975 27.537499999999998 25.2625 25.224999999999998 60-61 21.925 26.687499999999996 25.95 25.4375 62-63 22.525000000000002 25.45 26.05 25.974999999999998 64-65 23.19788652660712 26.456158007296516 25.764247075103786 24.581708390992578 66-67 22.134634634634633 26.2012012012012 26.726726726726728 24.93743743743744 68-69 23.091387739751788 25.911996991350133 25.51084367556726 25.485771593330824 70-71 22.1875 26.650000000000002 25.5 25.662499999999998 72-73 23.6625 25.7125 25.474999999999998 25.15 74-75 21.790223777972244 25.928241030128767 26.59082385298162 25.690711338917367 76-77 23.3375 25.937500000000004 25.0125 25.7125 78-79 21.85 26.437500000000004 25.362499999999997 26.35 80-81 23.225 26.5875 24.275 25.912499999999998 82-83 22.675 26.1625 25.2875 25.874999999999996 84-85 23.575 25.55 25.275 25.6 86-87 22.9375 25.687500000000004 24.875 26.5 88-89 22.887191686490546 25.841993239013394 25.190935269813448 26.07987980468261 90-91 23.21586459517494 25.881015536187952 24.93368700265252 25.969432865984587 92-93 22.35977766548762 26.440121273370387 25.909550277918143 25.290550783223853 94-95 23.891345546430827 25.7991156032849 24.939987365761212 25.369551484523058 96-97 23.085699797160245 26.179006085192697 25.291582150101423 25.44371196754564 98-99 23.371989295272076 25.831527972473555 26.022683828214603 24.773798904039758 100-101 22.68354430379747 25.455696202531648 26.0 25.860759493670887 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 4.0 29 3.5 30 3.0 31 12.5 32 16.5 33 15.0 34 22.5 35 32.0 36 51.5 37 70.5 38 93.0 39 118.5 40 147.5 41 171.5 42 177.5 43 175.0 44 185.5 45 217.0 46 219.5 47 218.0 48 220.0 49 199.0 50 179.0 51 156.5 52 145.0 53 131.0 54 116.0 55 127.5 56 120.0 57 96.5 58 89.0 59 77.0 60 67.0 61 64.5 62 60.5 63 56.5 64 38.0 65 26.0 66 25.0 67 20.0 68 14.5 69 8.0 70 4.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.025 20-21 0.025 22-23 0.0 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.025 44-45 0.025 46-47 0.0 48-49 0.5875 50-51 0.9125 52-53 1.35 54-55 1.0 56-57 0.2 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.6375 66-67 0.1 68-69 0.2875 70-71 0.0 72-73 0.0 74-75 0.0125 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.1625 90-91 1.0375 92-93 1.05 94-95 1.0625 96-97 1.4000000000000001 98-99 1.9124999999999999 100-101 1.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73289406994424 97.39999999999999 2 1.1657374556512925 2.3 3 0.10136847440446022 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.07500000000000001 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCACAA 15 0.009292021 48.326923 90-91 >>END_MODULE ERR10610839 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610839_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63275 33.0 33.0 34.0 32.0 34.0 2 32.6095 33.0 33.0 34.0 31.0 34.0 3 32.7265 34.0 33.0 34.0 32.0 34.0 4 32.72675 34.0 33.0 34.0 32.0 34.0 5 32.69475 34.0 33.0 34.0 32.0 34.0 6 36.30575 38.0 38.0 38.0 35.0 38.0 7 35.77075 38.0 38.0 38.0 34.0 38.0 8 2.0 2.0 2.0 2.0 2.0 2.0 9 28.5275 30.0 30.0 31.0 26.0 31.0 10-11 23.104875 22.5 22.5 23.0 20.5 29.5 12-13 30.862375 32.5 31.5 34.0 27.0 34.0 14-15 34.47675 38.0 36.5 38.0 27.5 38.0 16-17 34.494 38.0 38.0 38.0 27.0 38.0 18-19 34.73625 38.0 38.0 38.0 28.0 38.0 20-21 34.533125 38.0 38.0 38.0 26.5 38.0 22-23 34.805125000000004 38.0 38.0 38.0 28.5 38.0 24-25 34.646125 38.0 38.0 38.0 27.5 38.0 26-27 34.670625 38.0 38.0 38.0 27.0 38.0 28-29 34.584 38.0 38.0 38.0 27.0 38.0 30-31 34.356375 38.0 