Starting /dee2/code/volunteer_pipeline.sh ERR10610840 current disk space = 1549375623168 free memory = 1598940684 ERR10610840 SRAfilesize f17a7eef6d893be73f48532c69b5c073 ERR10610840.sra ERR10610840.sra file validated ERR10610840 is paired end ERR10610840 is conventional basespace ERR10610840 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610840_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.32075 32.0 25.0 33.0 18.0 33.0 2 30.24275 32.0 30.0 33.0 18.0 33.0 3 30.589 33.0 31.0 33.0 18.0 34.0 4 30.61275 33.0 31.0 33.0 25.0 34.0 5 30.75675 33.0 32.0 33.0 25.0 34.0 6 32.9195 37.0 31.0 38.0 16.0 38.0 7 33.325 37.0 33.0 38.0 16.0 38.0 8 32.90325 37.0 31.0 38.0 16.0 38.0 9 33.17775 38.0 31.0 38.0 16.0 38.0 10-11 33.46725 38.0 33.0 38.0 16.0 38.0 12-13 33.543875 38.0 33.5 38.0 16.0 38.0 14-15 33.3905 38.0 33.0 38.0 16.0 38.0 16-17 33.534125 38.0 33.0 38.0 16.0 38.0 18-19 33.637249999999995 38.0 33.0 38.0 16.0 38.0 20-21 33.57825 38.0 33.0 38.0 16.0 38.0 22-23 33.651375 38.0 33.0 38.0 16.0 38.0 24-25 33.094125000000005 37.5 31.0 38.0 16.0 38.0 26-27 33.46975 38.0 33.0 38.0 16.0 38.0 28-29 33.793625 38.0 33.5 38.0 16.0 38.0 30-31 33.881375000000006 38.0 34.0 38.0 16.0 38.0 32-33 33.754875 38.0 34.0 38.0 16.0 38.0 34-35 33.908500000000004 38.0 34.0 38.0 16.0 38.0 36-37 33.74925 38.0 33.5 38.0 16.0 38.0 38-39 33.841499999999996 38.0 34.0 38.0 16.0 38.0 40-41 33.841125 38.0 33.5 38.0 16.0 38.0 42-43 33.861000000000004 38.0 34.0 38.0 16.0 38.0 44-45 34.116125 38.0 34.0 38.0 16.0 38.0 46-47 33.845124999999996 38.0 33.5 38.0 16.0 38.0 48-49 33.8225 38.0 34.0 38.0 16.0 38.0 50-51 33.6875 38.0 33.0 38.0 16.0 38.0 52-53 33.638125 38.0 33.5 38.0 16.0 38.0 54-55 33.73025 38.0 33.5 38.0 16.0 38.0 56-57 33.780249999999995 38.0 33.5 38.0 16.0 38.0 58-59 33.584375 38.0 33.0 38.0 16.0 38.0 60-61 33.73075 38.0 33.0 38.0 16.0 38.0 62-63 33.694125 38.0 33.0 38.0 16.0 38.0 64-65 33.90475 38.0 34.0 38.0 16.0 38.0 66-67 33.855875 38.0 33.5 38.0 16.0 38.0 68-69 33.807625 38.0 33.5 38.0 20.0 38.0 70-71 33.809875000000005 38.0 34.0 38.0 16.0 38.0 72-73 33.43175 38.0 33.0 38.0 16.0 38.0 74-75 33.71 38.0 33.5 38.0 16.0 38.0 76-77 33.5075 38.0 33.5 38.0 15.5 38.0 78-79 33.538624999999996 38.0 33.0 38.0 16.0 38.0 80-81 33.566874999999996 38.0 33.0 38.0 15.5 38.0 82-83 33.299625 38.0 33.0 38.0 15.0 38.0 84-85 33.603625 38.0 33.5 38.0 15.5 38.0 86-87 33.432249999999996 38.0 33.0 38.0 15.5 38.0 88-89 33.259375 38.0 33.0 38.0 15.0 38.0 90-91 33.643375000000006 38.0 34.0 38.0 15.0 38.0 92-93 33.284375 38.0 33.0 38.0 15.0 38.0 94-95 33.26375 38.0 32.5 38.0 15.0 38.0 96-97 33.351875 38.0 33.0 38.0 15.0 38.0 98-99 32.764125 37.5 31.0 38.0 15.0 38.0 100-101 31.996249999999996 36.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 4.0 17 6.0 18 17.0 19 43.0 20 46.0 21 58.0 22 71.0 23 51.0 24 73.0 25 63.0 26 100.0 27 100.0 28 121.0 29 132.0 30 130.0 31 141.0 32 210.0 33 202.0 34 251.0 35 360.0 36 587.0 37 1234.