Starting /dee2/code/volunteer_pipeline.sh ERR10610847 current disk space = 1549183119360 free memory = 1443816320 ERR10610847 SRAfilesize 8454b2ed05ecf084e63d7678991d3b8b ERR10610847.sra ERR10610847.sra file validated ERR10610847 is paired end ERR10610847 is conventional basespace ERR10610847 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610847_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.476 18.0 18.0 28.0 18.0 32.0 2 28.16375 32.0 25.0 32.0 18.0 33.0 3 29.23 32.0 27.0 33.0 18.0 33.0 4 29.86675 32.0 30.0 33.0 15.0 33.0 5 30.41475 33.0 31.0 33.0 25.0 33.0 6 32.02325 36.0 29.0 38.0 16.0 38.0 7 31.961 36.0 29.0 38.0 16.0 38.0 8 32.031 36.0 29.0 38.0 16.0 38.0 9 32.60425 37.0 29.0 38.0 16.0 38.0 10-11 33.341125000000005 37.5 32.0 38.0 16.0 38.0 12-13 33.41875 38.0 32.5 38.0 16.0 38.0 14-15 33.322374999999994 38.0 32.0 38.0 16.0 38.0 16-17 33.344625 38.0 33.0 38.0 16.0 38.0 18-19 33.373999999999995 38.0 33.0 38.0 16.0 38.0 20-21 33.531 38.0 33.0 38.0 16.0 38.0 22-23 33.5075 38.0 33.0 38.0 16.0 38.0 24-25 33.14325 37.5 31.0 38.0 16.0 38.0 26-27 33.4375 38.0 32.0 38.0 16.0 38.0 28-29 33.608374999999995 38.0 33.5 38.0 16.0 38.0 30-31 33.6475 38.0 33.0 38.0 16.0 38.0 32-33 33.666875 38.0 33.0 38.0 16.0 38.0 34-35 33.7115 38.0 33.0 38.0 16.0 38.0 36-37 33.473375000000004 38.0 33.0 38.0 16.0 38.0 38-39 33.648875000000004 38.0 33.0 38.0 16.0 38.0 40-41 33.5555 38.0 33.0 38.0 16.0 38.0 42-43 33.6285 38.0 33.0 38.0 16.0 38.0 44-45 33.764875 38.0 34.0 38.0 16.0 38.0 46-47 33.562375 38.0 33.0 38.0 16.0 38.0 48-49 33.730000000000004 38.0 33.5 38.0 16.0 38.0 50-51 33.345124999999996 38.0 33.0 38.0 16.0 38.0 52-53 33.5595 38.0 33.5 38.0 16.0 38.0 54-55 33.496875 38.0 33.0 38.0 16.0 38.0 56-57 33.6055 38.0 33.0 38.0 16.0 38.0 58-59 33.431124999999994 38.0 33.0 38.0 16.0 38.0 60-61 33.414 38.0 33.0 38.0 16.0 38.0 62-63 33.444 38.0 32.0 38.0 16.0 38.0 64-65 33.665875 38.0 33.5 38.0 16.0 38.0 66-67 33.669875000000005 38.0 33.0 38.0 16.0 38.0 68-69 33.581125 38.0 33.0 38.0 16.0 38.0 70-71 33.626374999999996 38.0 33.0 38.0 16.0 38.0 72-73 33.190124999999995 38.0 31.0 38.0 16.0 38.0 74-75 33.600375 38.0 33.0 38.0 16.0 38.0 76-77 33.466750000000005 38.0 33.0 38.0 15.5 38.0 78-79 33.431 38.0 33.0 38.0 16.0 38.0 80-81 33.44625 38.0 33.0 38.0 15.5 38.0 82-83 33.217375000000004 38.0 32.0 38.0 15.0 38.0 84-85 33.345375000000004 38.0 33.0 38.0 15.5 38.0 86-87 33.097375 38.0 32.0 38.0 15.5 38.0 88-89 32.924375 37.5 31.0 38.0 15.0 38.0 90-91 33.350125000000006 38.0 33.0 38.0 15.0 38.0 92-93 32.906 38.0 31.0 38.0 15.0 38.0 94-95 33.023125 38.0 31.5 38.0 15.0 38.0 96-97 33.076499999999996 38.0 31.0 38.0 15.0 38.0 98-99 32.538624999999996 37.0 30.0 38.0 15.0 38.0 100-101 31.63825 36.0 28.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 8.0 18 8.0 19 49.0 20 54.0 21 66.0 22 55.0 23 73.0 24 71.0 25 90.0 26 105.0 27 103.0 28 133.0 29 127.0 30 160.0 31 144.0 32 198.0 33 236.0 34 300.0 35 352.0 36 688.0 37 980.