Starting /dee2/code/volunteer_pipeline.sh ERR10610843 current disk space = 1549252169728 free memory = 1599539036 ERR10610843 SRAfilesize 11460971ff5ae7c13822498db93f832b ERR10610843.sra ERR10610843.sra file validated ERR10610843 is paired end ERR10610843 is conventional basespace ERR10610843 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610843_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.857 18.0 18.0 31.0 18.0 33.0 2 29.99225 32.0 27.0 33.0 25.0 33.0 3 30.65725 33.0 31.0 33.0 25.0 33.0 4 30.084 33.0 29.0 33.0 25.0 33.0 5 31.162 33.0 32.0 33.0 27.0 34.0 6 33.5425 37.0 33.0 38.0 16.0 38.0 7 34.0095 38.0 34.0 38.0 16.0 38.0 8 34.26475 38.0 34.0 38.0 26.0 38.0 9 34.56675 38.0 35.0 38.0 26.0 38.0 10-11 34.5405 38.0 35.0 38.0 26.0 38.0 12-13 34.469375 38.0 34.5 38.0 25.5 38.0 14-15 34.539874999999995 38.0 35.0 38.0 26.0 38.0 16-17 34.614625 38.0 35.0 38.0 26.0 38.0 18-19 34.6375 38.0 35.5 38.0 26.0 38.0 20-21 24.115000000000002 22.0 21.5 28.5 15.0 33.0 22-23 32.3135 35.5 30.5 37.5 16.0 37.5 24-25 34.291250000000005 38.0 34.0 38.0 25.0 38.0 26-27 34.703875 38.0 35.0 38.0 25.0 38.0 28-29 34.64275 38.0 35.0 38.0 25.0 38.0 30-31 34.843625 38.0 36.0 38.0 26.0 38.0 32-33 34.865 38.0 35.5 38.0 26.0 38.0 34-35 34.771 38.0 35.5 38.0 26.0 38.0 36-37 34.713125000000005 38.0 35.0 38.0 25.0 38.0 38-39 34.7295 38.0 35.5 38.0 25.0 38.0 40-41 34.888625000000005 38.0 36.0 38.0 25.0 38.0 42-43 34.63525 38.0 35.0 38.0 25.0 38.0 44-45 34.632374999999996 38.0 35.0 38.0 25.0 38.0 46-47 34.866749999999996 38.0 36.0 38.0 25.0 38.0 48-49 27.464624999999998 27.0 26.0 31.5 20.5 35.5 50-51 29.79475 31.5 27.5 33.5 16.0 37.5 52-53 33.796875 37.5 33.5 38.0 20.5 38.0 54-55 27.24275 27.0 25.0 31.5 19.5 36.5 56-57 29.4835 31.0 27.5 33.0 16.0 37.0 58-59 33.56425 37.0 32.5 38.0 20.0 38.0 60-61 34.528 38.0 34.5 38.0 25.0 38.0 62-63 34.821375 38.0 35.5 38.0 26.0 38.0 64-65 34.75925 38.0 35.5 38.0 25.0 38.0 66-67 34.8425 38.0 36.0 38.0 25.0 38.0 68-69 34.89875 38.0 36.0 38.0 26.0 38.0 70-71 34.6215 38.0 35.0 38.0 25.0 38.0 72-73 24.142875 22.0 21.0 27.5 15.0 37.0 74-75 31.973374999999997 35.0 29.0 37.0 20.0 38.0 76-77 34.296125 38.0 34.0 38.0 24.5 38.0 78-79 34.593125 38.0 35.0 38.0 25.0 38.0 80-81 34.861125 38.0 35.5 38.0 26.0 38.0 82-83 34.764875 38.0 35.5 38.0 25.0 38.0 84-85 34.743375 38.0 35.5 38.0 25.0 38.0 86-87 34.70275 38.0 35.5 38.0 25.0 38.0 88-89 34.701375 38.0 35.0 38.0 25.0 38.0 90-91 34.739125 38.0 35.5 38.0 25.0 38.0 92-93 34.768625 38.0 35.5 38.0 25.5 38.0 94-95 33.446875000000006 37.5 32.5 38.0 19.0 38.0 96-97 34.344875 38.0 34.0 38.0 24.0 38.0 98-99 25.914375 26.5 24.5 26.5 18.5 32.5 100-101 27.2175 27.5 25.0 32.0 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 5.0 19 32.0 20 43.0 21 48.0 22 56.0 23 60.0 24 44.0 25 76.0 26 73.0 27 84.0 28 104.0 29 123.0 30 145.0 31 181.0 32 233.0 33 308.0 34 495.0 35 1371.0 36 446.0 37 72.