Starting /dee2/code/volunteer_pipeline.sh ERR10610846 current disk space = 1549183954944 free memory = 1413430424 ERR10610846 SRAfilesize e750fa4d1544abe2917b262ef190b0df ERR10610846.sra ERR10610846.sra file validated ERR10610846 is paired end ERR10610846 is conventional basespace ERR10610846 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610846_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.6445 32.0 27.0 33.0 18.0 33.0 2 30.299 32.0 30.0 33.0 18.0 33.0 3 30.61875 33.0 31.0 33.0 18.0 34.0 4 30.57625 33.0 31.0 33.0 25.0 34.0 5 30.661 33.0 32.0 33.0 25.0 34.0 6 32.88625 37.0 31.0 38.0 16.0 38.0 7 33.42625 37.0 32.0 38.0 16.0 38.0 8 32.93125 37.0 31.0 38.0 16.0 38.0 9 33.29675 38.0 31.0 38.0 16.0 38.0 10-11 33.52 38.0 33.0 38.0 16.0 38.0 12-13 33.7215 38.0 33.5 38.0 16.0 38.0 14-15 33.602875 38.0 33.0 38.0 16.0 38.0 16-17 33.636250000000004 38.0 33.0 38.0 16.0 38.0 18-19 33.675749999999994 38.0 33.0 38.0 16.0 38.0 20-21 33.702625 38.0 33.5 38.0 16.0 38.0 22-23 33.735875 38.0 33.5 38.0 16.0 38.0 24-25 33.27775 38.0 32.0 38.0 16.0 38.0 26-27 33.703875 38.0 33.5 38.0 16.0 38.0 28-29 33.888000000000005 38.0 33.5 38.0 16.0 38.0 30-31 33.8695 38.0 34.0 38.0 16.0 38.0 32-33 33.87975 38.0 34.0 38.0 16.0 38.0 34-35 33.877125 38.0 34.0 38.0 16.0 38.0 36-37 33.801249999999996 38.0 33.5 38.0 16.0 38.0 38-39 34.028875 38.0 34.0 38.0 16.0 38.0 40-41 33.770624999999995 38.0 33.5 38.0 16.0 38.0 42-43 33.814750000000004 38.0 33.5 38.0 16.0 38.0 44-45 33.96275 38.0 34.0 38.0 16.0 38.0 46-47 33.77375 38.0 33.5 38.0 16.0 38.0 48-49 33.903125 38.0 34.0 38.0 16.0 38.0 50-51 33.675375 38.0 33.5 38.0 16.0 38.0 52-53 33.755875 38.0 33.5 38.0 16.0 38.0 54-55 33.851 38.0 33.5 38.0 16.0 38.0 56-57 33.977125 38.0 34.0 38.0 16.0 38.0 58-59 33.617625000000004 38.0 33.0 38.0 16.0 38.0 60-61 33.745000000000005 38.0 33.5 38.0 16.0 38.0 62-63 33.669375 38.0 33.0 38.0 16.0 38.0 64-65 33.803375 38.0 33.5 38.0 16.0 38.0 66-67 33.7685 38.0 34.0 38.0 16.0 38.0 68-69 33.733374999999995 38.0 33.5 38.0 16.0 38.0 70-71 33.752375 38.0 34.0 38.0 16.0 38.0 72-73 33.404875000000004 38.0 33.0 38.0 16.0 38.0 74-75 33.658875 38.0 33.5 38.0 16.0 38.0 76-77 33.491 38.0 33.5 38.0 15.5 38.0 78-79 33.59325 38.0 33.0 38.0 16.0 38.0 80-81 33.756 38.0 33.5 38.0 15.5 38.0 82-83 33.410624999999996 38.0 33.0 38.0 15.0 38.0 84-85 33.673375 38.0 34.0 38.0 15.5 38.0 86-87 33.369 38.0 33.0 38.0 15.5 38.0 88-89 33.125375000000005 38.0 32.5 38.0 15.0 38.0 90-91 33.351625 38.0 33.0 38.0 15.0 38.0 92-93 33.252624999999995 38.0 33.0 38.0 15.0 38.0 94-95 33.343500000000006 38.0 33.0 38.0 15.0 38.0 96-97 33.449875 38.0 33.0 38.0 15.0 38.0 98-99 32.837875 37.0 31.0 38.0 15.0 38.0 100-101 32.004374999999996 36.0 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 9.0 18 20.0 19 32.0 20 50.0 21 53.0 22 62.0 23 53.0 24 80.0 25 70.0 26 89.0 27 111.0 28 119.0 29 120.0 30 129.0 31 159.0 32 205.0 33 196.0 34 272.0 35 347.0 36 611.0 37 1213.