38.0 38.0 20.5 38.0 32-33 34.355000000000004 38.0 38.0 38.0 25.5 38.0 34-35 34.750125 38.0 38.0 38.0 27.5 38.0 36-37 35.0975 38.0 38.0 38.0 28.0 38.0 38-39 35.1755 38.0 38.0 38.0 30.0 38.0 40-41 35.002875 38.0 38.0 38.0 30.0 38.0 42-43 34.829750000000004 38.0 38.0 38.0 28.5 38.0 44-45 35.015125 38.0 38.0 38.0 29.0 38.0 46-47 35.098875 38.0 38.0 38.0 29.0 38.0 48-49 35.154250000000005 38.0 38.0 38.0 29.0 38.0 50-51 35.604 38.0 38.0 38.0 29.0 38.0 52-53 36.035250000000005 38.0 38.0 38.0 32.0 38.0 54-55 36.36525 38.0 38.0 38.0 34.0 38.0 56-57 36.43375 38.0 38.0 38.0 34.5 38.0 58-59 36.517624999999995 38.0 38.0 38.0 35.0 38.0 60-61 36.4335 38.0 38.0 38.0 34.5 38.0 62-63 36.513875 38.0 38.0 38.0 35.0 38.0 64-65 36.501000000000005 38.0 38.0 38.0 34.5 38.0 66-67 36.441500000000005 38.0 38.0 38.0 34.5 38.0 68-69 36.1345 38.0 38.0 38.0 34.0 38.0 70-71 36.062375 38.0 38.0 38.0 34.0 38.0 72-73 35.92 38.0 38.0 38.0 33.5 38.0 74-75 35.58175 38.0 38.0 38.0 32.5 38.0 76-77 35.5745 38.0 38.0 38.0 33.0 38.0 78-79 35.375125 38.0 38.0 38.0 31.0 38.0 80-81 35.389125 38.0 38.0 38.0 31.0 38.0 82-83 35.526375 38.0 38.0 38.0 32.0 38.0 84-85 35.44725 38.0 38.0 38.0 31.5 38.0 86-87 35.417625 38.0 38.0 38.0 31.5 38.0 88-89 35.254374999999996 38.0 38.0 38.0 30.0 38.0 90-91 35.03375 38.0 38.0 38.0 29.0 38.0 92-93 35.047625 38.0 38.0 38.0 28.5 38.0 94-95 34.9775 38.0 38.0 38.0 28.0 38.0 96-97 34.825500000000005 38.0 38.0 38.0 27.5 38.0 98-99 34.74125 38.0 38.0 38.0 27.0 38.0 100-101 34.173375 38.0 36.5 38.0 22.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 0.0 4 0.0 5 2.0 6 11.0 7 4.0 8 23.0 9 20.0 10 5.0 11 17.0 12 15.0 13 7.0 14 4.0 15 7.0 16 13.0 17 6.0 18 24.0 19 28.0 20 21.0 21 21.0 22 20.0 23 16.0 24 18.0 25 22.0 26 23.0 27 23.0 28 45.0 29 46.0 30 51.0 31 58.0 32 71.0 33 86.0 34 128.0 35 265.0 36 2558.0 37 329.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.82046138415246 15.59679037111334 15.195586760280843 37.387161484453365 2 29.395535490343615 23.200401304238778 29.621269124655132 17.78279408076248 3 23.85252069224981 25.106596438424884 25.08151492350138 25.95936794582393 4 26.661650363681964 31.326812139453224 19.63882618510158 22.37271131176323 5 28.06621519939804 32.35515425131678 20.065211938801102 19.513418610484074 6 23.755081300813007 34.171747967479675 21.59552845528455 20.477642276422763 7 22.35415591120289 16.778523489932887 36.628807434176565 24.23851316468766 8 NaN NaN NaN NaN 9 24.488209380668565 22.67426794506349 28.116092251878726 24.721430422389222 10-11 23.466394592526463 28.97589593164137 20.29077923734218 27.26693023848999 12-13 26.527991782229073 22.650231124807398 24.961479198767332 25.8602978941962 14-15 25.306768702995118 26.006069402295818 25.06927035228922 23.617891542419844 16-17 27.19239523363235 25.733029856741197 24.019279689382785 23.055295220243675 18-19 25.88906581740977 24.800955414012737 24.814225053078555 24.49575371549894 20-21 26.34674508755514 25.09022857906697 24.70257986900147 23.86044646437642 22-23 26.355561447699856 26.43510539573114 24.56582261699589 22.643510539573114 24-25 25.446785809549212 26.83382235262737 24.099759935982927 23.619631901840492 26-27 26.728847435043306 24.823451032644904 25.076615589606927 23.371085942704863 28-29 25.377926421404684 26.046822742474916 24.588628762541806 23.986622073578594 30-31 25.562289562289564 25.818181818181817 25.441077441077443 23.17845117845118 32-33 26.30586968228325 25.1884760366182 25.296176628971462 23.209477652127084 34-35 