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.8030303030303 10.732323232323232 16.43939393939394 45.025252525252526 2 22.525000000000002 17.9 36.425000000000004 23.150000000000002 3 21.10527631907977 21.555388847211805 22.80570142535634 34.53363340835209 4 23.575 31.05 22.125 23.25 5 23.150000000000002 34.150000000000006 23.65 19.05 6 18.35 35.699999999999996 25.6 20.349999999999998 7 15.825 22.900000000000002 41.975 19.3 8 19.225 22.075 32.0 26.700000000000003 9 18.625 21.75 33.575 26.05 10-11 21.3125 31.2875 23.7625 23.6375 12-13 20.80520130032508 25.018754688672168 28.782195548887223 25.393848462115532 14-15 20.54777388694347 26.663331665832917 28.65182591295648 24.137068534267133 16-17 21.160580290145074 27.088544272136065 26.575787893946973 25.175087543771884 18-19 20.735367683841922 27.088544272136065 27.07603801900951 25.100050025012504 20-21 20.897948974487242 30.965482741370685 21.360680340170084 26.775887943971988 22-23 21.29282320580145 26.994248562140534 26.744186046511626 24.968742185546386 24-25 21.12764095511939 27.3284160520065 26.95336917114639 24.590573821727716 26-27 20.9875 27.325 27.400000000000002 24.2875 28-29 21.125 26.625 27.175 25.074999999999996 30-31 22.237499999999997 27.05 26.087500000000002 24.625 32-33 21.575 27.1375 26.8375 24.45 34-35 21.85 27.125 25.3 25.724999999999998 36-37 20.840105013126642 27.128391048881113 27.078384798099762 24.953119139892486 38-39 21.2625 27.375 26.8625 24.5 40-41 20.962500000000002 27.900000000000002 25.3 25.837500000000002 42-43 21.275 27.287499999999998 26.6 24.837500000000002 44-45 21.512500000000003 26.9125 26.650000000000002 24.925 46-47 20.8625 27.6625 26.1 25.374999999999996 48-49 22.900000000000002 27.037499999999998 25.112499999999997 24.95 50-51 21.825 26.974999999999998 26.8125 24.3875 52-53 22.1375 26.875 26.5375 24.45 54-55 21.175 29.349999999999998 23.799999999999997 25.674999999999997 56-57 21.025 27.737499999999997 26.7125 24.525 58-59 21.1125 28.012500000000003 25.9625 24.9125 60-61 21.65 27.437499999999996 25.0375 25.874999999999996 62-63 21.25 26.137500000000003 27.150000000000002 25.4625 64-65 22.55 27.0125 25.75 24.6875 66-67 21.6625 26.4625 26.400000000000002 25.474999999999998 68-69 21.1375 26.75 26.6125 25.5 70-71 21.6625 27.474999999999998 26.05 24.8125 72-73 23.4125 30.099999999999998 23.6375 22.85 74-75 21.375 26.9625 27.6 24.0625 76-77 21.975 26.0 27.0625 24.962500000000002 78-79 21.075 26.237500000000004 26.4125 26.275 80-81 21.087500000000002 26.700000000000003 26.687499999999996 25.525 82-83 21.55 27.725 26.637499999999996 24.087500000000002 84-85 21.3625 26.1125 26.0125 26.5125 86-87 22.0 26.187500000000004 27.224999999999998 24.587500000000002 88-89 22.14026753344168 26.903362920365048 26.415801975246904 24.54056757094637 90-91 21.349999999999998 27.187499999999996 25.662499999999998 25.8 92-93 21.61520190023753 25.51568946118265 27.21590198774847 25.653206650831358 94-95 22.05 26.650000000000002 26.0 25.3 96-97 22.525000000000002 25.5625 26.775 25.137500000000003 98-99 24.1625 28.225 23.8875 23.724999999999998 