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.174703357737947 9.845998485231004 12.269628881595557 49.709669275435495 2 19.775000000000002 17.625 37.25 25.35 3 21.9 18.9 24.8 34.4 4 25.624999999999996 28.7 21.375 24.3 5 24.175 31.900000000000002 25.525 18.4 6 19.75 34.1 26.125 20.025000000000002 7 15.532766383191596 20.76038019009505 43.77188594297149 19.93496748374187 8 19.834917458729365 20.58529264632316 33.26663331665833 26.313156578289142 9 18.384192096048025 21.1855927963982 35.217608804402204 25.212606303151574 10-11 22.14857428714357 30.590295147573787 23.12406203101551 24.137068534267133 12-13 21.298149074537267 23.386693346673336 28.8144072036018 26.500750375187593 14-15 21.02692548528491 25.17219787100814 27.764558547276142 26.03631809643081 16-17 22.283425137706562 25.0 27.466199298948425 25.250375563345017 18-19 22.0360180090045 26.088044022011005 26.96348174087044 24.912456228114056 20-21 21.85546386596649 25.906476619154787 26.78169542385596 25.456364091022753 22-23 21.66791697924481 26.281570392598148 26.906726681670417 25.143785946486624 24-25 21.010505252626313 26.225612806403202 27.651325662831418 25.11255627813907 26-27 20.597798899449725 26.475737868934466 27.426213106553277 25.50025012506253 28-29 21.212500000000002 26.787499999999998 27.725 24.275 30-31 21.224999999999998 26.325 27.462500000000002 24.9875 32-33 21.355338834708675 26.79419854963741 26.881720430107524 24.968742185546386 34-35 22.0125 27.0 27.075 23.9125 36-37 21.0625 26.900000000000002 26.9625 25.074999999999996 38-39 21.54288572143036 25.51887971992998 27.819454863715933 25.11877969492373 40-41 21.8 26.375 26.700000000000003 25.124999999999996 42-43 22.375 25.924999999999997 26.75 24.95 44-45 21.7875 26.2125 25.912499999999998 26.087500000000002 46-47 21.8125 26.5 26.987499999999997 24.7 48-49 22.237499999999997 25.775 26.637499999999996 25.35 50-51 21.512500000000003 26.974999999999998 26.150000000000002 25.362499999999997 52-53 21.7875 25.887500000000003 26.787499999999998 25.5375 54-55 22.25 25.9875 26.787499999999998 24.975 56-57 21.425 26.025 26.637499999999996 25.912499999999998 58-59 21.85 26.325 26.5625 25.2625 60-61 21.75 25.650000000000002 27.325 25.275 62-63 22.825 25.924999999999997 25.825 25.424999999999997 64-65 22.075 25.9625 27.55 24.4125 66-67 22.0625 25.7 26.700000000000003 25.5375 68-69 21.8625 26.7625 26.5 24.875 70-71 22.7 26.487500000000004 26.437500000000004 24.375 72-73 22.2 25.4375 26.2875 26.075 74-75 21.5375 26.05 26.987499999999997 25.424999999999997 76-77 21.4375 26.150000000000002 26.924999999999997 25.4875 78-79 22.400000000000002 26.8375 25.887500000000003 24.875 80-81 21.3625 25.6125 27.5875 25.4375 82-83 22.55 26.137500000000003 26.6125 24.7 84-85 22.7 25.162499999999998 26.450000000000003 25.687500000000004 86-87 22.125 25.9875 26.7625 25.124999999999996 88-89 21.15 26.3625 26.724999999999998 25.7625 90-91 22.768192048012004 25.818954738684667 26.744186046511626 24.668667166791696 92-93 21.680420105026258 26.51912978244561 27.00675168792198 24.793698424606152 94-95 22.3625 25.424999999999997 27.187499999999996 25.025 96-97 22.175 26.487500000000004 26.0 25.337500000000002 98-99 22.3125 25.924999999999997 26.437500000000004 25.324999999999996 100-101 22.912499999999998 26.375 26.0125 24.