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.50152594099695 9.664292980671414 14.216683621566634 46.61749745676501 2 22.55 19.1 35.025 23.325000000000003 3 22.775000000000002 20.549999999999997 24.425 32.25 4 25.025 30.75 21.05 23.175 5 23.9 31.2 25.0 19.900000000000002 6 19.2 34.150000000000006 27.375 19.275000000000002 7 15.453863465866466 21.45536384096024 42.48562140535134 20.605151287821954 8 19.30965482741371 21.785892946473236 31.36568284142071 27.538769384692348 9 18.529632408102024 21.955488872218055 33.9584896224056 25.55638909727432 10-11 22.193048262065513 30.457614403600903 22.718179544886222 24.63115778944736 12-13 21.633112417156433 24.034012754783042 27.697886707515316 26.634988120545206 14-15 21.985192621407958 25.498807880537083 27.694817417492786 24.821182080562178 16-17 21.74294670846395 26.63322884012539 26.72100313479624 24.90282131661442 18-19 21.155288822205552 26.731682920730183 27.106776694173547 25.006251562890725 20-21 22.290286285785722 25.803225403175396 27.490936367045883 24.415551943992998 22-23 21.837500000000002 26.737499999999997 26.650000000000002 24.775 24-25 22.39029878734842 26.065758219777475 26.540817602200274 25.003125390673837 26-27 21.865233154144267 26.62832854106763 26.103262907863485 25.403175396924617 28-29 21.95 25.924999999999997 27.325 24.8 30-31 21.9375 25.900000000000002 26.987499999999997 25.174999999999997 32-33 22.6125 25.55 27.525 24.3125 34-35 22.275 25.924999999999997 26.325 25.474999999999998 36-37 21.8125 25.387500000000003 27.3375 25.4625 38-39 22.0 26.224999999999998 26.187500000000004 25.587500000000002 40-41 22.05 27.075 25.8625 25.0125 42-43 22.912499999999998 25.8125 27.1125 24.1625 44-45 21.875 25.5625 26.6125 25.95 46-47 21.987499999999997 26.0625 26.575 25.374999999999996 48-49 21.712500000000002 25.5 27.075 25.7125 50-51 21.3125 26.6625 27.125 24.9 52-53 21.65 26.187500000000004 26.737499999999997 25.424999999999997 54-55 21.975 26.5 26.200000000000003 25.324999999999996 56-57 22.425 26.125 26.55 24.9 58-59 21.9625 26.3625 26.8 24.875 60-61 22.225 26.05 26.5875 25.137500000000003 62-63 21.95 26.700000000000003 26.6 24.75 64-65 22.037499999999998 26.474999999999998 26.637499999999996 24.85 66-67 21.8 28.050000000000004 25.35 24.8 68-69 22.15 26.387500000000003 26.1625 25.3 70-71 21.65 27.462500000000002 25.900000000000002 24.9875 72-73 22.4625 26.0625 26.387500000000003 25.087500000000002 74-75 22.05 26.724999999999998 26.25 24.975 76-77 21.925 26.5375 26.1125 25.424999999999997 78-79 21.55 27.212500000000002 25.937500000000004 25.3 80-81 22.85 26.0375 25.5125 25.6 82-83 22.175 26.387500000000003 26.200000000000003 25.2375 84-85 22.225 25.337500000000002 26.4125 26.025 86-87 22.275 26.4125 25.8125 25.5 88-89 22.675 26.075 26.25 25.0 90-91 22.4375 26.0 25.874999999999996 25.687500000000004 92-93 22.537499999999998 25.9875 26.55 24.925 94-95 21.912499999999998 27.224999999999998 25.124999999999996 25.7375 96-97 21.925 26.4125 25.900000000000002 25.7625 98-99 22.6125 27.025 24.775 25.587500000000002 100-101 23.65 26.724999999999998 25.324999999999996 24.3 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 1.0 27 1.5 28 2.5 29 4.5 30 6.5 31 7.0 32 15.5 33 30.0 34 35.5 35 39.0 36 66.0 37 90.5 38 95.5 39 116.0 40 145.0 41 161.0 42 181.0 43 208.0 44 226.5 45 220.5 46 209.5 47 205.0 48 195.5 49 193.5 50 185.0 51 169.0 52 141.0 53 116.5 54 119.0 55 122.5 56 108.0 57 97.5 58 82.5 59 70.0 60 73.5 61 59.5 62 43.0 63 35.5 64 32.0 65 29.0 66 23.0 67 17.0 68 8.0 69 2.5 70 3.0 71 2.