100-101 22.15 26.625 26.025 25.2 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.5 29 4.5 30 6.5 31 8.5 32 11.5 33 17.0 34 31.0 35 46.5 36 60.5 37 84.5 38 108.5 39 133.0 40 159.5 41 168.5 42 208.0 43 237.5 44 239.0 45 239.0 46 224.0 47 212.5 48 218.5 49 211.5 50 177.5 51 168.5 52 170.0 53 143.0 54 106.0 55 95.5 56 88.0 57 78.0 58 67.0 59 52.5 60 46.5 61 44.0 62 35.5 63 28.5 64 23.5 65 18.0 66 11.5 67 6.0 68 4.0 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.025 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.025 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610843 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610843_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.655 33.0 31.0 33.0 18.0 34.0 2 30.9025 33.0 31.0 33.0 25.0 34.0 3 30.6245 33.0 31.0 33.0 18.0 34.0 4 30.3575 33.0 31.0 33.0 15.0 34.0 5 30.56025 33.0 31.0 33.0 15.0 34.0 6 33.98575 38.0 34.0 38.0 16.0 38.0 7 34.51275 38.0 35.0 38.0 26.0 38.0 8 34.4285 38.0 34.0 38.0 26.0 38.0 9 34.1185 38.0 34.0 38.0 16.0 38.0 10-11 34.232625 38.0 34.0 38.0 16.0 38.0 12-13 34.204750000000004 38.0 34.0 38.0 16.0 38.0 14-15 34.321124999999995 38.0 34.5 38.0 21.0 38.0 16-17 34.374750000000006 38.0 34.5 38.0 25.0 38.0 18-19 34.304500000000004 38.0 34.5 38.0 20.0 38.0 20-21 34.067499999999995 38.0 34.0 38.0 16.0 38.0 22-23 34.392624999999995 38.0 34.5 38.0 24.5 38.0 24-25 34.471125 38.0 35.0 38.0 25.0 38.0 26-27 34.310375 38.0 34.0 38.0 20.5 38.0 28-29 34.4585 38.0 34.5 38.0 25.0 38.0 30-31 34.691874999999996 38.0 35.0 38.0 25.0 38.0 32-33 34.438 38.0 35.0 38.0 20.5 38.0 34-35 34.209875 38.0 34.5 38.0 20.5 38.0 36-37 34.347875 38.0 34.0 38.0 20.5 38.0 38-39 34.44375 38.0 34.5 38.0 25.0 38.0 40-41 34.582125 38.0 35.0 38.0 25.0 38.0 42-43 34.726 38.0 35.0 38.0 25.0 38.0 44-45 34.583124999999995 38.0 35.0 38.0 25.0 38.0 46-47 34.692625 38.0 35.5 38.0 25.0 38.0 48-49 34.6055 38.0 35.0 38.0 25.0 38.0 50-51 34.554 38.0 35.0 38.0 25.0 38.0 52-53 34.447625 38.0 35.0 38.0 24.5 38.0 54-55 34.48175 38.0 34.5 38.0 25.0 38.0 56-57 34.534625 38.0 35.0 38.0 24.5 38.0 58-59 34.449375 38.0 35.0 38.0 24.5 38.0 60-61 34.527875 38.0 35.0 38.0 25.0 38.0 62-63 34.4895 38.0 35.0 38.0 24.5 38.0 64-65 34.407624999999996 38.0 34.5 38.0 24.5 38.0 66-67 34.5275 38.0 35.0 38.0 25.0 38.0 68-69 34.541375 38.0 35.0 38.0 25.0 38.0 70-71 34.46325 38.0 35.0 38.0 24.5 38.0 72-73 34.55675 38.0 35.0 38.0 25.0 38.0 74-75 34.19925 38.0 34.0 38.0 20.0 38.0 76-77 34.44775 38.0 35.0 38.0 24.5 38.0 78-79 34.500875 38.0 35.0 38.0 24.5 38.0 80-81 34.383125 38.0 35.0 38.0 23.0 38.0 82-83 34.453375 38.0 35.0 38.0 23.5 38.0 84-85 34.45275 38.0 35.0 38.0 24.0 38.0 86-87 34.451875 38.0 35.0 38.0 23.0 38.0 88-89 34.386250000000004 38.0 35.0 38.0 23.0 38.0 90-91 34.320625 38.0 34.5 38.0 22.5 38.0 92-93 34.28675 38.0 34.5 38.0 19.0 38.0 94-95 34.149375000000006 38.0 34.5 38.0 22.0 38.0 96-97 25.78625 21.5 19.5 36.0 14.5 38.0 98-99 21.563125 20.5 19.0 22.5 14.0 28.5 100-101 28.82875 31.0 24.0 36.0 15.