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 2.5 29 2.5 30 4.0 31 5.0 32 7.0 33 15.0 34 31.5 35 49.5 36 56.0 37 60.5 38 86.5 39 121.5 40 156.0 41 180.5 42 193.0 43 222.0 44 242.5 45 246.5 46 235.0 47 209.0 48 198.0 49 185.5 50 182.0 51 183.5 52 156.5 53 130.0 54 111.5 55 102.0 56 110.0 57 101.5 58 84.5 59 79.5 60 62.5 61 46.0 62 37.5 63 31.0 64 22.5 65 11.5 66 12.0 67 10.0 68 5.5 69 3.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.05 8 0.05 9 0.05 10-11 0.05 12-13 0.05 14-15 0.1875 16-17 0.15 18-19 0.05 20-21 0.025 22-23 0.025 24-25 0.05 26-27 0.05 28-29 0.0 30-31 0.0 32-33 0.025 34-35 0.0 36-37 0.0 38-39 0.025 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.025 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.825 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93751581077662 97.775 2 0.9612952188211485 1.9 3 0.07589172780166961 0.22499999999999998 4 0.025297242600556536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.5375 0.0 0.0 0.0 0.0 84-85 0.6499999999999999 0.0 0.0 0.0 0.0 86-87 0.8125 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610846 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610846_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.06975 32.0 27.0 33.0 18.0 33.0 2 29.617 32.0 27.0 33.0 18.0 33.0 3 26.0845 28.0 18.0 33.0 18.0 33.0 4 28.083 32.0 27.0 33.0 15.0 33.0 5 29.0965 32.0 27.0 33.0 15.0 33.0 6 26.5975 29.0 16.0 37.0 15.0 38.0 7 29.87975 33.0 26.0 38.0 16.0 38.0 8 31.9275 36.0 29.0 38.0 16.0 38.0 9 32.19275 37.0 29.0 38.0 16.0 38.0 10-11 32.823 37.0 30.0 38.0 16.0 38.0 12-13 33.085875 38.0 31.0 38.0 16.0 38.0 14-15 33.255125 38.0 32.0 38.0 16.0 38.0 16-17 33.038375 38.0 30.0 38.0 16.0 38.0 18-19 32.944 38.0 31.0 38.0 16.0 38.0 20-21 32.929375 38.0 31.0 38.0 16.0 38.0 22-23 33.186375 38.0 31.0 38.0 16.0 38.0 24-25 32.755625 37.0 30.0 38.0 16.0 38.0 26-27 32.832875 37.5 30.0 38.0 16.0 38.0 28-29 31.1785 35.5 23.0 38.0 16.0 38.0 30-31 32.48825 37.0 28.5 38.0 16.0 38.0 32-33 33.030625 38.0 31.0 38.0 16.0 38.0 34-35 33.057249999999996 38.0 31.0 38.0 16.0 38.0 36-37 32.72625 37.5 31.0 38.0 16.0 38.0 38-39 32.979625 37.0 31.0 38.0 16.0 38.0 40-41 33.091375 38.0 31.0 38.0 16.0 38.0 42-43 32.955124999999995 38.0 31.0 38.0 16.0 38.0 44-45 33.348 38.0 33.0 38.0 16.0 38.0 46-47 33.099625 38.0 31.0 38.0 16.0 38.0 48-49 33.318625 38.0 33.0 38.0 16.0 38.0 50-51 33.350875 38.0 33.0 38.0 16.0 38.0 52-53 33.41975 38.0 32.0 38.0 16.0 38.0 54-55 33.1845 38.0 31.5 38.0 16.0 38.0 56-57 33.048625 38.0 31.5 38.0 16.0 38.0 58-59 33.235625 38.0 31.5 38.0 16.0 38.0 60-61 33.239374999999995 38.0 32.0 38.0 16.0 38.0 62-63 33.279250000000005 38.0 33.0 38.0 16.0 38.0 64-65 33.1965 38.0 32.0 38.0 16.0 38.0 66-67 33.055625 38.0 31.0 38.0 16.0 38.0 68-69 33.212875 38.0 32.0 38.0 16.0 38.0 70-71 33.096999999999994 38.0 31.0 38.0 16.0 38.0 72-73 33.123125 38.0 31.0 38.0 16.0 38.0 74-75 33.062 37.5 31.0 38.0 16.0 38.0 76-77 33.168875 38.0 32.5 38.0 16.0 38.0 78-79 32.568875000000006 37.5 29.5 38.0 15.5 38.0 80-81 32.57175 37.0 29.0 38.0 15.5 38.0 82-83 32.451625 37.0 29.0 38.0 15.0 38.0 84-85 32.96525 37.5 31.0 38.0 15.5 38.0 86-87 32.528999999999996 37.0 29.0 38.0 15.0 38.0 88-89 32.626000000000005 37.0 30.0 38.0 15.0 38.0 90-91 32.561125000000004 37.0 30.0 38.0 15.0 38.0 92-93 32.589124999999996 37.0 30.0 38.0 15.0 38.0 94-95 32.6265 37.0 30.5 38.0 15.0 38.0 96-97 32.529624999999996 37.0 30.0 38.0 15.0 38.0 98-99 32.503249999999994 37.0 30.0 38.0 15.0 38.0 100-101 30.7885 35.0 27.0 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 5.0 17 14.0 18 34.0 19 66.0 20 64.0 21 67.0 22 74.0 23 71.0 24 108.0 25 104.0 26 104.0 27 105.0 28 125.0 29 149.0 30 140.0 31 183.0 32 181.0 33 212.0 34 299.0 35 377.0 36 665.0 37 853.