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.546120798584788 12.838008592367956 9.097801364670206 50.51806924437705 2 20.225 15.049999999999999 42.425000000000004 22.3 3 21.475 20.674999999999997 23.375 34.475 4 27.625 27.125 20.825 24.425 5 25.825 31.275 23.599999999999998 19.3 6 19.950000000000003 33.475 26.075 20.5 7 16.954238559639908 22.73068267066767 41.01025256314079 19.30482620655164 8 19.684842421210604 22.386193096548272 30.490245122561284 27.43871935967984 9 19.42985746436609 21.80545136284071 33.20830207551888 25.55638909727432 10-11 22.83070767691923 30.732683170792697 23.843460865216304 22.593148287071767 12-13 21.930482620655166 24.81870467616904 27.26931732933233 25.98149537384346 14-15 21.26753507014028 26.089679358717433 27.89328657314629 24.749498997995993 16-17 21.84526790185278 26.22684026039059 27.315973960941413 24.611917876815223 18-19 21.677709713714215 26.390798849856235 26.653331666458307 25.278159769971246 20-21 21.715214401800225 26.52831603950494 27.403425428178522 24.353044130516317 22-23 22.0 26.8375 26.025 25.137500000000003 24-25 22.277784723090384 25.690711338917367 26.790848856107015 25.240655081885237 26-27 21.552694086760845 26.340792599074884 26.778347293411674 25.328166020752597 28-29 21.349999999999998 26.6625 26.224999999999998 25.7625 30-31 21.75 26.025 26.375 25.85 32-33 22.05 26.187500000000004 26.950000000000003 24.8125 34-35 21.8875 27.0625 26.2125 24.837500000000002 36-37 22.575 26.625 25.2375 25.5625 38-39 21.575 25.9875 26.8125 25.624999999999996 40-41 21.712500000000002 26.924999999999997 26.200000000000003 25.162499999999998 42-43 21.375 25.837500000000002 27.3375 25.45 44-45 21.462500000000002 26.3625 27.325 24.85 46-47 21.6 27.1625 26.2625 24.975 48-49 21.875 26.525 25.8125 25.7875 50-51 22.1 26.875 26.075 24.95 52-53 22.287499999999998 26.3125 26.424999999999997 24.975 54-55 22.400000000000002 26.4125 26.424999999999997 24.762500000000003 56-57 21.975 26.437500000000004 26.650000000000002 24.9375 58-59 22.975 26.1125 26.0125 24.9 60-61 22.5875 25.3 26.687499999999996 25.424999999999997 62-63 21.9625 26.8625 26.625 24.55 64-65 22.0 25.900000000000002 26.487500000000004 25.6125 66-67 21.4375 25.7375 26.674999999999997 26.150000000000002 68-69 21.987499999999997 25.387500000000003 26.325 26.3 70-71 22.825 26.325 26.1 24.75 72-73 22.025 26.450000000000003 26.5125 25.0125 74-75 22.375 26.0 26.687499999999996 24.9375 76-77 22.225 26.0375 26.237500000000004 25.5 78-79 22.45 25.937500000000004 25.7 25.912499999999998 80-81 22.1375 27.0 25.8625 25.0 82-83 22.875 26.087500000000002 26.05 24.9875 84-85 21.775 25.424999999999997 26.787499999999998 26.0125 86-87 22.5125 25.7375 26.4625 25.2875 88-89 22.5875 26.3125 26.1125 24.9875 90-91 22.15 26.437500000000004 25.974999999999998 25.4375 92-93 22.875 26.0 25.7 25.424999999999997 94-95 22.2 26.3 26.2625 25.2375 96-97 22.400000000000002 25.2625 26.4125 25.924999999999997 98-99 22.3125 26.4125 26.187500000000004 25.087500000000002 100-101 23.575 26.237500000000004 26.025 24.1625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 2.0 28 2.5 29 3.0 30 5.5 31 7.5 32 8.5 33 15.0 34 30.0 35 41.5 36 54.5 37 74.5 38 84.0 39 106.0 40 147.0 41 176.5 42 192.0 43 207.5 44 225.0 45 235.5 46 228.5 47 209.0 48 204.5 49 202.5 50 188.0 51 164.5 52 151.5 53 146.5 54 125.0 55 108.5 56 103.5 57 96.0 58 82.0 59 77.5 60 64.5 61 49.0 62 45.5 63 36.0 64 25.5 65 17.5 66 18.5 67 17.0 68 9.0 69 4.0 70 3.0 71 1.