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 2.0 17 4.0 18 13.0 19 28.0 20 54.0 21 67.0 22 44.0 23 42.0 24 57.0 25 57.0 26 74.0 27 92.0 28 77.0 29 92.0 30 107.0 31 152.0 32 187.0 33 204.0 34 300.0 35 441.0 36 1294.0 37 610.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.707176794198553 14.653663415853963 15.803950987746937 40.835208802200555 2 25.575 22.25 34.5 17.675 3 22.75 24.474999999999998 27.85 24.925 4 28.000000000000004 29.975 20.275000000000002 21.75 5 27.556889222305575 32.40810202550637 21.030257564391096 19.004751187796952 6 22.025 34.9 22.575 20.5 7 21.349999999999998 18.35 37.075 23.225 8 24.349999999999998 22.875 26.400000000000002 26.375 9 23.35 23.35 28.125 25.174999999999997 10-11 26.05 29.4125 21.2875 23.25 12-13 26.2625 23.1 25.9625 24.675 14-15 24.85 26.1625 26.075 22.912499999999998 16-17 26.674999999999997 25.2375 24.5 23.5875 18-19 24.4125 26.224999999999998 25.6 23.7625 20-21 26.4125 25.3 25.924999999999997 22.3625 22-23 25.650000000000002 26.637499999999996 25.0 22.7125 24-25 24.837500000000002 26.575 25.35 23.2375 26-27 26.174999999999997 26.125 25.5375 22.162499999999998 28-29 25.0 26.650000000000002 26.025 22.325 30-31 25.087500000000002 25.7125 25.9625 23.2375 32-33 24.9375 27.224999999999998 25.35 22.4875 34-35 24.85 26.3125 26.0 22.8375 36-37 25.6125 26.5625 25.775 22.05 38-39 25.55 25.724999999999998 25.2875 23.4375 40-41 25.412499999999998 25.7625 25.137500000000003 23.6875 42-43 25.0 26.4625 25.387500000000003 23.150000000000002 44-45 24.8125 26.8375 26.0125 22.3375 46-47 25.3125 26.35 25.0125 23.325000000000003 48-49 24.349999999999998 26.8375 25.95 22.8625 50-51 24.5125 26.7125 26.637499999999996 22.1375 52-53 25.974999999999998 25.162499999999998 26.450000000000003 22.412499999999998 54-55 24.9875 25.374999999999996 26.3625 23.275000000000002 56-57 25.924999999999997 26.325 25.874999999999996 21.875 58-59 25.2125 26.400000000000002 26.187500000000004 22.2 60-61 25.7375 26.275 25.937500000000004 22.05 62-63 26.400000000000002 26.337500000000002 25.6 21.6625 64-65 25.7625 26.2125 26.087500000000002 21.9375 66-67 24.925 26.174999999999997 26.55 22.35 68-69 25.575 26.3 26.0125 22.112499999999997 70-71 25.2125 26.7125 25.924999999999997 22.15 72-73 25.224999999999998 25.275 26.787499999999998 22.7125 74-75 25.6125 25.6125 26.687499999999996 22.0875 76-77 24.7875 25.9625 27.0125 22.237499999999997 78-79 24.587500000000002 25.900000000000002 26.887499999999996 22.625 80-81 25.162499999999998 26.2125 26.5 22.125 82-83 25.112499999999997 25.874999999999996 27.250000000000004 21.762500000000003 84-85 24.9375 26.424999999999997 26.25 22.3875 86-87 25.2625 27.0875 25.837500000000002 21.8125 88-89 24.975 26.650000000000002 26.1 22.275 90-91 25.387500000000003 26.700000000000003 26.1 21.8125 92-93 25.337500000000002 25.837500000000002 27.200000000000003 21.625 94-95 25.662499999999998 27.200000000000003 25.525 21.6125 96-97 25.825 25.162499999999998 26.437500000000004 22.575 98-99 24.275 28.9375 24.5375 22.25 100-101 25.137500000000003 26.4625 26.900000000000002 21.