Starting /dee2/code/volunteer_pipeline.sh ERR10610844 current disk space = 1549247655936 free memory = 1599391456 ERR10610844 SRAfilesize 15303ba509f844000cc7b1630c64ec7e ERR10610844.sra ERR10610844.sra file validated ERR10610844 is paired end ERR10610844 is conventional basespace ERR10610844 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610844_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.7675 33.0 30.0 33.0 18.0 33.0 2 30.594 33.0 31.0 33.0 25.0 33.0 3 30.72 33.0 31.0 33.0 25.0 34.0 4 30.2655 33.0 30.0 33.0 25.0 34.0 5 31.05525 33.0 32.0 33.0 27.0 34.0 6 33.70075 37.0 33.0 38.0 16.0 38.0 7 34.30525 38.0 34.0 38.0 26.0 38.0 8 34.46 38.0 34.0 38.0 26.0 38.0 9 34.62375 38.0 35.0 38.0 26.0 38.0 10-11 34.6155 38.0 35.0 38.0 26.0 38.0 12-13 34.541875000000005 38.0 35.0 38.0 26.0 38.0 14-15 34.66825 38.0 35.0 38.0 26.0 38.0 16-17 34.5585 38.0 34.5 38.0 25.0 38.0 18-19 34.54225 38.0 35.0 38.0 26.0 38.0 20-21 24.0025 22.0 21.5 28.5 15.0 33.5 22-23 32.269625 35.5 30.5 37.0 20.5 37.5 24-25 34.281125 38.0 34.0 38.0 25.0 38.0 26-27 34.5105 38.0 35.0 38.0 25.0 38.0 28-29 34.6205 38.0 35.0 38.0 25.0 38.0 30-31 34.789 38.0 36.0 38.0 25.0 38.0 32-33 34.7295 38.0 35.5 38.0 25.0 38.0 34-35 34.712 38.0 35.0 38.0 26.0 38.0 36-37 34.639375 38.0 35.0 38.0 25.0 38.0 38-39 34.72 38.0 35.5 38.0 25.0 38.0 40-41 34.8855 38.0 35.5 38.0 26.0 38.0 42-43 34.570750000000004 38.0 35.0 38.0 25.0 38.0 44-45 34.557500000000005 38.0 35.0 38.0 25.0 38.0 46-47 34.859375 38.0 35.5 38.0 26.0 38.0 48-49 27.32575 27.0 25.5 31.5 19.5 36.0 50-51 29.64825 31.0 27.5 33.0 16.0 37.0 52-53 33.713750000000005 37.5 33.5 38.0 24.5 38.0 54-55 27.397 27.0 25.0 32.5 19.5 37.0 56-57 29.543625 31.0 27.5 33.0 16.0 37.5 58-59 33.6715 37.0 33.5 38.0 24.5 38.0 60-61 34.548875 38.0 34.5 38.0 25.0 38.0 62-63 34.814375 38.0 35.5 38.0 26.0 38.0 64-65 34.747625 38.0 35.0 38.0 26.0 38.0 66-67 34.690625 38.0 35.0 38.0 25.0 38.0 68-69 34.785 38.0 35.5 38.0 25.0 38.0 70-71 34.81725 38.0 35.0 38.0 26.0 38.0 72-73 24.207875 22.0 21.0 28.0 15.0 37.0 74-75 31.871000000000002 33.5 30.0 37.0 20.0 38.0 76-77 34.14575 37.5 34.0 38.0 24.0 38.0 78-79 34.604625 38.0 34.5 38.0 25.0 38.0 80-81 34.8155 38.0 35.5 38.0 26.0 38.0 82-83 34.826125000000005 38.0 35.5 38.0 25.0 38.0 84-85 34.73887499999999 38.0 35.5 38.0 25.5 38.0 86-87 34.7275 38.0 35.5 38.0 25.0 38.0 88-89 34.812125 38.0 35.5 38.0 26.0 38.0 90-91 34.638000000000005 38.0 35.0 38.0 25.0 38.0 92-93 34.6525 38.0 35.0 38.0 25.0 38.0 94-95 33.339749999999995 37.0 31.5 38.0 19.0 38.0 96-97 34.189875 38.0 34.0 38.0 23.0 38.0 98-99 25.728250000000003 26.5 24.5 26.5 18.5 32.5 100-101 27.08775 27.5 25.0 31.5 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 11.0 19 25.0 20 28.0 21 34.0 22 58.0 23 64.0 24 68.0 25 69.0 26 93.0 27 77.0 28 123.0 29 119.0 30 126.0 31 184.0 32 220.0 33 308.0 34 515.0 35 1236.0 36 575.0 37 67.