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7000000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.05 9 0.025 10-11 0.025 12-13 0.0375 14-15 0.3875 16-17 0.3125 18-19 0.025 20-21 0.0125 22-23 0.0 24-25 0.0125 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7315842583249244 1.4500000000000002 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.30000000000000004 0.0 0.0 0.0 0.0 74-75 0.375 0.0 0.0 0.0 0.0 76-77 0.475 0.0 0.0 0.0 0.0 78-79 0.5125 0.0 0.0 0.0 0.0 80-81 0.575 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 1.0375 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610840 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610840_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.219 32.0 27.0 33.0 18.0 33.0 2 29.74025 32.0 28.0 33.0 18.0 33.0 3 26.33 28.0 18.0 33.0 18.0 33.0 4 28.4475 32.0 27.0 33.0 15.0 33.0 5 29.29975 32.0 27.0 33.0 15.0 33.0 6 26.575 29.0 16.0 37.0 15.0 38.0 7 30.3635 34.0 26.0 38.0 16.0 38.0 8 31.91825 36.0 29.0 38.0 16.0 38.0 9 32.662 37.0 29.0 38.0 16.0 38.0 10-11 32.911 37.0 30.0 38.0 16.0 38.0 12-13 33.192499999999995 38.0 31.0 38.0 16.0 38.0 14-15 33.29375 38.0 32.0 38.0 16.0 38.0 16-17 33.103125 38.0 30.5 38.0 16.0 38.0 18-19 33.002375 38.0 30.0 38.0 16.0 38.0 20-21 32.9355 37.5 30.0 38.0 16.0 38.0 22-23 33.170625 38.0 31.0 38.0 16.0 38.0 24-25 32.753874999999994 37.0 29.5 38.0 16.0 38.0 26-27 32.806375 37.0 30.0 38.0 16.0 38.0 28-29 31.269374999999997 35.5 23.5 38.0 16.0 38.0 30-31 32.664249999999996 37.0 29.5 38.0 16.0 38.0 32-33 33.264624999999995 38.0 32.0 38.0 16.0 38.0 34-35 33.18425 38.0 32.0 38.0 16.0 38.0 36-37 32.71325 37.5 31.0 38.0 16.0 38.0 38-39 32.870875 37.0 30.0 38.0 16.0 38.0 40-41 33.298625 38.0 32.0 38.0 16.0 38.0 42-43 33.024 38.0 31.5 38.0 16.0 38.0 44-45 33.388125 38.0 33.0 38.0 16.0 38.0 46-47 33.07325 38.0 31.0 38.0 16.0 38.0 48-49 33.354625 38.0 33.0 38.0 16.0 38.0 50-51 33.463625 38.0 33.0 38.0 16.0 38.0 52-53 33.581375 38.0 33.0 38.0 16.0 38.0 54-55 33.329625 38.0 32.5 38.0 16.0 38.0 56-57 33.306875000000005 38.0 32.0 38.0 16.0 38.0 58-59 33.408625 38.0 32.0 38.0 16.0 38.0 60-61 33.493125 38.0 33.0 38.0 16.0 38.0 62-63 33.322500000000005 38.0 33.0 38.0 16.0 38.0 64-65 33.292125 38.0 32.5 38.0 16.0 38.0 66-67 33.07225 38.0 31.0 38.0 16.0 38.0 68-69 33.3845 38.0 33.0 38.0 16.0 38.0 70-71 33.218625 38.0 32.5 38.0 16.0 38.0 72-73 33.221125 38.0 31.0 38.0 16.0 38.0 74-75 33.085750000000004 38.0 31.0 38.0 16.0 38.0 76-77 33.343374999999995 38.0 33.0 38.0 16.0 38.0 78-79 32.9465 37.5 31.0 38.0 15.5 38.0 80-81 32.691500000000005 37.0 30.0 38.0 15.5 38.0 82-83 32.665 37.0 30.0 38.0 15.0 38.0 84-85 33.123125 38.0 32.5 38.0 15.5 38.0 86-87 32.7175 37.0 30.0 38.0 15.0 38.0 88-89 32.917 38.0 31.0 38.0 15.0 38.0 90-91 32.7355 37.5 30.5 38.0 15.0 38.0 92-93 32.731624999999994 37.5 30.5 38.0 15.0 38.0 94-95 32.775 37.0 31.0 38.0 15.0 38.0 96-97 32.715625 37.5 31.0 38.0 15.0 38.0 98-99 32.663375 37.5 31.0 38.0 15.0 38.0 100-101 30.714750000000002 35.5 27.0 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 19.0 18 43.0 19 62.0 20 59.0 21 69.0 22 75.0 23 67.0 24 83.0 25 85.0 26 102.0 27 125.0 28 128.0 29 145.0 30 139.0 31 140.0 32 194.0 33 224.0 34 290.0 35 396.0 36 649.0 37 904.