25.60360838418679 25.497479437516585 24.834173520827807 24.064738657468823 36-37 24.931327665140614 25.807717462393718 25.166775670372793 24.09417920209287 38-39 26.094364351245087 25.321100917431195 25.740498034076015 22.84403669724771 40-41 26.27208014764039 24.597943580279463 25.046137621935145 24.083838650145005 42-43 26.076016421666004 25.797907561912332 25.109257052046086 23.01681896437558 44-45 25.483998419596997 27.222441722639275 23.75872514157777 23.53483471618596 46-47 25.744652932686 26.54507282508857 24.366880986747148 23.343393255478283 48-49 25.02289077828646 25.624591236102027 25.886200130804447 23.466317854807066 50-51 26.5596919127086 26.264441591784337 24.58279845956354 22.593068035943517 52-53 26.072062928190814 26.439989850291806 24.99365643237757 22.49429078913981 54-55 26.186579378068743 26.75311595115196 24.77653279617273 22.283771874606572 56-57 25.308486527323094 25.673633845378994 26.416519768320324 22.601359858977588 58-59 25.283303953664067 25.77436414001511 25.673633845378994 23.26869806094183 60-61 25.295895240493575 25.48476454293629 26.240241752707128 22.979098463863007 62-63 26.026189876605386 25.698816419038025 25.371442961470663 22.903550742885923 64-65 26.029467321496035 26.042060193930233 25.19833774083868 22.730134743735046 66-67 25.10713385429796 26.153264431560373 26.266700277287626 22.472901436854045 68-69 25.81915163830328 26.56845313690627 25.146050292100586 22.466344932689868 70-71 26.044852191641183 25.089194699286445 25.535168195718654 23.33078491335372 72-73 25.53001277139208 25.402298850574713 25.810983397190295 23.256704980842912 74-75 25.186615186615185 26.486486486486488 26.08751608751609 22.239382239382238 76-77 26.297488731487444 25.51191242755956 25.885383129426913 22.305215711526078 78-79 26.146670121793207 26.63902565431459 25.33039647577093 21.883907748121274 80-81 24.66390899689762 26.331437435367118 25.34901758014478 23.655635987590486 82-83 25.42721315688038 26.172427084671718 25.774123088783245 22.626236669664653 84-85 25.544528934141 25.157881170253898 26.485371826266274 22.812218069338833 86-87 25.674803047914246 27.069611261784836 25.274441430969908 21.98114425933101 88-89 26.819774231218375 26.6510964058648 25.314649020371093 21.214480342545738 90-91 25.480203841630733 25.76767280804913 25.93754083366 22.814582516660135 92-93 26.16846764744174 26.45488868636896 25.165994011196457 22.21064965499284 94-95 26.18300653594771 26.483660130718956 26.11764705882353 21.215686274509803 96-97 26.3848779207141 26.55552638487792 24.940929377789445 22.118666316618533 98-99 26.63336400683581 26.37044827132904 24.911265939266467 22.084921782568685 100-101 26.29985520600237 25.575885217849155 25.78649466894827 22.33776490720021 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 7.0 1 6.5 2 3.0 3 0.0 4 0.0 5 1.0 6 4.5 7 7.0 8 8.0 9 11.5 10 9.0 11 7.0 12 9.5 13 7.0 14 9.0 15 9.5 16 7.0 17 5.5 18 4.5 19 5.5 20 6.5 21 8.0 22 7.0 23 8.0 24 7.5 25 6.0 26 6.5 27 5.0 28 5.0 29 5.5 30 8.0 31 13.0 32 16.5 33 17.0 34 20.0 35 35.5 36 51.0 37 56.5 38 62.0 39 94.0 40 138.0 41 153.5 42 163.0 43 183.0 44 186.0 45 180.5 46 187.5 47 192.0 48 184.0 49 181.0 50 176.5 51 174.5 52 166.5 53 150.5 54 132.5 55 120.5 56 117.5 57 98.5 58 95.5 59 99.5 60 85.5 61 61.5 62 44.0 63 47.5 64 44.5 65 26.5 66 18.5 67 17.5 68 10.0 69 3.5 70 2.0 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 0.3 2 0.325 3 0.325 4 0.325 5 0.325 6 1.6 7 3.15 8 100.0 9 3.5249999999999995 10-11 1.9875 12-13 2.65 14-15 