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.88294651866801 10.242179616548942 10.418768920282542 53.4561049445005 2 21.6 19.225 35.975 23.200000000000003 3 25.624999999999996 19.8 21.875 32.7 4 26.674999999999997 29.5 19.900000000000002 23.925 5 24.025 33.75 23.925 18.3 6 19.400000000000002 34.55 27.0 19.05 7 14.378594648662165 22.95573893473368 42.98574643660915 19.679919979995 8 19.650000000000002 22.7 32.300000000000004 25.35 9 20.025000000000002 22.125 33.15 24.7 10-11 21.315164395549445 32.704088011001375 22.777847230903863 23.202900362545318 12-13 21.215151893986747 25.328166020752597 27.340917614701837 26.115764470558823 14-15 20.64266066516629 27.91947986996749 27.219304826206553 24.218554638659665 16-17 21.192798199549888 27.04426106526632 26.819204801200303 24.943735933983497 18-19 21.405351337834457 27.11927981995499 26.38159539884971 25.09377344336084 20-21 20.05752157058897 32.824809303488806 22.10829060897837 25.009378516943855 22-23 21.392848212053014 26.85671417854464 26.744186046511626 25.006251562890725 24-25 21.380345086271568 27.74443610902726 26.294073518379594 24.58114528632158 26-27 20.549999999999997 27.275 26.2875 25.887500000000003 28-29 22.42780347543443 26.990873859232405 25.66570821352669 24.915614451806476 30-31 21.099999999999998 27.1375 26.575 25.1875 32-33 21.5625 26.85 26.474999999999998 25.112499999999997 34-35 21.65 27.400000000000002 26.450000000000003 24.5 36-37 21.94024253031629 27.803475434429302 25.678209776222026 24.57807225903238 38-39 21.637500000000003 27.3875 26.525 24.45 40-41 22.162499999999998 27.175 25.95 24.712500000000002 42-43 21.140142517814727 27.403425428178522 25.490686335791974 25.965745718214777 44-45 20.3875 27.0875 27.037499999999998 25.4875 46-47 21.1125 27.0125 26.987499999999997 24.887500000000003 48-49 23.4625 27.5125 24.625 24.4 50-51 21.85 27.1 26.05 25.0 52-53 21.5625 27.700000000000003 26.224999999999998 24.5125 54-55 21.325 29.15 24.6875 24.837500000000002 56-57 21.224999999999998 26.6625 26.237500000000004 25.874999999999996 58-59 21.987499999999997 25.3 27.925 24.7875 60-61 21.95 27.1625 25.7625 25.124999999999996 62-63 21.2875 26.8375 26.325 25.55 64-65 22.425 27.187499999999996 25.974999999999998 24.4125 66-67 21.2375 27.437499999999996 26.487500000000004 24.837500000000002 68-69 22.2125 26.375 26.487500000000004 24.925 70-71 22.15 26.187500000000004 26.275 25.387500000000003 72-73 22.475 30.6875 23.5125 23.325000000000003 74-75 22.6375 25.650000000000002 26.25 25.4625 76-77 21.525 27.05 26.575 24.85 78-79 21.9375 26.85 26.05 25.162499999999998 80-81 21.975 27.1375 25.724999999999998 25.162499999999998 82-83 21.7 27.5625 25.7125 25.025 84-85 23.400000000000002 25.75 26.2625 24.587500000000002 86-87 21.9375 27.037499999999998 25.874999999999996 25.15 88-89 23.377922240280036 26.428303537942245 25.203150393799223 24.990623827978496 90-91 22.287499999999998 26.5375 26.0375 25.137500000000003 92-93 22.62782847855982 26.878359794974372 26.67833479184898 23.81547693461683 94-95 23.5375 27.1375 25.1 24.224999999999998 96-97 22.412499999999998 26.5375 25.9875 25.0625 98-99 24.15 27.3875 24.575 23.8875 100-101 22.237499999999997 27.0 26.174999999999997 24.587500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 1.0 29 2.5 30 3.5 31 5.0 32 9.0 33 19.5 34 24.0 35 30.0 36 50.5 37 70.5 38 101.0 39 132.5 40 157.5 41 185.0 42 198.0 43 211.5 44 232.5 45 228.0 46 227.5 47 243.5 48 241.5 49 222.5 50 201.0 51 176.0 52 155.0 53 149.0 54 125.0 55 102.0 56 91.5 57 76.5 58 61.0 59 57.0 60 53.0 61 44.0 62 34.5 63 22.0 64 19.0 65 16.5 66 9.5 67 3.5 68 2.5 69 2.