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.875000000000004 14.924999999999999 15.525 38.675 2 28.575 20.925 32.5 18.0 3 20.775 23.625 33.5 22.1 4 25.174999999999997 30.025000000000002 21.0 23.799999999999997 5 27.925 33.550000000000004 19.825 18.7 6 21.224999999999998 32.75 25.6 20.424999999999997 7 21.475 17.474999999999998 37.85 23.200000000000003 8 24.275 22.5 25.7 27.525 9 23.200000000000003 23.25 28.425 25.124999999999996 10-11 25.887500000000003 28.5875 20.724999999999998 24.8 12-13 25.974999999999998 22.85 25.775 25.4 14-15 25.35 25.8 25.900000000000002 22.95 16-17 27.075 25.5125 24.45 22.9625 18-19 26.450000000000003 25.1 25.650000000000002 22.8 20-21 25.362499999999997 26.487500000000004 25.724999999999998 22.425 22-23 25.412499999999998 25.6 25.5125 23.474999999999998 24-25 25.275 25.1875 26.337500000000002 23.200000000000003 26-27 24.6875 26.674999999999997 25.9875 22.650000000000002 28-29 25.825 24.587500000000002 26.487500000000004 23.1 30-31 24.65 26.35 25.7375 23.2625 32-33 25.900000000000002 26.737499999999997 25.374999999999996 21.987499999999997 34-35 25.484556708765787 26.2348380642741 26.08478179317244 22.19582343378767 36-37 26.155198392767453 25.13812154696133 25.791059768960324 22.915620291310898 38-39 25.062625250501004 26.152304609218437 26.22745490981964 22.55761523046092 40-41 24.99373590578802 26.04610373340015 25.757955399649212 23.202204961162614 42-43 25.810930203205857 24.914804998106778 25.735201312634103 23.539063486053262 44-45 25.093961413179656 26.083688298672016 25.457278877474316 23.365071410674016 46-47 25.182115046470738 25.772418990203466 25.69706103993971 23.348404923386084 48-49 25.18768768768769 26.101101101101097 25.863363363363362 22.84784784784785 50-51 25.224999999999998 26.487500000000004 25.7875 22.5 52-53 25.624999999999996 26.75 25.1875 22.4375 54-55 25.2125 26.200000000000003 25.8125 22.775000000000002 56-57 25.412499999999998 26.1125 25.775 22.7 58-59 26.825 25.162499999999998 25.887500000000003 22.125 60-61 25.05 26.400000000000002 26.575 21.975 62-63 25.474999999999998 25.900000000000002 25.6125 23.0125 64-65 26.6125 25.75 26.0625 21.575 66-67 25.387500000000003 26.174999999999997 25.8625 22.575 68-69 24.587500000000002 26.1625 26.1 23.150000000000002 70-71 25.4625 25.5125 25.837500000000002 23.1875 72-73 25.775 25.887500000000003 26.637499999999996 21.7 74-75 25.1875 25.7625 26.0375 23.0125 76-77 25.874999999999996 26.0125 25.137500000000003 22.975 78-79 25.2625 26.087500000000002 25.924999999999997 22.725 80-81 24.85 26.5875 25.75 22.8125 82-83 26.25 26.187500000000004 25.825 21.7375 84-85 25.7625 26.625 25.2125 22.400000000000002 86-87 25.3125 26.575 26.5875 21.525 88-89 25.687500000000004 25.974999999999998 25.4375 22.900000000000002 90-91 25.7 26.987499999999997 25.137500000000003 22.175 92-93 25.0125 26.9625 26.275 21.75 94-95 26.3625 26.674999999999997 24.7375 22.225 96-97 25.2125 26.237500000000004 26.25 22.3 98-99 24.5625 27.35 25.775 22.3125 100-101 26.0625 27.4125 25.124999999999996 21.