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 1.5 28 1.5 29 3.5 30 5.5 31 4.0 32 4.5 33 11.0 34 15.0 35 24.0 36 38.5 37 55.5 38 70.5 39 89.0 40 124.0 41 159.5 42 200.5 43 217.5 44 227.5 45 238.5 46 225.0 47 210.5 48 208.0 49 221.5 50 214.5 51 185.0 52 165.0 53 146.0 54 123.5 55 116.0 56 111.0 57 97.5 58 86.0 59 73.5 60 64.5 61 56.5 62 44.5 63 41.0 64 36.5 65 24.0 66 14.5 67 12.0 68 10.5 69 9.0 70 4.5 71 0.0 72 0.0 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCAGCT 15 0.009957196 47.5 90-91 >>END_MODULE Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203667 spots for ERR10610843.sra Written 1203667 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra Read 1203654 spots for ERR10610843.sra Written 1203654 spots for ERR10610843.sra SRR ids: ['ERR10610843.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jx35x31j ERR10610843.sra spots: 24073093 blocks: [[1, 1203654], [1203655, 2407308], [2407309, 3610962], [3610963, 4814616], [4814617, 6018270], [6018271, 7221924], [7221925, 8425578], [8425579, 9629232], [9629233, 10832886], [10832887, 12036540], [12036541, 13240194], [13240195, 14443848], [14443849, 15647502], [15647503, 16851156], [16851157, 18054810], [18054811, 19258464], [19258465, 20462118], [20462119, 21665772], [21665773, 22869426], [22869427, 24073093]] ERR10610843 file size 5808501 ERR10610843 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610843 ERR10610843_1.fastq ERR10610843_2.fastq Input file: ERR10610843_1.fastq Paired file: ERR10610843_2.fastq trimmed: ERR10610843-trimmed-pair1.fastq, ERR10610843-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 20:54:43 2024 >> started Fri Dec 6 20:55:11 2024 >> done (28.220s) 24073093 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 2470 ( 0.01%) empty read pairs filtered out after trimming by size control 24070565 (99.99%) read pairs available; of these: 616157 ( 2.56%) trimmed read pairs available after processing 23454408 (97.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 8 0.00% 29 7 0.00% 30 1 0.00% 31 8 0.00% 32 10 0.00% 33 11 0.00% 34 11 0.00% 35 10 0.00% 36 24 0.00% 37 29 0.00% 38 42 0.00% 39 42 0.00% 40 52 0.00% 41 64 0.00% 42 72 0.00% 43 78 0.00% 44 85 0.00% 45 83 0.00% 46 108 0.00% 47 142 0.00% 48 169 0.00% 49 168 0.00% 50 199 0.00% 51 257 0.00% 52 253 0.00% 53 300 0.00% 54 302 0.00% 55 359 0.00% 56 372 0.00% 57 434 0.00% 58 526 0.00% 59 636 0.00% 60 669 0.00% 61 746 0.00% 62 826 0.00% 63 987 0.00% 64 1106 0.00% 65 1245 0.01% 66 1430 0.01% 67 1568 0.01% 68 1717 0.01% 69 1982 0.01% 70 2292 0.01% 71 2623 0.01% 72 2908 0.01% 73 3391 0.01% 74 3702 0.02% 75 4334 0.02% 76 4849 0.02% 77 5346 0.02% 78 6183 0.03% 79 6853 0.03% 80 7648 0.03% 81 8628 0.04% 82 9990 0.04% 83 11085 0.05% 84 12116 0.05% 85 13534 0.06% 86 15129 0.06% 87 16941 0.07% 88 18900 0.08% 89 21098 0.09% 90 23118 0.10% 91 25775 0.11% 92 28633 