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.0 9 0.0 10-11 0.0125 12-13 0.0125 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.0375 22-23 0.025 24-25 0.025 26-27 0.0 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0125 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 100.0 #Duplication Level Percentage of deduplicated Percentage of total 1 100.0 100.0 2 0.0 0.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610844 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610844_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.287 33.0 31.0 33.0 18.0 34.0 2 30.54625 33.0 31.0 33.0 18.0 34.0 3 30.31825 33.0 29.0 33.0 18.0 34.0 4 29.965 33.0 31.0 33.0 15.0 34.0 5 30.282 33.0 31.0 33.0 15.0 34.0 6 33.31 38.0 32.0 38.0 16.0 38.0 7 33.937 38.0 34.0 38.0 16.0 38.0 8 33.81375 38.0 34.0 38.0 16.0 38.0 9 34.0215 38.0 34.0 38.0 16.0 38.0 10-11 33.819625 38.0 33.0 38.0 16.0 38.0 12-13 33.688625 38.0 33.0 38.0 16.0 38.0 14-15 33.783625 38.0 33.5 38.0 16.0 38.0 16-17 33.888999999999996 38.0 34.0 38.0 16.0 38.0 18-19 33.828625 38.0 33.5 38.0 16.0 38.0 20-21 33.548874999999995 38.0 33.0 38.0 16.0 38.0 22-23 33.740875 38.0 33.0 38.0 16.0 38.0 24-25 33.924875 38.0 34.0 38.0 16.0 38.0 26-27 33.7935 38.0 34.0 38.0 16.0 38.0 28-29 33.710499999999996 38.0 33.5 38.0 16.0 38.0 30-31 33.960625 38.0 34.0 38.0 16.0 38.0 32-33 33.936625 38.0 34.0 38.0 16.0 38.0 34-35 33.572374999999994 38.0 33.5 38.0 16.0 38.0 36-37 33.6765 38.0 33.0 38.0 16.0 38.0 38-39 33.8635 38.0 34.0 38.0 16.0 38.0 40-41 33.899 38.0 34.0 38.0 16.0 38.0 42-43 34.12175 38.0 34.0 38.0 16.0 38.0 44-45 33.985749999999996 38.0 34.0 38.0 16.0 38.0 46-47 34.168 38.0 34.0 38.0 20.0 38.0 48-49 33.98350000000001 38.0 34.0 38.0 16.0 38.0 50-51 33.950125 38.0 34.0 38.0 16.0 38.0 52-53 33.908375 38.0 33.5 38.0 16.0 38.0 54-55 33.831125 38.0 33.5 38.0 16.0 38.0 56-57 33.863875 38.0 33.5 38.0 16.0 38.0 58-59 33.854749999999996 38.0 34.0 38.0 16.0 38.0 60-61 33.860375000000005 38.0 33.5 38.0 16.0 38.0 62-63 33.843 38.0 33.5 38.0 16.0 38.0 64-65 33.865875 38.0 34.0 38.0 16.0 38.0 66-67 33.912625000000006 38.0 34.0 38.0 16.0 38.0 68-69 33.930125000000004 38.0 34.0 38.0 16.0 38.0 70-71 33.8775 38.0 34.0 38.0 16.0 38.0 72-73 33.8695 38.0 34.0 38.0 16.0 38.0 74-75 33.668125 38.0 33.5 38.0 16.0 38.0 76-77 33.762125 38.0 33.5 38.0 16.0 38.0 78-79 33.7465 38.0 34.0 38.0 16.0 38.0 80-81 33.76325 38.0 34.0 38.0 16.0 38.0 82-83 33.839875 38.0 34.0 38.0 16.0 38.0 84-85 33.83925 38.0 34.0 38.0 16.0 38.0 86-87 33.822875 38.0 34.0 38.0 16.0 38.0 88-89 33.840999999999994 38.0 34.0 38.0 16.0 38.0 90-91 33.809 38.0 34.0 38.0 15.5 38.0 92-93 33.7765 38.0 34.0 38.0 15.0 38.0 94-95 33.56725 38.0 33.5 38.0 15.0 38.0 96-97 25.64225 21.5 19.0 36.0 14.5 38.0 98-99 21.52375 20.5 19.0 22.5 14.0 29.5 100-101 28.21675 30.5 23.0 35.5 15.