Starting /dee2/code/volunteer_pipeline.sh ERR10610842 current disk space = 1549277409280 free memory = 1597046652 ERR10610842 SRAfilesize 0e9d9ddd4ecabc7c7519c339ef80efe2 ERR10610842.sra ERR10610842.sra file validated ERR10610842 is paired end ERR10610842 is conventional basespace ERR10610842 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610842_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.25725 18.0 18.0 30.0 18.0 32.0 2 28.44125 29.0 27.0 31.0 18.0 33.0 3 28.57375 31.0 27.0 33.0 18.0 33.0 4 29.8565 32.0 30.0 33.0 15.0 33.0 5 30.1385 33.0 31.0 33.0 15.0 33.0 6 32.17325 36.0 29.0 38.0 16.0 38.0 7 32.9815 37.0 31.0 38.0 16.0 38.0 8 33.5005 37.0 33.0 38.0 16.0 38.0 9 33.47325 38.0 33.0 38.0 16.0 38.0 10-11 30.730625 35.0 23.0 38.0 16.0 38.0 12-13 33.4785 37.0 32.0 38.0 16.0 38.0 14-15 33.903999999999996 38.0 33.5 38.0 16.0 38.0 16-17 34.10850000000001 38.0 34.0 38.0 16.0 38.0 18-19 34.074125 38.0 34.0 38.0 16.0 38.0 20-21 33.896375 38.0 34.0 38.0 16.0 38.0 22-23 33.9835 38.0 34.0 38.0 16.0 38.0 24-25 34.115125 38.0 34.0 38.0 16.0 38.0 26-27 33.960875 38.0 34.0 38.0 16.0 38.0 28-29 33.8815 38.0 33.5 38.0 16.0 38.0 30-31 33.27175 38.0 32.0 38.0 16.0 38.0 32-33 33.82325 38.0 34.0 38.0 16.0 38.0 34-35 33.868750000000006 38.0 34.0 38.0 16.0 38.0 36-37 33.86425 38.0 34.0 38.0 16.0 38.0 38-39 34.019999999999996 38.0 34.0 38.0 16.0 38.0 40-41 33.941500000000005 38.0 34.0 38.0 16.0 38.0 42-43 34.14425 38.0 34.0 38.0 16.0 38.0 44-45 33.988375 38.0 34.0 38.0 20.0 38.0 46-47 34.015125 38.0 34.0 38.0 16.0 38.0 48-49 33.98075 38.0 34.0 38.0 16.0 38.0 50-51 34.029875000000004 38.0 34.0 38.0 16.0 38.0 52-53 34.1915 38.0 34.0 38.0 20.5 38.0 54-55 34.077875 38.0 34.0 38.0 16.0 38.0 56-57 34.10525 38.0 34.0 38.0 20.0 38.0 58-59 34.126000000000005 38.0 34.0 38.0 20.5 38.0 60-61 34.35625 38.0 34.0 38.0 24.5 38.0 62-63 34.361125 38.0 35.0 38.0 24.0 38.0 64-65 34.396249999999995 38.0 34.5 38.0 24.5 38.0 66-67 34.27875 38.0 34.0 38.0 20.5 38.0 68-69 34.179125 38.0 34.0 38.0 20.0 38.0 70-71 34.207 38.0 34.0 38.0 20.0 38.0 72-73 34.289625 38.0 34.0 38.0 24.0 38.0 74-75 34.283625 38.0 34.0 38.0 20.5 38.0 76-77 34.3955 38.0 34.5 38.0 24.5 38.0 78-79 34.3435 38.0 34.0 38.0 24.5 38.0 80-81 34.256125 38.0 34.0 38.0 23.0 38.0 82-83 34.159375 38.0 34.0 38.0 20.0 38.0 84-85 34.12425 38.0 34.0 38.0 19.5 38.0 86-87 34.113375000000005 38.0 34.0 38.0 19.5 38.0 88-89 34.045500000000004 38.0 34.0 38.0 20.0 38.0 90-91 34.062 38.0 34.0 38.0 18.5 38.0 92-93 33.71925 38.0 34.0 38.0 16.0 38.0 94-95 33.933 38.0 34.0 38.0 21.5 38.0 96-97 34.03075 38.0 34.0 38.0 19.5 38.0 98-99 34.070875 38.0 34.0 38.0 22.5 38.0 100-101 33.158 37.5 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 9.0 19 39.0 20 49.0 21 43.0 22 45.0 23 61.0 24 58.0 25 66.0 26 96.0 27 87.0 28 92.0 29 111.0 30 137.0 31 166.0 32 201.0 33 202.0 34 276.0 35 389.0 36 810.0 37 1060.