Starting /dee2/code/volunteer_pipeline.sh ERR10610845 current disk space = 1549234675712 free memory = 1603513836 ERR10610845 SRAfilesize 8d1a51c3508705138d3bf39d26dd6457 ERR10610845.sra ERR10610845.sra file validated ERR10610845 is paired end ERR10610845 is conventional basespace ERR10610845 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610845_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.813 32.0 18.0 33.0 18.0 33.0 2 29.50275 32.0 27.0 33.0 18.0 33.0 3 30.82075 33.0 31.0 33.0 25.0 33.0 4 30.533 33.0 31.0 33.0 25.0 34.0 5 31.13475 33.0 32.0 33.0 27.0 34.0 6 33.82275 37.0 33.0 38.0 16.0 38.0 7 34.4865 38.0 34.0 38.0 26.0 38.0 8 34.403 38.0 34.0 38.0 26.0 38.0 9 34.87725 38.0 35.0 38.0 26.0 38.0 10-11 34.6905 38.0 35.0 38.0 26.0 38.0 12-13 34.509 38.0 34.5 38.0 26.0 38.0 14-15 34.559124999999995 38.0 35.0 38.0 26.0 38.0 16-17 34.638999999999996 38.0 35.0 38.0 26.0 38.0 18-19 34.65275 38.0 35.0 38.0 26.0 38.0 20-21 24.053625 22.0 21.5 28.5 15.0 33.5 22-23 32.2645 35.5 30.5 37.0 20.5 37.5 24-25 34.208749999999995 38.0 34.0 38.0 20.5 38.0 26-27 34.637 38.0 35.0 38.0 25.0 38.0 28-29 34.624125 38.0 35.0 38.0 25.0 38.0 30-31 34.798375 38.0 35.5 38.0 25.0 38.0 32-33 34.799375 38.0 36.0 38.0 25.0 38.0 34-35 34.696875000000006 38.0 35.0 38.0 25.0 38.0 36-37 34.653875 38.0 35.0 38.0 25.0 38.0 38-39 34.794 38.0 35.0 38.0 26.0 38.0 40-41 34.80925 38.0 35.0 38.0 25.0 38.0 42-43 34.616125 38.0 35.0 38.0 25.0 38.0 44-45 34.57575 38.0 35.0 38.0 25.0 38.0 46-47 34.74125 38.0 35.0 38.0 25.0 38.0 48-49 27.405875 27.0 25.5 31.5 19.5 36.0 50-51 29.698124999999997 31.0 27.5 33.5 16.0 37.5 52-53 33.568 37.5 33.0 38.0 16.0 38.0 54-55 27.26025 27.0 25.0 31.5 19.0 37.0 56-57 29.51875 31.0 27.5 33.0 16.0 37.5 58-59 33.70125 37.0 32.5 38.0 24.5 38.0 60-61 34.58925 38.0 35.0 38.0 25.0 38.0 62-63 34.73475 38.0 35.5 38.0 25.0 38.0 64-65 34.7245 38.0 35.0 38.0 25.0 38.0 66-67 34.877750000000006 38.0 36.0 38.0 25.0 38.0 68-69 34.878625 38.0 35.5 38.0 26.0 38.0 70-71 34.765125 38.0 35.0 38.0 26.0 38.0 72-73 24.208125000000003 22.0 21.0 28.5 15.0 37.0 74-75 31.76475 33.5 29.0 37.0 20.0 38.0 76-77 34.2415 37.5 34.0 38.0 25.0 38.0 78-79 34.4125 38.0 35.0 38.0 24.0 38.0 80-81 34.62525 38.0 35.0 38.0 25.0 38.0 82-83 34.729625 38.0 35.0 38.0 25.0 38.0 84-85 34.896875 38.0 35.5 38.0 27.0 38.0 86-87 34.679500000000004 38.0 35.0 38.0 25.0 38.0 88-89 34.668625000000006 38.0 35.0 38.0 25.0 38.0 90-91 34.489000000000004 38.0 35.0 38.0 24.0 38.0 92-93 34.5685 38.0 35.0 38.0 25.0 38.0 94-95 33.205375000000004 37.0 31.0 38.0 19.0 38.0 96-97 34.126625000000004 38.0 34.5 38.0 22.0 38.0 98-99 25.853 26.5 24.5 26.5 18.5 32.5 100-101 27.045125 27.5 25.0 31.5 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 13.0 19 21.0 20 39.0 21 35.0 22 39.0 23 57.0 24 73.0 25 80.0 26 90.0 27 104.0 28 106.0 29 123.0 30 164.0 31 171.0 32 196.0 33 293.0 34 489.0 35 1306.0 36 533.0 37 68.