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.05 9 0.025 10-11 0.025 12-13 0.025 14-15 0.2 16-17 0.15 18-19 0.0125 20-21 0.0125 22-23 0.0 24-25 0.0125 26-27 0.0125 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21894683799447 98.45 2 0.781053162005543 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.9249999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610847 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610847_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.817 32.0 27.0 33.0 18.0 33.0 2 29.35 32.0 27.0 33.0 18.0 33.0 3 25.93875 28.0 18.0 33.0 18.0 33.0 4 27.85575 32.0 27.0 33.0 15.0 33.0 5 28.562 32.0 27.0 33.0 15.0 33.0 6 25.88275 28.0 16.0 37.0 14.0 38.0 7 29.56125 31.0 26.0 37.0 16.0 38.0 8 31.2325 36.0 28.0 38.0 16.0 38.0 9 31.88625 36.0 29.0 38.0 16.0 38.0 10-11 32.2945 37.0 29.0 38.0 16.0 38.0 12-13 32.574375 37.0 29.0 38.0 16.0 38.0 14-15 32.707625 37.0 29.5 38.0 16.0 38.0 16-17 32.51775 37.0 29.0 38.0 16.0 38.0 18-19 32.391875 37.0 29.0 38.0 16.0 38.0 20-21 32.309375 37.0 28.5 38.0 16.0 38.0 22-23 32.491875 37.0 29.0 38.0 16.0 38.0 24-25 32.03375 37.0 28.0 38.0 16.0 38.0 26-27 32.205 37.0 28.5 38.0 16.0 38.0 28-29 30.543374999999997 35.0 22.0 38.0 16.0 38.0 30-31 31.979875 36.5 28.0 38.0 16.0 38.0 32-33 32.5725 37.0 29.0 38.0 16.0 38.0 34-35 32.409375 37.0 29.0 38.0 16.0 38.0 36-37 32.098875 37.0 28.0 38.0 16.0 38.0 38-39 32.339749999999995 37.0 28.5 38.0 16.0 38.0 40-41 32.457750000000004 37.0 29.0 38.0 16.0 38.0 42-43 32.304875 37.0 29.0 38.0 16.0 38.0 44-45 32.738 37.0 29.5 38.0 16.0 38.0 46-47 32.460499999999996 37.0 29.0 38.0 16.0 38.0 48-49 32.605999999999995 37.0 29.0 38.0 16.0 38.0 50-51 32.818125 37.5 30.0 38.0 16.0 38.0 52-53 32.729124999999996 37.0 29.0 38.0 16.0 38.0 54-55 32.722625 37.0 29.0 38.0 16.0 38.0 56-57 32.462625 37.0 29.0 38.0 16.0 38.0 58-59 32.637249999999995 37.0 29.0 38.0 16.0 38.0 60-61 32.591 37.0 29.0 38.0 16.0 38.0 62-63 32.46375 37.0 29.0 38.0 16.0 38.0 64-65 32.432500000000005 37.0 29.0 38.0 16.0 38.0 66-67 32.458749999999995 37.0 29.0 38.0 16.0 38.0 68-69 32.539375 37.0 29.0 38.0 16.0 38.0 70-71 32.350375 37.0 29.0 38.0 16.0 38.0 72-73 32.35225 37.0 28.5 38.0 16.0 38.0 74-75 32.117625 37.0 28.5 38.0 16.0 38.0 76-77 32.318375 37.0 29.0 38.0 15.5 38.0 78-79 31.764375 36.5 28.0 38.0 15.0 38.0 80-81 31.668125 36.5 27.0 38.0 15.0 38.0 82-83 31.715375 37.0 27.5 38.0 15.0 38.0 84-85 32.142624999999995 37.0 29.0 38.0 15.0 38.0 86-87 31.8385 37.0 28.0 38.0 15.0 38.0 88-89 31.839624999999998 37.0 28.0 38.0 15.0 38.0 90-91 31.517625 37.0 27.0 38.0 15.0 38.0 92-93 31.74175 36.5 28.0 38.0 15.0 38.0 94-95 31.814625 37.0 28.0 38.0 15.0 38.0 96-97 31.645 36.5 27.0 38.0 15.0 38.0 98-99 31.744 37.0 27.5 38.0 15.0 38.0 100-101 29.877125 34.0 24.0 37.5 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 16.0 18 50.0 19 70.0 20 89.0 21 100.0 22 92.0 23 108.0 24 93.0 25 104.0 26 120.0 27 127.0 28 141.0 29 160.0 30 157.0 31 175.0 32 234.0 33 210.0 34 268.0 35 356.0 36 598.0 37 730.