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.664978475563434 14.661939731577615 10.86350974930362 47.809572043555335 2 22.400000000000002 17.05 38.525 22.025 3 26.325 18.575 22.725 32.375 4 26.900000000000002 27.025 20.424999999999997 25.650000000000002 5 25.5 30.975 24.7 18.825 6 18.179544886221557 35.65891472868217 26.006501625406354 20.155038759689923 7 14.832416208104052 23.28664332166083 42.04602301150575 19.834917458729365 8 18.575 22.725 31.45 27.250000000000004 9 19.5 22.175 33.324999999999996 25.0 10-11 22.75 29.675 24.087500000000002 23.4875 12-13 20.975609756097562 23.439649781113197 29.130706691682303 26.454033771106943 14-15 21.901188242651656 25.89118198874296 27.49218261413383 24.715447154471544 16-17 22.47935951963973 26.28221165874406 26.7575681761321 24.48086064548411 18-19 22.37928446334751 26.54490868151113 26.64498373780335 24.430823117338004 20-21 21.885942971485743 26.088044022011005 26.900950475237618 25.125062531265634 22-23 22.273636818409205 26.075537768884445 26.88844422211106 24.7623811905953 24-25 21.842960740185045 26.469117279319832 27.431857964491122 24.256064016004 26-27 21.257971739402276 26.04726772539702 27.597849193447544 25.09691134175316 28-29 21.717929482370593 26.84421105276319 27.156789197299325 24.281070267566893 30-31 22.6875 26.325 25.387500000000003 25.6 32-33 20.4625 26.224999999999998 27.3625 25.95 34-35 22.0875 26.9625 26.9125 24.0375 36-37 21.775 26.35 26.700000000000003 25.174999999999997 38-39 22.3 26.125 26.55 25.025 40-41 21.587500000000002 28.075 25.724999999999998 24.6125 42-43 21.912499999999998 26.3125 26.087500000000002 25.687500000000004 44-45 20.9375 26.6 27.3875 25.074999999999996 46-47 22.112499999999997 26.637499999999996 26.1625 25.087500000000002 48-49 21.637500000000003 26.337500000000002 26.187500000000004 25.837500000000002 50-51 22.85 26.5875 26.05 24.5125 52-53 22.575 25.85 26.4125 25.162499999999998 54-55 22.3125 25.5375 26.85 25.3 56-57 21.6 26.724999999999998 27.1125 24.5625 58-59 21.8125 26.5875 26.8 24.8 60-61 22.45 26.187500000000004 26.3 25.0625 62-63 22.125 26.5 26.724999999999998 24.65 64-65 22.45 26.400000000000002 26.05 25.1 66-67 21.912499999999998 26.3125 26.3 25.474999999999998 68-69 21.6 26.424999999999997 26.924999999999997 25.05 70-71 22.075 26.650000000000002 26.937499999999996 24.337500000000002 72-73 22.175 25.887500000000003 25.7875 26.150000000000002 74-75 22.162499999999998 25.924999999999997 25.85 26.0625 76-77 22.4625 26.6125 26.25 24.675 78-79 21.8875 26.1125 26.375 25.624999999999996 80-81 21.7375 26.2125 26.674999999999997 25.374999999999996 82-83 23.0125 26.3125 25.5125 25.162499999999998 84-85 22.0125 25.8 26.650000000000002 25.5375 86-87 22.037499999999998 26.674999999999997 25.587500000000002 25.7 88-89 22.412499999999998 27.450000000000003 25.95 24.1875 90-91 22.740342542817853 25.815726965870734 26.52831603950494 24.915614451806476 92-93 22.552819102387797 26.840855106888363 25.86573321665208 24.74059257407176 94-95 23.275000000000002 26.85 25.837500000000002 24.0375 96-97 22.4625 26.787499999999998 25.587500000000002 25.162499999999998 98-99 22.825 26.825 25.75 24.6 100-101 22.412499999999998 27.3375 25.4375 24.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 0.5 27 1.5 28 1.5 29 2.0 30 6.0 31 9.5 32 12.5 33 18.0 34 23.5 35 37.0 36 57.0 37 78.5 38 104.5 39 126.0 40 158.0 41 186.0 42 202.5 43 212.5 44 225.5 45 234.0 46 237.0 47 232.0 48 201.5 49 183.0 50 170.5 51 156.5 52 149.0 53 124.5 54 103.5 55 95.5 56 86.0 57 83.5 58 79.0 59 70.0 60 60.0 61 53.5 62 44.0 63 38.0 64 36.0 65 28.5 66 22.5 67 14.0 68 10.0 69 9.5 70 6.5 71 4.5 72 1.