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 8.0 18 23.0 19 34.0 20 52.0 21 64.0 22 65.0 23 71.0 24 81.0 25 95.0 26 91.0 27 91.0 28 101.0 29 125.0 30 124.0 31 157.0 32 164.0 33 211.0 34 279.0 35 410.0 36 1202.0 37 551.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.5 15.049999999999999 15.7 39.75 2 27.975 21.4 33.425 17.2 3 23.425 25.224999999999998 25.874999999999996 25.474999999999998 4 26.325 32.300000000000004 19.725 21.65 5 27.7569392348087 32.358089522380595 21.630407601900476 18.254563640910227 6 22.900000000000002 35.65 21.075 20.375 7 20.325 16.625 40.45 22.6 8 23.3 20.674999999999997 27.35 28.675 9 23.125 22.075 29.475 25.324999999999996 10-11 25.7 28.962500000000002 22.0875 23.25 12-13 26.174999999999997 23.400000000000002 25.5125 24.9125 14-15 25.5125 26.787499999999998 25.2125 22.4875 16-17 26.900000000000002 25.0375 25.3 22.7625 18-19 25.912499999999998 25.95 25.3 22.8375 20-21 24.9125 26.1125 25.2375 23.7375 22-23 25.6125 25.624999999999996 25.4625 23.3 24-25 25.7625 25.775 25.637500000000003 22.825 26-27 24.6 26.150000000000002 25.9875 23.2625 28-29 25.337500000000002 25.7125 26.0625 22.8875 30-31 24.887500000000003 26.150000000000002 25.637500000000003 23.325000000000003 32-33 25.174999999999997 27.1 25.4625 22.2625 34-35 25.35 26.85 25.424999999999997 22.375 36-37 25.0 26.0625 25.35 23.5875 38-39 25.124999999999996 26.9125 26.0 21.9625 40-41 24.925 26.087500000000002 25.95 23.0375 42-43 24.9125 25.575 25.324999999999996 24.1875 44-45 25.837500000000002 26.825 24.775 22.5625 46-47 25.2125 26.787499999999998 25.124999999999996 22.875 48-49 24.4 26.174999999999997 25.7 23.724999999999998 50-51 25.275 26.400000000000002 25.7875 22.537499999999998 52-53 25.874999999999996 25.7 26.387500000000003 22.037499999999998 54-55 25.025 26.450000000000003 26.0375 22.4875 56-57 25.124999999999996 26.125 25.9625 22.787499999999998 58-59 25.5125 25.85 26.5875 22.05 60-61 25.337500000000002 25.637500000000003 25.4625 23.5625 62-63 24.962500000000002 25.6125 27.0125 22.412499999999998 64-65 25.900000000000002 26.237500000000004 25.974999999999998 21.8875 66-67 25.2125 26.687499999999996 25.75 22.35 68-69 25.650000000000002 26.825 25.575 21.95 70-71 25.724999999999998 25.8 26.3 22.175 72-73 25.2 27.1625 25.724999999999998 21.912499999999998 74-75 25.374999999999996 27.1625 25.7875 21.675 76-77 24.8 26.337500000000002 26.075 22.787499999999998 78-79 24.275 26.25 26.200000000000003 23.275000000000002 80-81 25.5125 25.924999999999997 26.2125 22.35 82-83 25.7375 26.474999999999998 25.7625 22.025 84-85 24.6625 26.5375 26.674999999999997 22.125 86-87 24.4875 26.3625 27.1 22.05 88-89 25.45 26.1625 25.825 22.5625 90-91 24.5 26.525 26.150000000000002 22.825 92-93 25.0125 26.375 26.5625 22.05 94-95 24.6875 27.1 26.275 21.9375 96-97 25.75 25.124999999999996 26.5875 22.537499999999998 98-99 23.799999999999997 29.2 24.337500000000002 22.662499999999998 100-101 25.25 26.174999999999997 26.700000000000003 21.