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.131159969673995 10.487743239828152 11.245893353550668 45.13520343694718 2 22.225 15.299999999999999 38.9 23.575 3 21.9 21.375 24.099999999999998 32.625 4 24.375 28.625 20.875 26.125 5 24.05 31.825 24.875 19.25 6 18.925 34.449999999999996 26.400000000000002 20.225 7 14.249999999999998 23.0 43.45 19.3 8 20.65 20.95 30.85 27.55 9 19.625 20.974999999999998 35.449999999999996 23.95 10-11 22.3875 30.6375 22.825 24.15 12-13 21.2375 24.0125 28.8375 25.912499999999998 14-15 20.825 26.887499999999996 28.075 24.212500000000002 16-17 22.5 26.3 27.237499999999997 23.962500000000002 18-19 21.512500000000003 26.8625 26.3 25.324999999999996 20-21 21.1125 31.587500000000002 21.087500000000002 26.2125 22-23 21.837500000000002 27.187499999999996 25.9875 24.9875 24-25 22.575 26.325 25.9875 25.112499999999997 26-27 21.25 26.5625 27.212500000000002 24.975 28-29 22.325 26.125 26.1 25.45 30-31 21.6 26.924999999999997 27.1 24.375 32-33 21.2875 25.9875 27.8375 24.887500000000003 34-35 21.825 26.487500000000004 26.237500000000004 25.45 36-37 21.462500000000002 26.5375 26.6 25.4 38-39 21.5 26.575 27.0625 24.8625 40-41 22.3375 25.224999999999998 26.987499999999997 25.45 42-43 21.875 25.924999999999997 27.650000000000002 24.55 44-45 20.849999999999998 26.700000000000003 27.0 25.45 46-47 21.762500000000003 26.35 26.525 25.362499999999997 48-49 24.05 26.224999999999998 25.074999999999996 24.65 50-51 22.162499999999998 25.974999999999998 26.174999999999997 25.687500000000004 52-53 22.575 26.55 24.9875 25.887500000000003 54-55 20.925 29.6375 24.125 25.3125 56-57 21.775 26.775 26.900000000000002 24.55 58-59 22.112499999999997 26.575 26.5 24.8125 60-61 22.1 26.387500000000003 26.75 24.762500000000003 62-63 22.412499999999998 26.887499999999996 26.2125 24.4875 64-65 21.762500000000003 26.737499999999997 26.8375 24.6625 66-67 22.162499999999998 26.700000000000003 26.025 25.112499999999997 68-69 22.662499999999998 26.237500000000004 26.6 24.5 70-71 22.175 26.5 26.35 24.975 72-73 22.525000000000002 29.599999999999998 24.4125 23.4625 74-75 22.650000000000002 27.025 26.224999999999998 24.099999999999998 76-77 21.775 26.437500000000004 26.8375 24.95 78-79 21.587500000000002 27.037499999999998 25.650000000000002 25.724999999999998 80-81 21.85 26.974999999999998 26.3125 24.8625 82-83 21.8625 26.6 26.625 24.9125 84-85 22.375 25.874999999999996 25.624999999999996 26.125 86-87 22.5625 26.4125 26.025 25.0 88-89 21.85 25.9875 26.687499999999996 25.474999999999998 90-91 22.112499999999997 25.374999999999996 26.8625 25.650000000000002 92-93 22.95 26.325 26.0375 24.6875 94-95 22.537499999999998 26.237500000000004 25.887500000000003 25.337500000000002 96-97 21.675 26.937499999999996 25.7625 25.624999999999996 98-99 24.775 27.462500000000002 23.5625 24.2 100-101 22.75 26.625 26.187500000000004 24.