0.12% 93 30450 0.13% 94 33737 0.14% 95 37136 0.15% 96 40217 0.17% 97 44896 0.19% 98 48178 0.20% 99 52306 0.22% 100 57011 0.24% 101 23454408 97.44% 24070565 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=28 prefix-density=0.11 prefix-fanout=2.6 sequence=CATATATCGATC criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=291.58 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=29.5 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=14.18 fanout-score-rank=8 prefix-density=0.28 prefix-fanout=8.4 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=16 fanout-score=166.74 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=20.8 sequence=GAAGAAGAAGAAA ERR10610843 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 20:56:13 Started mapping on | Dec 06 20:56:14 Finished on | Dec 06 21:01:08 Mapping speed, Million of reads per hour | 294.74 Number of input reads | 24070565 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 21455168 Uniquely mapped reads % | 89.13% Average mapped length | 200.28 Number of splices: Total | 12995338 Number of splices: Annotated (sjdb) | 12159228 Number of splices: GT/AG | 12814525 Number of splices: GC/AG | 157273 Number of splices: AT/AC | 6377 Number of splices: Non-canonical | 17163 Mismatch rate per base, % | 0.76% Deletion rate per base | 0.02% Deletion average length | 2.38 Insertion rate per base | 0.01% Insertion average length | 1.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 289740 % of reads mapped to multiple loci | 1.20% Number of reads mapped to too many loci | 13140 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.20% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2325657 2325657 2325657 N_multimapping 289740 289740 289740 N_noFeature 704056 20792845 835982 N_ambiguous 603244 2248 74274 UnstrandedReadsAssigned:20147868 PositiveStrandReadsAssigned:660075 NegativeStrandReadsAssigned:20544912 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610843 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610843-trimmed-pair1.fastq ERR10610843-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,070,565 reads, 21,025,009 reads pseudoaligned [quant] estimated average fragment length: 176.765 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,161 rounds 52973 ERR10610843.ke.tsv 35125 ERR10610843.se.tsv 88098 total ==> ERR10610843.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.393 0 0 PNS24247 1044 868.235 83.7001 6.76296 PNS24249 1928 1752.24 5.72328 0.22914 PNS24246 1044 868.235 83.7001 6.76296 PNS24248 1044 868.235 83.7001 6.76296 PNS24244 1471 1295.24 250.176 13.5502 PNS24243 293 125.735 0 0 KQK14069 1603 1427.24 2618 128.683 KQK14071 474 299.78 120.534 28.2067 ==> ERR10610843.se.tsv <== BRADI_1g14170v3 3423 BRADI_1g53295v3 161 BRADI_1g59795v3 793 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 440 BRADI_1g74790v3 219 BRADI_1g09890v3 0 BRADI_1g77505v3 528 BRADI_1g48960v3 0 ERR10610843 completed mapping pipeline successfully