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.05 8 0.0 9 0.0 10-11 0.0 12-13 0.0625 14-15 0.0625 16-17 0.075 18-19 0.075 20-21 0.05 22-23 0.05 24-25 0.025 26-27 0.0375 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0125 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.55 0.0 0.0 0.0 0.0 86-87 0.7 0.0 0.0 0.0 0.0 88-89 0.8625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610842 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610842_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.8555 33.0 28.0 33.0 18.0 34.0 2 30.2855 33.0 30.0 33.0 18.0 34.0 3 30.339 33.0 31.0 33.0 18.0 34.0 4 30.03175 33.0 31.0 33.0 15.0 34.0 5 29.88325 33.0 31.0 33.0 15.0 34.0 6 33.247 38.0 31.0 38.0 16.0 38.0 7 33.76025 38.0 33.0 38.0 16.0 38.0 8 33.56175 38.0 33.0 38.0 16.0 38.0 9 33.66375 38.0 33.0 38.0 16.0 38.0 10-11 33.6185 38.0 33.0 38.0 16.0 38.0 12-13 33.608625 38.0 33.0 38.0 16.0 38.0 14-15 33.558625 38.0 33.0 38.0 16.0 38.0 16-17 32.870374999999996 37.5 31.0 38.0 16.0 38.0 18-19 33.402249999999995 38.0 32.5 38.0 16.0 38.0 20-21 33.479 38.0 33.0 38.0 16.0 38.0 22-23 33.556250000000006 38.0 33.0 38.0 16.0 38.0 24-25 33.717124999999996 38.0 33.5 38.0 16.0 38.0 26-27 33.351 38.0 32.0 38.0 16.0 38.0 28-29 33.172625 38.0 31.0 38.0 16.0 38.0 30-31 33.43662500000001 38.0 33.0 38.0 16.0 38.0 32-33 33.55 38.0 33.0 38.0 16.0 38.0 34-35 33.767125 38.0 33.0 38.0 16.0 38.0 36-37 33.497125 38.0 33.0 38.0 16.0 38.0 38-39 33.680875 38.0 33.0 38.0 16.0 38.0 40-41 33.64575 38.0 33.0 38.0 16.0 38.0 42-43 33.29275 38.0 32.0 38.0 16.0 38.0 44-45 33.591125 38.0 33.0 38.0 16.0 38.0 46-47 33.591875 38.0 33.0 38.0 16.0 38.0 48-49 33.787499999999994 38.0 33.5 38.0 16.0 38.0 50-51 33.518375 38.0 33.0 38.0 16.0 38.0 52-53 33.560625 38.0 33.0 38.0 16.0 38.0 54-55 33.439625 38.0 33.0 38.0 16.0 38.0 56-57 33.440375 38.0 33.0 38.0 16.0 38.0 58-59 33.426125 38.0 33.0 38.0 16.0 38.0 60-61 33.6425 38.0 33.0 38.0 16.0 38.0 62-63 33.300875 38.0 32.0 38.0 16.0 38.0 64-65 33.557249999999996 38.0 33.0 38.0 16.0 38.0 66-67 33.43675 38.0 33.0 38.0 16.0 38.0 68-69 33.611125 38.0 33.0 38.0 16.0 38.0 70-71 33.441874999999996 38.0 33.0 38.0 16.0 38.0 72-73 33.4815 38.0 33.0 38.0 16.0 38.0 74-75 33.461749999999995 38.0 33.0 38.0 16.0 38.0 76-77 33.4135 38.0 33.0 38.0 16.0 38.0 78-79 33.332499999999996 38.0 32.5 38.0 16.0 38.0 80-81 33.179375 38.0 32.0 38.0 16.0 38.0 82-83 33.303625 38.0 32.0 38.0 16.0 38.0 84-85 33.313125 38.0 33.0 38.0 16.0 38.0 86-87 33.437124999999995 38.0 33.0 38.0 15.5 38.0 88-89 33.2795 38.0 33.0 38.0 15.0 38.0 90-91 33.183 38.0 32.0 38.0 15.0 38.0 92-93 33.094125 38.0 32.5 38.0 15.0 38.0 94-95 33.186375 38.0 33.0 38.0 15.0 38.0 96-97 33.0525 38.0 32.0 38.0 15.0 38.0 98-99 33.10625 38.0 33.0 38.0 15.0 38.0 100-101 31.851 36.5 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 5.0 18 23.0 19 49.0 20 74.0 21 55.0 22 59.0 23 79.0 24 72.0 25 75.0 26 81.0 27 100.0 28 107.0 29 147.0 30 139.0 31 