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 0.5 30 1.0 31 4.0 32 6.0 33 8.0 34 20.5 35 26.5 36 32.0 37 49.5 38 73.0 39 99.5 40 124.5 41 165.0 42 179.5 43 201.0 44 224.5 45 227.5 46 232.0 47 223.5 48 237.0 49 221.0 50 190.5 51 175.0 52 156.5 53 159.5 54 158.5 55 131.0 56 106.5 57 94.5 58 79.0 59 79.0 60 68.5 61 58.0 62 54.0 63 35.0 64 29.5 65 22.0 66 12.5 67 9.0 68 8.5 69 8.0 70 3.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.40221216691804923 0.8 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.025138260432378077 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTACGTCCTGGTGTAGATCTC 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249737 spots for ERR10610844.sra Written 1249737 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra Read 1249730 spots for ERR10610844.sra Written 1249730 spots for ERR10610844.sra SRR ids: ['ERR10610844.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_73vw3zmw ERR10610844.sra spots: 24994607 blocks: [[1, 1249730], [1249731, 2499460], [2499461, 3749190], [3749191, 4998920], [4998921, 6248650], [6248651, 7498380], [7498381, 8748110], [8748111, 9997840], [9997841, 11247570], [11247571, 12497300], [12497301, 13747030], [13747031, 14996760], [14996761, 16246490], [16246491, 17496220], [17496221, 18745950], [18745951, 19995680], [19995681, 21245410], [21245411, 22495140], [22495141, 23744870], [23744871, 24994607]] ERR10610844 file size 6031681 ERR10610844 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610844 ERR10610844_1.fastq ERR10610844_2.fastq Input file: ERR10610844_1.fastq Paired file: ERR10610844_2.fastq trimmed: ERR10610844-trimmed-pair1.fastq, ERR10610844-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:00:40 2024 >> started Fri Dec 6 21:01:03 2024 >> done (22.508s) 24994607 read pairs processed; of these: 81 ( 0.00%) short read pairs filtered out after trimming by size control 4847 ( 0.02%) empty read pairs filtered out after trimming by size control 24989679 (99.98%) read pairs available; of these: 658267 ( 2.63%) trimmed read pairs available after processing 24331412 (97.37%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 0 0.00% 21 0 0.00% 22 3 0.00% 23 0 0.00% 24 3 0.00% 25 2 0.00% 26 2 0.00% 27 4 0.00% 28 6 0.00% 29 6 0.00% 30 7 0.00% 31 15 0.00% 32 12 0.00% 33 11 0.00% 34 11 0.00% 35 31 0.00% 36 27 0.00% 37 33 0.00% 38 35 0.00% 39 53 0.00% 40 60 0.00% 41 76 0.00% 42 83 0.00% 43 99 0.00% 44 88 0.00% 45 107 0.00% 46 139 0.00% 47 133 0.00% 48 178 0.00% 49 199 0.00% 50 224 0.00% 51 267 0.00% 52 285 0.00% 53 341 0.00% 54 405 0.00% 55 335 0.00% 56 444 0.00% 57 451 0.00% 58 553 0.00% 59 631 0.00% 60 726 0.00% 61 802 0.00% 62 880 0.00% 63 1083 0.00% 64 1231 0.00% 65 1368 0.01% 66 1434 0.01% 67 1670 0.01% 68 1872 0.01% 69 2156 0.01% 70 2400 0.01% 71 2731 0.01% 72 3083 0.01% 73 3527 0.01% 74 4115 0.02% 75 4608 0.02% 76 5219 0.02% 77 5916 0.02% 78 6706 0.03% 79 7568 0.03% 80 8165 0.03% 81 9219 0.04% 82 10439 0.04% 83 11665 0.05% 84 13275 0.05% 85 14798 0.06% 86 