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 2.0 27 3.0 28 1.5 29 2.0 30 3.5 31 7.0 32 11.5 33 17.0 34 22.5 35 28.5 36 42.5 37 57.0 38 75.0 39 103.5 40 135.0 41 162.5 42 175.5 43 187.5 44 195.5 45 197.5 46 206.5 47 213.5 48 204.0 49 194.0 50 184.5 51 177.5 52 172.0 53 155.5 54 149.5 55 136.0 56 114.0 57 103.5 58 95.5 59 79.5 60 68.5 61 65.5 62 59.0 63 52.0 64 38.0 65 28.0 66 25.5 67 19.0 68 14.0 69 7.0 70 2.0 71 1.0 72 0.0 73 1.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0375 36-37 0.44999999999999996 38-39 0.2 40-41 0.22499999999999998 42-43 0.9625 44-45 0.22499999999999998 46-47 0.475 48-49 0.1 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7491219267436 99.4 2 0.2007024586051179 0.4 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.07500000000000001 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2625 0.0 0.0 0.0 0.0 72-73 0.32499999999999996 0.0 0.0 0.0 0.0 74-75 0.4 0.0 0.0 0.0 0.0 76-77 0.5 0.0 0.0 0.0 0.0 78-79 0.5375000000000001 0.0 0.0 0.0 0.0 80-81 0.6 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 1.0625 0.0 0.0 0.0 0.0 88-89 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTTCAC 15 0.009957196 47.5 70-71 >>END_MODULE Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247113 spots for ERR10610840.sra Written 247113 spots for ERR10610840.sra Read 247116 spots for ERR10610840.sra Written 247116 spots for ERR10610840.sra SRR ids: ['ERR10610840.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p5t379d5 ERR10610840.sra spots: 4942263 blocks: [[1, 247113], [247114, 494226], [494227, 741339], [741340, 988452], [988453, 1235565], [1235566, 1482678], [1482679, 1729791], [1729792, 1976904], [1976905, 2224017], [2224018, 2471130], [2471131, 2718243], [2718244, 2965356], [2965357, 3212469], [3212470, 3459582], [3459583, 3706695], [3706696, 3953808], [3953809, 4200921], [4200922, 4448034], [4448035, 4695147], [4695148, 4942263]] ERR10610840 file size 1185132 ERR10610840 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610840 ERR10610840_1.fastq ERR10610840_2.fastq Input file: ERR10610840_1.fastq Paired file: ERR10610840_2.fastq trimmed: ERR10610840-trimmed-pair1.fastq, ERR10610840-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:45:50 2024 >> started Fri Dec 6 20:45:55 2024 >> done (4.730s) 4942263 read pairs processed; of these: 22 ( 0.00%) short read pairs filtered out after trimming by size control 475 ( 0.01%) empty read pairs filtered out after trimming by size control 4941766 (99.99%) read pairs available; of these: 222699 ( 4.51%) trimmed read pairs available after processing 4719067 (95.49%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 2 0.00% 22 3 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 0 0.00% 28 3 0.00% 29 1 0.00% 30 2 0.00% 31 4 0.00% 32 4 0.00% 33 2 0.00% 34 4 0.00% 35 7 0.00% 36 12 0.00% 37 10 0.00% 38 16 0.00% 39 18 0.00% 40 17 0.00% 41 20 0.00% 42 18 0.00% 43 21 0.00% 44 44 0.00% 45 36 0.00% 46 39 0.00% 47 57 0.00% 48 50 0.00% 49 79 0.00% 50 92 0.00% 51 96 0.00% 52 98 0.00% 53 126 0.00% 54 133 0.00% 55 139 0.00% 56 152 0.00% 57 169 0.00% 58 209 0.00% 59 249 0.01% 60 312 0.01% 61 356 0.01% 62 330 0.01% 63 404 0.01% 64 477 0.01% 65 509 0.01% 66 598 0.01% 67 649 0.01% 68 729 0.01% 69 853 0.02% 70 929 0.02% 71 1044 