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.025000000000002 16.075 16.400000000000002 38.5 2 27.55 21.2 34.050000000000004 17.2 3 21.675 22.95 32.0 23.375 4 25.124999999999996 30.85 20.75 23.275000000000002 5 27.725 31.324999999999996 21.425 19.525000000000002 6 21.8 32.2 26.200000000000003 19.8 7 19.2 18.05 39.35 23.400000000000002 8 22.275 23.35 26.700000000000003 27.675 9 25.275 20.125 29.549999999999997 25.05 10-11 26.275 28.9125 21.75 23.0625 12-13 25.2625 23.575 26.0625 25.1 14-15 24.962500000000002 25.324999999999996 27.1 22.6125 16-17 24.9 25.074999999999996 25.85 24.175 18-19 25.95 25.15 26.0625 22.8375 20-21 25.912499999999998 25.162499999999998 25.75 23.175 22-23 24.8125 26.2625 24.5625 24.3625 24-25 24.975 25.650000000000002 26.087500000000002 23.2875 26-27 25.1875 25.650000000000002 25.837500000000002 23.325000000000003 28-29 25.825 24.7375 26.325 23.1125 30-31 24.525 26.650000000000002 25.0625 23.7625 32-33 25.324999999999996 25.3 26.450000000000003 22.925 34-35 26.02825353169146 26.065758219777475 25.87823477934742 22.027753469183647 36-37 25.2099786887301 26.31315030713301 25.347875141030464 23.12899586310643 38-39 25.881911433575183 26.232174130597947 25.706780085063798 22.17913435076307 40-41 25.88838838838839 25.487987987987985 25.525525525525527 23.0980980980981 42-43 25.24833396202691 25.537533006412676 25.93989689425374 23.274236137306676 44-45 24.91241241241241 26.013513513513516 26.026026026026027 23.04804804804805 46-47 25.64552519428428 26.034093757834043 24.52995738280271 23.790423665078965 48-49 24.90934100287608 26.484931849443544 26.034763036138553 22.570964111541826 50-51 24.85 26.487500000000004 25.8625 22.8 52-53 24.7875 25.937500000000004 25.424999999999997 23.849999999999998 54-55 25.637500000000003 24.775 26.9625 22.625 56-57 24.825 26.687499999999996 26.025 22.4625 58-59 25.0625 25.525 26.150000000000002 23.2625 60-61 24.9 26.25 25.75 23.1 62-63 25.131282820705174 26.069017254313575 26.269067266816705 22.53063265816454 64-65 25.7875 25.937500000000004 25.2625 23.0125 66-67 25.2375 26.4625 25.724999999999998 22.575 68-69 25.0125 27.175 25.174999999999997 22.6375 70-71 25.26565820727591 26.378297287160894 25.29066133266658 23.06538317289661 72-73 25.687500000000004 25.674999999999997 26.625 22.0125 74-75 25.587500000000002 26.950000000000003 25.1 22.3625 76-77 24.55 26.474999999999998 26.2875 22.6875 78-79 24.9875 26.187500000000004 26.224999999999998 22.6 80-81 25.55 26.525 26.187500000000004 21.7375 82-83 27.2625 25.4875 25.85 21.4 84-85 24.6875 26.174999999999997 25.687500000000004 23.45 86-87 24.34054256782098 26.390798849856235 26.92836604575572 22.340292536567073 88-89 26.294073518379594 24.668667166791696 26.59414853713428 22.443110777694425 90-91 26.0 26.7625 25.624999999999996 21.6125 92-93 25.724999999999998 26.5 25.4375 22.3375 94-95 25.637500000000003 26.2625 25.424999999999997 22.675 96-97 25.640705088136016 26.465808226028255 26.56582072759095 21.327665958244783 98-99 25.55 27.3 26.5125 20.6375 100-101 25.9625 25.7 25.8 22.537499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 0.5 27 0.5 28 1.0 29 2.0 30 4.5 31 7.5 32 10.0 33 14.5 34 17.5 35 27.0 36 39.5 37 53.5 38 67.0 39 94.5 40 139.0 41 165.0 42 191.5 43 215.0 44 207.0 45 210.0 46 230.0 47 225.0 48 199.0 49 187.5 50 194.5 51 172.5 52 151.0 53 150.5 54 138.0 55 133.0 56 121.5 57 100.0 58 90.0 59 80.5 60 73.5 61 61.0 62 45.5 63 37.0 64 38.0 65 31.0 66 22.5 67 20.5 68 11.5 69 7.5 70 6.0 71 3.