5.2625 16-17 6.6375 18-19 5.800000000000001 20-21 6.4875 22-23 5.7125 24-25 6.275 26-27 6.1875 28-29 6.5625 30-31 7.187499999999999 32-33 7.1499999999999995 34-35 5.775 36-37 4.4375 38-39 4.625 40-41 5.175 42-43 5.6125 44-45 5.0874999999999995 46-47 4.7375 48-49 4.4375 50-51 2.625 52-53 1.4749999999999999 54-55 0.7125 56-57 0.7250000000000001 58-59 0.7250000000000001 60-61 0.7250000000000001 62-63 0.7250000000000001 64-65 0.7374999999999999 66-67 0.8250000000000001 68-69 1.575 70-71 1.9 72-73 2.125 74-75 2.875 76-77 2.9375 78-79 3.5249999999999995 80-81 3.3000000000000003 82-83 2.7125 84-85 3.0124999999999997 86-87 3.2125 88-89 3.6624999999999996 90-91 4.3374999999999995 92-93 3.9875000000000003 94-95 4.375 96-97 4.775 98-99 4.9125000000000005 100-101 5.0375000000000005 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.40221216691804923 0.8 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.025138260432378077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.36250000000000004 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795191 spots for ERR10610839.sra Written 1795191 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra Read 1795183 spots for ERR10610839.sra Written 1795183 spots for ERR10610839.sra SRR ids: ['ERR10610839.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jc1zw4vf ERR10610839.sra spots: 35903668 blocks: [[1, 1795183], [1795184, 3590366], [3590367, 5385549], [5385550, 7180732], [7180733, 8975915], [8975916, 10771098], [10771099, 12566281], [12566282, 14361464], [14361465, 16156647], [16156648, 17951830], [17951831, 19747013], [19747014, 21542196], [21542197, 23337379], [23337380, 25132562], [25132563, 26927745], [26927746, 28722928], [28722929, 30518111], [30518112, 32313294], [32313295, 34108477], [34108478, 35903668]] ERR10610839 file size 8673719 ERR10610839 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610839 ERR10610839_1.fastq ERR10610839_2.fastq Input file: ERR10610839_1.fastq Paired file: ERR10610839_2.fastq trimmed: ERR10610839-trimmed-pair1.fastq, ERR10610839-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:48:53 2024 >> started Fri Dec 6 20:49:57 2024 >> done (63.563s) 35903668 read pairs processed; of these: 142338 ( 0.40%) short read pairs filtered out after trimming by size control 13239 ( 0.04%) empty read pairs filtered out after trimming by size control 35748091 (99.57%) read pairs available; of these: 1576600 ( 4.41%) trimmed read pairs available after processing 34171491 (95.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 4 0.00% 20 6 0.00% 21 10 0.00% 22 6 0.00% 23 6 0.00% 24 4 0.00% 25 6 0.00% 26 10 0.00% 27 13 0.00% 28 22 0.00% 29 25 0.00% 30 30 0.00% 31 31 0.00% 32 32 0.00% 33 50 0.00% 34 39 0.00% 35 59 0.00% 36 60 0.00% 37 90 0.00% 38 102 0.00% 39 128 0.00% 40 167 0.00% 41 162 0.00% 42 190 0.00% 43 239 0.00% 44 225 0.00% 45 292 0.00% 46 351 0.00% 47 411 0.00% 48 497 0.00% 49 580 0.00% 50 637 0.00% 51 702 0.00% 52 905 0.00% 53 1001 0.00% 54 1145 0.00% 55 1250 0.00% 56 1320 0.00% 57 1575 0.00% 58 2050 0.01% 59 5942 0.02% 60 71884 0.20% 61 2415 0.01% 62 2455 0.01% 63 3180 0.01% 64 3765 0.01% 65 5234 0.01% 66 4978 0.01% 67 8670 0.02% 68 7321 0.02% 69 5535 0.02% 70 6208 0.02% 71 7453 0.02% 72 8125 0.02% 73 9780 0.03% 74 10572 0.03% 75 12027 0.03% 76 13089 0.04% 77 14684 0.04% 78 16303 0.05% 79 18924 0.05% 80 21377 0.06% 81 22983 0.06% 82 26292 0.07% 83 30326 0.08% 84 33634 0.09% 85 36645 0.10% 86 39408 0.11% 87 42627 0.12% 88 47037 