0.02% 72 1289 0.03% 73 1359 0.03% 74 1514 0.03% 75 1722 0.03% 76 1943 0.04% 77 2231 0.05% 78 2514 0.05% 79 2866 0.06% 80 3111 0.06% 81 3454 0.07% 82 3893 0.08% 83 4246 0.09% 84 4690 0.09% 85 5439 0.11% 86 5951 0.12% 87 6528 0.13% 88 7168 0.15% 89 7903 0.16% 90 8673 0.18% 91 9506 0.19% 92 10244 0.21% 93 11129 0.23% 94 11799 0.24% 95 13053 0.26% 96 13830 0.28% 97 15377 0.31% 98 16276 0.33% 99 17632 0.36% 100 18234 0.37% 101 4719067 95.49% 4941766 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.21 prefix-fanout=2.0 sequence=TACCCTTTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=97.90 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.9 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=30 prefix-density=0.43 prefix-fanout=1.9 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=19 fanout-score=13.04 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.4 sequence=AAGGAGATCAAGAACGGCCGCCTCGCCATGTTCTCCATGTT ERR10610840 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:46:30 Started mapping on | Dec 06 20:46:30 Finished on | Dec 06 20:47:27 Mapping speed, Million of reads per hour | 312.11 Number of input reads | 4941766 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 4358347 Uniquely mapped reads % | 88.19% Average mapped length | 199.97 Number of splices: Total | 2668245 Number of splices: Annotated (sjdb) | 2499633 Number of splices: GT/AG | 2632368 Number of splices: GC/AG | 33029 Number of splices: AT/AC | 979 Number of splices: Non-canonical | 1869 Mismatch rate per base, % | 0.72% Deletion rate per base | 0.00% Deletion average length | 1.32 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 168478 % of reads mapped to multiple loci | 3.41% Number of reads mapped to too many loci | 13111 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.54% % of reads unmapped: other | 2.59% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 414941 414941 414941 N_multimapping 168478 168478 168478 N_noFeature 180559 4227981 206252 N_ambiguous 120501 390 16289 UnstrandedReadsAssigned:4057287 PositiveStrandReadsAssigned:129976 NegativeStrandReadsAssigned:4135806 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610840 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610840-trimmed-pair1.fastq ERR10610840-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,941,766 reads, 4,268,548 reads pseudoaligned [quant] estimated average fragment length: 168.352 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52973 ERR10610840.ke.tsv 35125 ERR10610840.se.tsv 88098 total ==> ERR10610840.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 768.758 17.366 7.72557 PNS24247 1044 876.648 7.05881 2.75377 PNS24249 1928 1760.65 3.85262 0.748351 PNS24246 1044 876.648 7.05881 2.75377 PNS24248 1044 876.648 7.05881 2.75377 PNS24244 1471 1303.65 17.605 4.61846 PNS24243 293 132.204 0 0 KQK14069 1603 1435.65 467.551 111.379 KQK14071 474 307.889 15.2137 16.899 ==> ERR10610840.se.tsv <== BRADI_1g14170v3 565 BRADI_1g53295v3 67 BRADI_1g59795v3 95 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 103 BRADI_1g74790v3 68 BRADI_1g09890v3 0 BRADI_1g77505v3 110 BRADI_1g48960v3 0 ERR10610840 completed mapping pipeline successfully