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.025000000000002 15.0 14.649999999999999 40.325 2 27.275 21.9 33.825 17.0 3 21.45 22.0 33.5 23.05 4 26.275 32.0 19.3 22.425 5 27.05 33.050000000000004 21.475 18.425 6 21.425 32.1 27.075 19.400000000000002 7 21.825 16.75 37.95 23.474999999999998 8 22.675 23.150000000000002 26.825 27.35 9 23.549999999999997 22.775000000000002 29.525000000000002 24.15 10-11 26.5 29.075 21.6 22.825 12-13 25.324999999999996 24.712500000000002 25.0625 24.9 14-15 25.15 26.075 26.5 22.275 16-17 26.1 25.924999999999997 25.424999999999997 22.55 18-19 26.125 26.474999999999998 24.825 22.575 20-21 25.4625 26.2125 26.075 22.25 22-23 25.95 26.237500000000004 25.4625 22.35 24-25 25.224999999999998 25.900000000000002 25.637500000000003 23.2375 26-27 26.1625 26.450000000000003 25.637500000000003 21.75 28-29 25.8625 25.8125 26.450000000000003 21.875 30-31 25.637500000000003 26.2125 25.387500000000003 22.7625 32-33 25.837500000000002 26.85 24.5 22.8125 34-35 25.25 26.474999999999998 25.912499999999998 22.3625 36-37 26.287432652549807 26.187194587144468 26.061897005387795 21.46347575491793 38-39 25.950475237618807 26.263131565782892 25.050025012506254 22.736368184092047 40-41 26.326326326326328 27.002002002002 24.41191191191191 22.25975975975976 42-43 24.767646320020095 26.72695302687767 25.68450138156242 22.820899271539812 44-45 25.237737737737735 25.863363363363362 26.05105105105105 22.84784784784785 46-47 26.183320811419986 25.6824442774856 25.732531930879038 22.401702980215376 48-49 24.537268634317158 26.013006503251624 26.40070035017509 23.04902451225613 50-51 25.924999999999997 26.674999999999997 25.7875 21.6125 52-53 24.65 26.5 26.087500000000002 22.7625 54-55 25.087500000000002 26.5375 26.637499999999996 21.7375 56-57 24.825 26.4625 25.75 22.9625 58-59 24.925 26.6125 25.5625 22.900000000000002 60-61 25.2 26.6 25.7375 22.4625 62-63 24.837500000000002 26.437500000000004 26.3 22.425 64-65 25.7125 26.4625 26.137500000000003 21.6875 66-67 24.2375 27.400000000000002 25.525 22.8375 68-69 24.8625 27.187499999999996 25.5 22.45 70-71 25.8625 26.275 25.5 22.3625 72-73 25.4875 26.224999999999998 26.6125 21.675 74-75 25.662499999999998 27.487499999999997 25.275 21.575 76-77 25.5125 26.75 25.674999999999997 22.0625 78-79 25.362499999999997 26.424999999999997 26.2625 21.95 80-81 25.5 27.500000000000004 25.374999999999996 21.625 82-83 24.875 26.125 27.0625 21.9375 84-85 25.374999999999996 26.8125 26.375 21.4375 86-87 25.275 26.7625 26.200000000000003 21.762500000000003 88-89 25.650000000000002 25.874999999999996 27.0875 21.3875 90-91 26.325 25.6125 25.924999999999997 22.1375 92-93 26.0 26.887499999999996 26.3 20.8125 94-95 25.35 27.075 25.5125 22.0625 96-97 25.2625 27.2625 25.95 21.525 98-99 26.2125 26.8 25.687500000000004 21.3 100-101 26.075 27.175 25.525 21.