162.0 32 174.0 33 210.0 34 248.0 35 334.0 36 575.0 37 1232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.049999999999997 16.125 14.7 39.125 2 26.474999999999998 21.725 32.875 18.925 3 21.85 24.9 27.700000000000003 25.55 4 25.900000000000002 33.025 19.75 21.325 5 27.35 32.725 20.674999999999997 19.25 6 22.35 36.825 21.349999999999998 19.475 7 20.974999999999998 17.925 37.724999999999994 23.375 8 23.275000000000002 21.45 28.249999999999996 27.025 9 24.55 21.8 27.825 25.825 10-11 25.35 29.3375 21.675 23.6375 12-13 25.224999999999998 24.05 25.387500000000003 25.337500000000002 14-15 24.4125 25.6 25.775 24.212500000000002 16-17 25.2 25.874999999999996 25.2125 23.7125 18-19 25.3125 26.5125 24.474999999999998 23.7 20-21 24.975 26.8375 24.775 23.4125 22-23 25.775 25.974999999999998 24.6125 23.6375 24-25 24.9875 26.2875 25.412499999999998 23.3125 26-27 25.0 25.874999999999996 25.4875 23.6375 28-29 25.137500000000003 25.85 26.075 22.9375 30-31 24.962500000000002 25.5 25.974999999999998 23.5625 32-33 25.35 26.075 26.087500000000002 22.4875 34-35 25.025 26.55 25.5125 22.912499999999998 36-37 25.090636329541194 25.54069258657332 26.790848856107015 22.577822227778473 38-39 25.472052019507313 25.997248968363134 25.397023883956482 23.133675128173063 40-41 25.278159769971246 26.428303537942245 25.315664458057256 22.977872234029252 42-43 24.712500000000002 26.224999999999998 26.275 22.787499999999998 44-45 24.93123280820205 25.70642660665166 25.968992248062015 23.393348337084273 46-47 24.75 26.3625 25.6 23.2875 48-49 24.55 25.7375 26.087500000000002 23.625 50-51 24.6875 26.6 26.337500000000002 22.375 52-53 25.25 26.387500000000003 25.5125 22.85 54-55 25.4 25.724999999999998 26.0625 22.8125 56-57 25.3125 25.4625 25.874999999999996 23.35 58-59 25.587500000000002 26.4625 25.362499999999997 22.5875 60-61 25.2625 26.075 25.662499999999998 23.0 62-63 25.125062531265634 26.488244122061033 26.17558779389695 22.211105552776388 64-65 25.6128064032016 26.038019009504755 25.86293146573287 22.486243121560783 66-67 24.725 26.450000000000003 25.724999999999998 23.1 68-69 25.531382845711427 26.18154538634659 26.019004751187797 22.268067016754188 70-71 24.887500000000003 25.9625 26.5875 22.5625 72-73 24.474999999999998 26.55 26.187500000000004 22.787499999999998 74-75 25.1 25.85 26.487500000000004 22.5625 76-77 25.4875 25.4625 26.137500000000003 22.912499999999998 78-79 25.162499999999998 26.937499999999996 25.974999999999998 21.925 80-81 25.162499999999998 25.900000000000002 25.9625 22.975 82-83 26.487500000000004 25.662499999999998 25.424999999999997 22.425 84-85 25.174999999999997 27.625 26.075 21.125 86-87 25.318829707426854 25.968992248062015 26.60665166291573 22.1055263815954 88-89 23.849999999999998 26.6625 27.025 22.4625 90-91 26.131532883220803 25.681420355088775 26.319079769942487 21.867966991747938 92-93 25.15 26.974999999999998 25.874999999999996 22.0 94-95 25.5125 26.2625 25.25 22.975 96-97 25.45 26.137500000000003 26.0125 22.400000000000002 98-99 25.275 25.637500000000003 26.400000000000002 22.6875 100-101 26.275 25.837500000000002 25.6125 22.