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 0.5 28 1.0 29 2.0 30 3.0 31 5.5 32 8.5 33 14.0 34 15.0 35 32.5 36 56.0 37 67.5 38 86.0 39 112.0 40 145.0 41 179.0 42 204.0 43 223.5 44 236.5 45 240.0 46 233.0 47 216.5 48 214.0 49 210.0 50 189.0 51 184.5 52 178.5 53 156.0 54 130.5 55 119.0 56 104.5 57 84.0 58 74.0 59 60.0 60 50.5 61 43.5 62 34.5 63 27.5 64 22.5 65 14.0 66 8.5 67 5.0 68 5.0 69 3.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.475 0.0 0.0 0.0 0.0 86-87 0.5875 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610845 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610845_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.2735 33.0 31.0 33.0 18.0 34.0 2 30.45275 33.0 31.0 33.0 18.0 34.0 3 30.2475 33.0 29.0 33.0 18.0 34.0 4 30.10075 33.0 31.0 33.0 15.0 34.0 5 30.42875 33.0 31.0 33.0 15.0 34.0 6 33.42075 38.0 33.0 38.0 16.0 38.0 7 33.92925 38.0 34.0 38.0 16.0 38.0 8 33.944 38.0 34.0 38.0 16.0 38.0 9 33.74975 38.0 33.0 38.0 16.0 38.0 10-11 33.756249999999994 38.0 33.5 38.0 16.0 38.0 12-13 33.811875 38.0 34.0 38.0 16.0 38.0 14-15 33.773375 38.0 33.5 38.0 16.0 38.0 16-17 33.95725 38.0 34.0 38.0 16.0 38.0 18-19 33.717 38.0 33.5 38.0 16.0 38.0 20-21 33.66 38.0 33.5 38.0 16.0 38.0 22-23 33.958749999999995 38.0 34.0 38.0 16.0 38.0 24-25 33.934124999999995 38.0 34.0 38.0 16.0 38.0 26-27 33.775625000000005 38.0 33.5 38.0 16.0 38.0 28-29 33.980625 38.0 34.0 38.0 16.0 38.0 30-31 34.191125 38.0 34.0 38.0 20.0 38.0 32-33 34.024125 38.0 34.0 38.0 20.0 38.0 34-35 33.716375 38.0 33.5 38.0 16.0 38.0 36-37 33.849625 38.0 34.0 38.0 16.0 38.0 38-39 33.7595 38.0 33.5 38.0 16.0 38.0 40-41 33.9715 38.0 34.0 38.0 16.0 38.0 42-43 34.252750000000006 38.0 34.0 38.0 20.5 38.0 44-45 33.957875 38.0 34.0 38.0 16.0 38.0 46-47 34.091875 38.0 34.0 38.0 20.0 38.0 48-49 34.116125 38.0 34.0 38.0 16.0 38.0 50-51 33.955 38.0 34.0 38.0 16.0 38.0 52-53 33.836 38.0 34.0 38.0 16.0 38.0 54-55 33.961 38.0 34.0 38.0 16.0 38.0 56-57 33.8565 38.0 34.0 38.0 16.0 38.0 58-59 34.043625000000006 38.0 34.0 38.0 16.0 38.0 60-61 33.945125000000004 38.0 34.0 38.0 16.0 38.0 62-63 34.029624999999996 38.0 34.0 38.0 16.0 38.0 64-65 33.963625 38.0 34.0 38.0 16.0 38.0 66-67 33.913375 38.0 34.0 38.0 16.0 38.0 68-69 33.881625 38.0 34.0 38.0 16.0 38.0 70-71 33.95525 38.0 34.0 38.0 16.0 38.0 72-73 33.98625 38.0 34.0 38.0 16.0 38.0 74-75 33.65025 38.0 34.0 38.0 16.0 38.0 76-77 33.889250000000004 38.0 34.0 38.0 16.0 38.0 78-79 33.955375000000004 38.0 34.0 38.0 16.0 38.0 80-81 33.7295 38.0 33.5 38.0 16.0 38.0 82-83 33.798874999999995 38.0 34.0 38.0 16.0 38.0 84-85 33.89175 38.0 34.0 38.0 16.0 38.0 86-87 33.78075 38.0 34.0 38.0 16.0 38.0 88-89 33.701625 38.0 34.0 38.0 16.0 38.0 90-91 33.637375 38.0 34.0 38.0 15.5 38.0 92-93 33.589 38.0 33.5 38.0 15.0 38.0 94-95 33.56 38.0 34.0 38.0 15.0 38.0 96-97 25.60425 21.5 19.0 36.0 14.5 38.0 98-99 21.531625 20.5 19.0 25.0 14.0 29.0 100-101 28.277250000000002 29.5 23.0 35.0 15.