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0125 36-37 0.2875 38-39 0.075 40-41 0.1 42-43 0.5875 44-45 0.1 46-47 0.27499999999999997 48-49 0.0375 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.025 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0125 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.025 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0125 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.11249999999999999 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136917 spots for ERR10610847.sra Written 136917 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra Read 136911 spots for ERR10610847.sra Written 136911 spots for ERR10610847.sra SRR ids: ['ERR10610847.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3dd7drni ERR10610847.sra spots: 2738226 blocks: [[1, 136911], [136912, 273822], [273823, 410733], [410734, 547644], [547645, 684555], [684556, 821466], [821467, 958377], [958378, 1095288], [1095289, 1232199], [1232200, 1369110], [1369111, 1506021], [1506022, 1642932], [1642933, 1779843], [1779844, 1916754], [1916755, 2053665], [2053666, 2190576], [2190577, 2327487], [2327488, 2464398], [2464399, 2601309], [2601310, 2738226]] ERR10610847 file size 655646 ERR10610847 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610847 ERR10610847_1.fastq ERR10610847_2.fastq Input file: ERR10610847_1.fastq Paired file: ERR10610847_2.fastq trimmed: ERR10610847-trimmed-pair1.fastq, ERR10610847-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:01:08 2024 >> started Fri Dec 6 21:01:11 2024 >> done (2.825s) 2738226 read pairs processed; of these: 4 ( 0.00%) short read pairs filtered out after trimming by size control 139 ( 0.01%) empty read pairs filtered out after trimming by size control 2738083 (99.99%) read pairs available; of these: 98556 ( 3.60%) trimmed read pairs available after processing 2639527 (96.40%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 1 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 0 0.00% 26 2 0.00% 27 1 0.00% 28 1 0.00% 29 0 0.00% 30 2 0.00% 31 1 0.00% 32 1 0.00% 33 2 0.00% 34 5 0.00% 35 1 0.00% 36 2 0.00% 37 3 0.00% 38 7 0.00% 39 7 0.00% 40 6 0.00% 41 8 0.00% 42 16 0.00% 43 16 0.00% 44 24 0.00% 45 19 0.00% 46 10 0.00% 47 21 0.00% 48 24 0.00% 49 32 0.00% 50 33 0.00% 51 42 0.00% 52 55 0.00% 53 51 0.00% 54 69 0.00% 55 72 0.00% 56 55 0.00% 57 74 0.00% 58 76 0.00% 59 100 0.00% 60 109 0.00% 61 124 0.00% 62 136 0.00% 63 158 0.01% 64 198 0.01% 65 201 0.01% 66 241 0.01% 67 296 0.01% 68 298 0.01% 69 316 0.01% 70 375 0.01% 71 491 0.02% 72 497 0.02% 73 556 0.02% 74 639 0.02% 75 743 0.03% 76 823 0.03% 77 935 0.03% 78 1016 0.04% 79 1206 0.04% 80 1278 0.05% 81 1423 0.05% 82 1593 0.06% 83 1783 0.07% 84 1990 0.07% 85 2265 0.08% 86 2539 0.09% 87 2784 0.10% 88 3098 0.11% 89 3435 0.13% 90 