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.5 27 1.5 28 1.5 29 1.0 30 3.0 31 4.5 32 8.5 33 15.5 34 18.0 35 25.0 36 40.5 37 59.5 38 86.0 39 114.0 40 133.0 41 161.5 42 191.0 43 208.5 44 217.0 45 218.5 46 227.0 47 216.0 48 203.0 49 200.0 50 180.5 51 167.0 52 153.5 53 132.5 54 119.0 55 114.5 56 103.0 57 90.0 58 87.5 59 84.0 60 70.5 61 65.0 62 63.0 63 49.0 64 40.5 65 35.5 66 28.0 67 22.0 68 14.5 69 11.0 70 7.5 71 2.0 72 1.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0375 40-41 0.0125 42-43 0.0 44-45 0.025 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.05 64-65 0.05 66-67 0.0 68-69 0.025 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.025 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52237305178483 98.97500000000001 2 0.4273504273504274 0.8500000000000001 3 0.025138260432378077 0.075 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.6 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735874 spots for ERR10610842.sra Written 735874 spots for ERR10610842.sra Read 735876 spots for ERR10610842.sra Written 735876 spots for ERR10610842.sra SRR ids: ['ERR10610842.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ij6enq_x ERR10610842.sra spots: 14717482 blocks: [[1, 735874], [735875, 1471748], [1471749, 2207622], [2207623, 2943496], [2943497, 3679370], [3679371, 4415244], [4415245, 5151118], [5151119, 5886992], [5886993, 6622866], [6622867, 7358740], [7358741, 8094614], [8094615, 8830488], [8830489, 9566362], [9566363, 10302236], [10302237, 11038110], [11038111, 11773984], [11773985, 12509858], [12509859, 13245732], [13245733, 13981606], [13981607, 14717482]] ERR10610842 file size 3542689 ERR10610842 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610842 ERR10610842_1.fastq ERR10610842_2.fastq Input file: ERR10610842_1.fastq Paired file: ERR10610842_2.fastq trimmed: ERR10610842-trimmed-pair1.fastq, ERR10610842-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:51:36 2024 >> started Fri Dec 6 20:51:56 2024 >> done (20.222s) 14717482 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 1150 ( 0.01%) empty read pairs filtered out after trimming by size control 14716294 (99.99%) read pairs available; of these: 452712 ( 3.08%) trimmed read pairs available after processing 14263582 (96.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 0 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 1 0.00% 26 2 0.00% 27 2 0.00% 28 8 0.00% 29 3 0.00% 30 7 0.00% 31 4 0.00% 32 7 0.00% 33 13 0.00% 34 11 0.00% 35 24 0.00% 36 29 0.00% 37 27 0.00% 38 32 0.00% 39 81 0.00% 40 39 0.00% 41 50 0.00% 42 59 0.00% 43 70 0.00% 44 67 0.00% 45 75 0.00% 46 90 0.00% 47 111 0.00% 48 135 0.00% 49 142 0.00% 50 163 0.00% 51 180 0.00% 52 237 0.00% 53 281 0.00% 54 269 0.00% 55 293 0.00% 56 318 0.00% 57 333 0.00% 58 386 0.00% 59 482 0.00% 60 544 0.00% 61 653 0.00% 62 690 0.00% 63 812 0.01% 64 936 0.01% 65 1001 0.01% 66 1109 0.01% 67 1259 0.01% 68 1403 0.01% 69 1563 0.01% 70 1822 0.01% 71 1977 0.01% 72 2320 0.02% 73 2551 0.02% 74 2867 0.02% 75 3315 0.02% 76 3877 0.03% 77 4144 0.03% 78 4662 0.03% 79 5186 0.04% 80 5844 0.04% 81 6558 0.04% 82 7365 0.05% 83 8329 0.06% 84 9345 0.06% 85 10359 0.07% 86 11544 0.08% 87 12726 0.09% 88 14221 