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 5.0 17 6.0 18 21.0 19 32.0 20 47.0 21 50.0 22 62.0 23 74.0 24 81.0 25 99.0 26 93.0 27 102.0 28 126.0 29 107.0 30 122.0 31 148.0 32 170.0 33 197.0 34 280.0 35 438.0 36 1177.0 37 563.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.225 15.35 14.45 39.975 2 27.575 21.325 32.824999999999996 18.275 3 22.475 24.55 27.700000000000003 25.275 4 25.874999999999996 31.75 19.15 23.225 5 27.425 34.25 20.925 17.4 6 22.525000000000002 35.6 21.275 20.599999999999998 7 20.025000000000002 17.9 39.6 22.475 8 23.5 21.775 27.650000000000002 27.075 9 22.325 22.45 28.95 26.275 10-11 25.637500000000003 29.562500000000004 21.475 23.325000000000003 12-13 25.224999999999998 23.4875 26.2875 25.0 14-15 25.324999999999996 25.7625 26.025 22.8875 16-17 25.874999999999996 25.6 25.2375 23.2875 18-19 25.275 26.5 24.712500000000002 23.5125 20-21 25.7875 25.85 25.8 22.5625 22-23 25.624999999999996 26.0625 25.6125 22.7 24-25 25.5375 26.0625 25.25 23.150000000000002 26-27 25.224999999999998 26.687499999999996 25.662499999999998 22.425 28-29 25.2875 25.687500000000004 26.05 22.975 30-31 25.35 26.450000000000003 24.95 23.25 32-33 25.887500000000003 26.387500000000003 25.5125 22.2125 34-35 25.174999999999997 26.387500000000003 24.75 23.6875 36-37 25.35 26.1125 25.8125 22.725 38-39 25.074999999999996 26.7125 24.675 23.5375 40-41 24.9 25.8625 25.8125 23.425 42-43 25.3125 27.037499999999998 25.337500000000002 22.3125 44-45 26.0125 26.400000000000002 25.25 22.3375 46-47 25.374999999999996 26.087500000000002 25.8 22.7375 48-49 25.1875 26.35 26.2875 22.175 50-51 24.887500000000003 26.637499999999996 26.150000000000002 22.325 52-53 26.3625 25.9625 24.5 23.175 54-55 25.55 25.8125 25.887500000000003 22.75 56-57 24.85 26.6625 25.7875 22.7 58-59 25.224999999999998 25.775 26.3125 22.6875 60-61 25.324999999999996 25.424999999999997 26.2875 22.9625 62-63 25.7875 26.5 25.874999999999996 21.837500000000002 64-65 24.9125 25.7125 26.4625 22.912499999999998 66-67 25.5 25.362499999999997 26.25 22.8875 68-69 24.9875 26.55 26.25 22.2125 70-71 25.25 26.1125 25.912499999999998 22.725 72-73 25.2875 25.55 26.1 23.0625 74-75 25.0125 27.1625 26.025 21.8 76-77 24.975 26.637499999999996 26.187500000000004 22.2 78-79 25.4625 26.337500000000002 26.6125 21.587500000000002 80-81 24.762500000000003 26.5375 26.275 22.425 82-83 25.174999999999997 25.6125 26.3625 22.85 84-85 25.2375 26.6 26.474999999999998 21.6875 86-87 24.9 26.125 25.912499999999998 23.0625 88-89 24.975 25.650000000000002 26.174999999999997 23.200000000000003 90-91 24.525 26.187500000000004 26.2875 23.0 92-93 25.5375 26.85 25.5625 22.05 94-95 25.587500000000002 26.737499999999997 25.7 21.975 96-97 26.137500000000003 26.125 25.224999999999998 22.5125 98-99 24.825 28.349999999999998 24.3125 22.5125 100-101 25.424999999999997 26.3625 25.775 22.