16563 0.07% 87 18326 0.07% 88 20478 0.08% 89 22336 0.09% 90 24662 0.10% 91 27476 0.11% 92 30045 0.12% 93 32531 0.13% 94 36006 0.14% 95 39485 0.16% 96 43037 0.17% 97 47420 0.19% 98 51623 0.21% 99 55868 0.22% 100 60394 0.24% 101 24331412 97.37% 24989679 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=12.36 fanout-score-rank=10 prefix-density=0.23 prefix-fanout=5.9 sequence=CTCCAGCTCCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=8 fanout-score=256.25 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=28.6 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=2.0 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=223.85 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=25.8 sequence=CAAGAAGAAGATC ERR10610844 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:01:50 Started mapping on | Dec 06 21:01:50 Finished on | Dec 06 21:05:52 Mapping speed, Million of reads per hour | 371.75 Number of input reads | 24989679 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 22867805 Uniquely mapped reads % | 91.51% Average mapped length | 200.18 Number of splices: Total | 13945737 Number of splices: Annotated (sjdb) | 13053133 Number of splices: GT/AG | 13754076 Number of splices: GC/AG | 165893 Number of splices: AT/AC | 7168 Number of splices: Non-canonical | 18600 Mismatch rate per base, % | 0.80% Deletion rate per base | 0.02% Deletion average length | 2.35 Insertion rate per base | 0.01% Insertion average length | 1.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 460224 % of reads mapped to multiple loci | 1.84% Number of reads mapped to too many loci | 24337 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.63% % of reads unmapped: other | 0.92% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1661650 1661650 1661650 N_multimapping 460224 460224 460224 N_noFeature 813080 22163201 966520 N_ambiguous 626613 2580 79101 UnstrandedReadsAssigned:21428112 PositiveStrandReadsAssigned:702024 NegativeStrandReadsAssigned:21822184 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610844 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610844-trimmed-pair1.fastq ERR10610844-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,989,679 reads, 22,381,791 reads pseudoaligned [quant] estimated average fragment length: 176.548 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52973 ERR10610844.ke.tsv 35125 ERR10610844.se.tsv 88098 total ==> ERR10610844.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.593 0 0 PNS24247 1044 868.452 85.9537 6.48928 PNS24249 1928 1752.45 16.2659 0.608568 PNS24246 1044 868.452 85.9537 6.48928 PNS24248 1044 868.452 85.9537 6.48928 PNS24244 1471 1295.45 237.873 12.0393 PNS24243 293 126.009 0 0 KQK14069 1603 1427.45 2471.35 113.514 KQK14071 474 299.938 157.903 34.5173 ==> ERR10610844.se.tsv <== BRADI_1g14170v3 3537 BRADI_1g53295v3 262 BRADI_1g59795v3 1086 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 690 BRADI_1g74790v3 106 BRADI_1g09890v3 0 BRADI_1g77505v3 551 BRADI_1g48960v3 0 ERR10610844 completed mapping pipeline successfully