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.0 28 2.0 29 3.5 30 4.5 31 6.5 32 8.0 33 12.0 34 19.0 35 31.0 36 42.5 37 54.0 38 74.5 39 102.0 40 137.0 41 156.5 42 181.5 43 214.5 44 226.5 45 235.0 46 236.0 47 224.0 48 205.0 49 205.5 50 199.5 51 169.5 52 154.0 53 148.0 54 144.0 55 143.0 56 120.0 57 96.5 58 89.0 59 73.0 60 60.0 61 54.5 62 45.5 63 35.0 64 25.5 65 17.0 66 13.0 67 10.5 68 9.0 69 5.5 70 1.5 71 1.5 72 2.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.2375 38-39 0.05 40-41 0.1 42-43 0.475 44-45 0.1 46-47 0.17500000000000002 48-49 0.05 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.38749999999999996 0.0 0.0 0.0 0.0 80-81 0.45 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166461 spots for ERR10610846.sra Written 166461 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra Read 166447 spots for ERR10610846.sra Written 166447 spots for ERR10610846.sra SRR ids: ['ERR10610846.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vswr9qk_ ERR10610846.sra spots: 3328954 blocks: [[1, 166447], [166448, 332894], [332895, 499341], [499342, 665788], [665789, 832235], [832236, 998682], [998683, 1165129], [1165130, 1331576], [1331577, 1498023], [1498024, 1664470], [1664471, 1830917], [1830918, 1997364], [1997365, 2163811], [2163812, 2330258], [2330259, 2496705], [2496706, 2663152], [2663153, 2829599], [2829600, 2996046], [2996047, 3162493], [3162494, 3328954]] ERR10610846 file size 797560 ERR10610846 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610846 ERR10610846_1.fastq ERR10610846_2.fastq Input file: ERR10610846_1.fastq Paired file: ERR10610846_2.fastq trimmed: ERR10610846-trimmed-pair1.fastq, ERR10610846-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:01:25 2024 >> started Fri Dec 6 21:01:29 2024 >> done (3.220s) 3328954 read pairs processed; of these: 18 ( 0.00%) short read pairs filtered out after trimming by size control 238 ( 0.01%) empty read pairs filtered out after trimming by size control 3328698 (99.99%) read pairs available; of these: 124458 ( 3.74%) trimmed read pairs available after processing 3204240 (96.26%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 3 0.00% 29 0 0.00% 30 1 0.00% 31 0 0.00% 32 0 0.00% 33 4 0.00% 34 2 0.00% 35 3 0.00% 36 3 0.00% 37 3 0.00% 38 7 0.00% 39 10 0.00% 40 7 0.00% 41 13 0.00% 42 16 0.00% 43 12 0.00% 44 20 0.00% 45 16 0.00% 46 20 0.00% 47 26 0.00% 48 25 0.00% 49 31 0.00% 50 35 0.00% 51 44 0.00% 52 53 0.00% 53 60 0.00% 54 58 0.00% 55 81 0.00% 56 86 0.00% 57 100 0.00% 58 117 0.00% 59 127 0.00% 60 152 0.00% 61 159 0.00% 62 193 0.01% 63 197 0.01% 64 230 0.01% 65 269 0.01% 66 301 0.01% 67 323 0.01% 68 358 0.01% 69 419 0.01% 70 467 0.01% 71 518 0.02% 72 611 0.02% 73 667 0.02% 74 823 0.02% 75 936 0.03% 76 1063 0.03% 77 1217 0.04% 78 1323 0.04% 79 1493 0.04% 80 1686 0.05% 81 1834 0.06% 82 2060 0.06% 83 2400 0.07% 84 2484 0.07% 85 2883 0.09% 86 3204 0.10% 87 3559 0.11% 88 3915 0.12% 89 4316 0.13% 90 4692 0.14% 91 5265 0.16% 92 5691 0.17% 93 6171 0.19% 94 6864 0.21% 95 7330 0.22% 96 8031 0.24% 97 8850 0.27% 98 9518 0.29% 99 10216 0.31% 100 10783 0.32% 101 3204240 96.26% 3328698 