0.13% 89 51821 0.14% 90 56102 0.16% 91 62708 0.18% 92 67724 0.19% 93 74251 0.21% 94 79853 0.22% 95 87049 0.24% 96 92775 0.26% 97 101166 0.28% 98 108188 0.30% 99 117275 0.33% 100 124375 0.35% 101 34171491 95.59% 35748091 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=2 fanout-score=2.00 fanout-score-rank=24 prefix-density=0.23 prefix-fanout=2.0 sequence=TTCGCTATCGGTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=40.85 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=2.4 sequence=CCGCACTTGCACTTGCCGTCGTTCTCCGCCGCGGACTCCTGCACCTCGAAGTGGCTCTTCTCGGTGTCAACCATGACGATGCCGTAGCCGTTTCCCTTCTTCACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGCCGCAGCCGCTCGACATGGTGGCCTTAACTTGCTGGGGAGATCGAGTACACGAATCAGCTGTGTTTTGCCTGTG criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=20 prefix-density=0.23 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=30 fanout-score=14.34 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=2.7 sequence=GCACCAGCTGCGGCTGCTCATGCTGCAGCTGCTAGATCTCAATCTGCTGCAGCAGCTTAATTTGCATGCCAGGGACGCATGCAACGACCATCTACATATAGCTACTCGATCTACCGCTACCATGAACCGATCCAAGGCTAGCTGCACAAGCTAGGCCCTTATTTCCCTTTGTACGGGTGCATGCATGCCATCCCATGCCATGCTTGTAACCCCCCATAAATAAAATCGCC ERR10610839 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:50:52 Started mapping on | Dec 06 20:50:52 Finished on | Dec 06 20:52:42 Mapping speed, Million of reads per hour | 1169.94 Number of input reads | 35748091 Average input read length | 200 UNIQUE READS: Uniquely mapped reads number | 32856457 Uniquely mapped reads % | 91.91% Average mapped length | 200.50 Number of splices: Total | 20669403 Number of splices: Annotated (sjdb) | 19359317 Number of splices: GT/AG | 20384825 Number of splices: GC/AG | 264358 Number of splices: AT/AC | 7872 Number of splices: Non-canonical | 12348 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.00% Deletion average length | 1.33 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1287907 % of reads mapped to multiple loci | 3.60% Number of reads mapped to too many loci | 142801 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.52% % of reads unmapped: other | 2.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1683648 1683648 1683648 N_multimapping 1287907 1287907 1287907 N_noFeature 1372397 31877881 1565597 N_ambiguous 910503 3026 128804 UnstrandedReadsAssigned:30573557 PositiveStrandReadsAssigned:975550 NegativeStrandReadsAssigned:31162056 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610839 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610839-trimmed-pair1.fastq ERR10610839-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,748,091 reads, 31,683,506 reads pseudoaligned [quant] estimated average fragment length: 176.696 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52973 ERR10610839.ke.tsv 35125 ERR10610839.se.tsv 88098 total ==> ERR10610839.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.445 0.211304 0.0125514 PNS24247 1044 868.304 120.512 6.26916 PNS24249 1928 1752.3 33.461 0.862547 PNS24246 1044 868.304 120.512 6.26916 PNS24248 1044 868.304 120.512 6.26916 PNS24244 1471 1295.3 173.793 6.06057 PNS24243 293 127.186 0 0 KQK14069 1603 1427.3 4001.95 126.651 KQK14071 474 300.109 71.6227 10.7801 ==> ERR10610839.se.tsv <== BRADI_1g14170v3 4462 BRADI_1g53295v3 513 BRADI_1g59795v3 703 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 756 BRADI_1g74790v3 531 BRADI_1g09890v3 0 BRADI_1g77505v3 797 BRADI_1g48960v3 0 ERR10610839 completed mapping pipeline successfully