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.5 29 1.0 30 1.0 31 3.5 32 6.5 33 12.0 34 20.0 35 23.5 36 42.0 37 55.0 38 58.5 39 81.0 40 114.0 41 152.5 42 175.0 43 204.5 44 228.0 45 224.0 46 234.0 47 243.0 48 220.5 49 198.5 50 200.5 51 189.5 52 174.5 53 162.0 54 149.0 55 137.0 56 122.5 57 110.5 58 96.0 59 81.5 60 62.5 61 51.0 62 44.0 63 36.0 64 28.5 65 19.5 66 13.0 67 9.5 68 6.5 69 2.5 70 0.5 71 1.0 72 0.5 73 0.0 74 0.5 75 1.0 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241505 spots for ERR10610845.sra Written 1241505 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra Read 1241502 spots for ERR10610845.sra Written 1241502 spots for ERR10610845.sra SRR ids: ['ERR10610845.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gidz8b6_ ERR10610845.sra spots: 24830043 blocks: [[1, 1241502], [1241503, 2483004], [2483005, 3724506], [3724507, 4966008], [4966009, 6207510], [6207511, 7449012], [7449013, 8690514], [8690515, 9932016], [9932017, 11173518], [11173519, 12415020], [12415021, 13656522], [13656523, 14898024], [14898025, 16139526], [16139527, 17381028], [17381029, 18622530], [18622531, 19864032], [19864033, 21105534], [21105535, 22347036], [22347037, 23588538], [23588539, 24830043]] ERR10610845 file size 5991825 ERR10610845 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610845 ERR10610845_1.fastq ERR10610845_2.fastq Input file: ERR10610845_1.fastq Paired file: ERR10610845_2.fastq trimmed: ERR10610845-trimmed-pair1.fastq, ERR10610845-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:01:25 2024 >> started Fri Dec 6 21:01:58 2024 >> done (32.160s) 24830043 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 5057 ( 0.02%) empty read pairs filtered out after trimming by size control 24824888 (99.98%) read pairs available; of these: 745904 ( 3.00%) trimmed read pairs available after processing 24078984 (97.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 0 0.00% 21 3 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 5 0.00% 26 1 0.00% 27 7 0.00% 28 9 0.00% 29 13 0.00% 30 15 0.00% 31 15 0.00% 32 16 0.00% 33 15 0.00% 34 23 0.00% 35 32 0.00% 36 36 0.00% 37 69 0.00% 38 62 0.00% 39 82 0.00% 40 84 0.00% 41 94 0.00% 42 93 0.00% 43 116 0.00% 44 123 0.00% 45 125 0.00% 46 170 0.00% 47 174 0.00% 48 220 0.00% 49 258 0.00% 50 267 0.00% 51 327 0.00% 52 378 0.00% 53 439 0.00% 54 479 0.00% 55 501 0.00% 56 539 0.00% 57 622 0.00% 58 702 0.00% 59 840 0.00% 60 927 0.00% 61 1023 0.00% 62 1144 0.00% 63 1257 0.01% 64 1503 0.01% 65 1707 0.01% 66 1761 0.01% 67 2081 0.01% 68 2277 0.01% 69 2646 0.01% 70 2862 0.01% 71 3180 0.01% 72 3645 0.01% 73 4300 0.02% 74 4670 0.02% 75 5503 0.02% 76 6182 0.02% 77 6908 0.03% 78 7646 0.03% 79 8767 0.04% 80 9683 0.04% 81 10535 0.04% 82 12298 0.05% 83 13531 0.05% 84 15140 0.06% 85 17046 0.07% 86 18711 0.08% 87 20518 0.08% 88 23504 0.09% 89 25588 0.10% 90 28011 0.11% 91 31016 0.12% 92 33860 0.14% 93 36878 0.15% 94 40879 0.16% 95 44451 0.18% 96 47546 0.19% 97 53315 0.21% 98 57617 0.23% 99 61775 