0.10% 89 15641 0.11% 90 16821 0.11% 91 19123 0.13% 92 20485 0.14% 93 22308 0.15% 94 24837 0.17% 95 26874 0.18% 96 28989 0.20% 97 32400 0.22% 98 34434 0.23% 99 37254 0.25% 100 40523 0.28% 101 14263582 96.92% 14716294 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.36 fanout-score-rank=16 prefix-density=0.22 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=25.76 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.9 sequence=TCTGAAACAGATTTATTTAAAACAGTAAGATGATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCACCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGTTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTGGCGGCGGCGG criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.44 prefix-fanout=2.0 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=24 fanout-score=25.75 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=7.2 sequence=GCTGCAGCTGCAGC ERR10610842 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:52:35 Started mapping on | Dec 06 20:52:35 Finished on | Dec 06 20:55:19 Mapping speed, Million of reads per hour | 323.04 Number of input reads | 14716294 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 13459721 Uniquely mapped reads % | 91.46% Average mapped length | 200.10 Number of splices: Total | 8798056 Number of splices: Annotated (sjdb) | 8246221 Number of splices: GT/AG | 8678690 Number of splices: GC/AG | 104812 Number of splices: AT/AC | 3825 Number of splices: Non-canonical | 10729 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.01% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 1.78 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 207535 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 9845 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.53% % of reads unmapped: other | 0.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1049038 1049038 1049038 N_multimapping 207535 207535 207535 N_noFeature 465755 13067730 551790 N_ambiguous 356086 1355 51372 UnstrandedReadsAssigned:12637880 PositiveStrandReadsAssigned:390636 NegativeStrandReadsAssigned:12856559 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610842 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610842-trimmed-pair1.fastq ERR10610842-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,716,294 reads, 13,168,315 reads pseudoaligned [quant] estimated average fragment length: 174.475 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,263 rounds 52973 ERR10610842.ke.tsv 35125 ERR10610842.se.tsv 88098 total ==> ERR10610842.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 762.644 0 0 PNS24247 1044 870.525 56.0553 7.24711 PNS24249 1928 1754.53 20.3265 1.30386 PNS24246 1044 870.525 56.0553 7.24711 PNS24248 1044 870.525 56.0553 7.24711 PNS24244 1471 1297.53 70.5076 6.11575 PNS24243 293 128.066 0 0 KQK14069 1603 1429.53 1307.6 102.947 KQK14071 474 302.052 53.4733 19.9244 ==> ERR10610842.se.tsv <== BRADI_1g14170v3 1581 BRADI_1g53295v3 94 BRADI_1g59795v3 457 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 318 BRADI_1g74790v3 107 BRADI_1g09890v3 0 BRADI_1g77505v3 341 BRADI_1g48960v3 0 ERR10610842 completed mapping pipeline successfully