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=17 prefix-density=0.18 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=19.85 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=3.0 sequence=ATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCATCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGTTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=21 prefix-density=0.22 prefix-fanout=2.4 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=30 fanout-score=178.65 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=25.1 sequence=CAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCTCAAGCTCGTGGGCGGCCACTACGACTTCGTCTCCGGCAAGTTCGACACATGGGAGCTCTAAGTCCTCTCATCCGGTTAACTCCTATACATACAACGTATACTTATACATACAGATATGGAGATGACCCTACAGATCGATCCATTGATGTGGATGCGATGCCATGGAGTATATGTACTCGCTATTTTCCAGTACTGCATGCCGGATGGCTCGATGTGAATTTGTAATAAGCAATAGAAGTTTCTACCATTTTCTGACGTGGGGTTGTACTTGTGATGCG ERR10610846 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:02:15 Started mapping on | Dec 06 21:02:16 Finished on | Dec 06 21:02:58 Mapping speed, Million of reads per hour | 285.32 Number of input reads | 3328698 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 2861497 Uniquely mapped reads % | 85.96% Average mapped length | 199.85 Number of splices: Total | 1968583 Number of splices: Annotated (sjdb) | 1850300 Number of splices: GT/AG | 1938389 Number of splices: GC/AG | 23788 Number of splices: AT/AC | 872 Number of splices: Non-canonical | 5534 Mismatch rate per base, % | 0.91% Deletion rate per base | 0.02% Deletion average length | 2.15 Insertion rate per base | 0.01% Insertion average length | 1.96 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 173070 % of reads mapped to multiple loci | 5.20% Number of reads mapped to too many loci | 8988 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.04% % of reads unmapped: other | 2.53% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 294131 294131 294131 N_multimapping 173070 173070 173070 N_noFeature 142549 2786370 159495 N_ambiguous 67781 323 9751 UnstrandedReadsAssigned:2651167 PositiveStrandReadsAssigned:74804 NegativeStrandReadsAssigned:2692251 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610846 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610846-trimmed-pair1.fastq ERR10610846-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,328,698 reads, 2,783,052 reads pseudoaligned [quant] estimated average fragment length: 172.39 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52973 ERR10610846.ke.tsv 35125 ERR10610846.se.tsv 88098 total ==> ERR10610846.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 764.776 0 0 PNS24247 1044 872.61 8.03127 5.17362 PNS24249 1928 1756.61 0 0 PNS24246 1044 872.61 8.03127 5.17362 PNS24248 1044 872.61 8.03127 5.17362 PNS24244 1471 1299.61 40.9062 17.6932 PNS24243 293 129.425 0 0 KQK14069 1603 1431.61 147.601 57.9555 KQK14071 474 303.916 0 0 ==> ERR10610846.se.tsv <== BRADI_1g14170v3 156 BRADI_1g53295v3 145 BRADI_1g59795v3 43 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 82 BRADI_1g74790v3 21 BRADI_1g09890v3 0 BRADI_1g77505v3 85 BRADI_1g48960v3 0 ERR10610846 completed mapping pipeline successfully