0.25% 100 67054 0.27% 101 24078984 97.00% 24824888 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=17 prefix-density=0.25 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=64.21 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.0 sequence=ATCATCATCATCCCCGCACCCCATCAACTGCTACGTACGGATGAACTAATTAACACACGCATGCATGCAAATATACGATGCTTAATTAATTAACACCGATCGATCCCCATTAAAACCAAACCACATCGATCAGACGTCGAAGGTGTTCTTGCCGGTG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=24 prefix-density=0.27 prefix-fanout=2.4 sequence=CCTAAGCAAGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=64.51 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=3.9 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC ERR10610845 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:02:45 Started mapping on | Dec 06 21:02:45 Finished on | Dec 06 21:06:46 Mapping speed, Million of reads per hour | 370.83 Number of input reads | 24824888 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 22223384 Uniquely mapped reads % | 89.52% Average mapped length | 199.95 Number of splices: Total | 15274632 Number of splices: Annotated (sjdb) | 14317752 Number of splices: GT/AG | 15040925 Number of splices: GC/AG | 186180 Number of splices: AT/AC | 6510 Number of splices: Non-canonical | 41017 Mismatch rate per base, % | 0.88% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 703599 % of reads mapped to multiple loci | 2.83% Number of reads mapped to too many loci | 35130 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.26% % of reads unmapped: other | 1.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1897905 1897905 1897905 N_multimapping 703599 703599 703599 N_noFeature 883782 21637092 1009802 N_ambiguous 539110 2566 79936 UnstrandedReadsAssigned:20800492 PositiveStrandReadsAssigned:583726 NegativeStrandReadsAssigned:21133646 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610845 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610845-trimmed-pair1.fastq ERR10610845-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,824,888 reads, 21,718,471 reads pseudoaligned [quant] estimated average fragment length: 177.254 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,191 rounds 52973 ERR10610845.ke.tsv 35125 ERR10610845.se.tsv 88098 total ==> ERR10610845.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 759.874 0 0 PNS24247 1044 867.746 85.6229 7.072 PNS24249 1928 1751.75 39.9205 1.63331 PNS24246 1044 867.746 85.6229 7.072 PNS24248 1044 867.746 85.6229 7.072 PNS24244 1471 1294.75 115.211 6.37756 PNS24243 293 126.777 0 0 KQK14069 1603 1426.75 1841.27 92.4946 KQK14071 474 299.265 31.4264 7.52634 ==> ERR10610845.se.tsv <== BRADI_1g14170v3 2059 BRADI_1g53295v3 716 BRADI_1g59795v3 411 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 453 BRADI_1g74790v3 151 BRADI_1g09890v3 0 BRADI_1g77505v3 599 BRADI_1g48960v3 0 ERR10610845 completed mapping pipeline successfully