3656 0.13% 91 4125 0.15% 92 4597 0.17% 93 4886 0.18% 94 5315 0.19% 95 5823 0.21% 96 6366 0.23% 97 7012 0.26% 98 7662 0.28% 99 8090 0.30% 100 8636 0.32% 101 2639527 96.40% 2738083 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=5.22 fanout-score-rank=10 prefix-density=0.22 prefix-fanout=3.5 sequence=GCAGCTGCAGCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=42.79 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=3.6 sequence=CCGCACTTGCACTTGCCGTCGTTCTCCGCCGCGGACTCCTGCACCTCGAAGTGGCTCTTCTCGGTGTCAACCATGACGATGCCGTAGCCGTTTCCCTTCTTCACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGCCGCAGCCGCTCGACATGGTGGCCTTAACTTGCTGGGGAGATCGAGTACACGAATCAGCTGTGTTTTGCCTGTG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.97 fanout-score-rank=23 prefix-density=0.16 prefix-fanout=2.6 sequence=CAAGGCTAAATAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=23.10 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=4.4 sequence=TGCAAGTGCGGGGACAACTGCACCTGCAACCCGTGCACCTGCAAGTGAAACTCAACTTGAGCAAATCGATGGATCCATCCATGCATGCAGATCAGGTCACATGGATGCAAGACTAGTAGTACCAACTAGTGTGTCGTTTCAGTCAGTTATCATAAGACAAGAATAAGACTTTCAGTCGATCTCGTGGATCCATCTGTCTTATCTG ERR10610847 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:02:08 Started mapping on | Dec 06 21:02:09 Finished on | Dec 06 21:02:54 Mapping speed, Million of reads per hour | 219.05 Number of input reads | 2738083 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 2402060 Uniquely mapped reads % | 87.73% Average mapped length | 199.68 Number of splices: Total | 1590095 Number of splices: Annotated (sjdb) | 1491001 Number of splices: GT/AG | 1565799 Number of splices: GC/AG | 19021 Number of splices: AT/AC | 618 Number of splices: Non-canonical | 4657 Mismatch rate per base, % | 0.98% Deletion rate per base | 0.02% Deletion average length | 2.19 Insertion rate per base | 0.01% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 91330 % of reads mapped to multiple loci | 3.34% Number of reads mapped to too many loci | 4793 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.99% % of reads unmapped: other | 1.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 244693 244693 244693 N_multimapping 91330 91330 91330 N_noFeature 105270 2331882 121410 N_ambiguous 62915 261 9063 UnstrandedReadsAssigned:2233875 PositiveStrandReadsAssigned:69917 NegativeStrandReadsAssigned:2271587 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610847 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610847-trimmed-pair1.fastq ERR10610847-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,738,083 reads, 2,349,399 reads pseudoaligned [quant] estimated average fragment length: 170.891 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 982 rounds 52973 ERR10610847.ke.tsv 35125 ERR10610847.se.tsv 88098 total ==> ERR10610847.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 766.245 0 0 PNS24247 1044 874.109 7.751 5.71527 PNS24249 1928 1758.11 2.50599 0.918708 PNS24246 1044 874.109 7.751 5.71527 PNS24248 1044 874.109 7.751 5.71527 PNS24244 1471 1301.11 37.241 18.4481 PNS24243 293 130.355 0 0 KQK14069 1603 1433.11 105.171 47.3001 KQK14071 474 305.564 0 0 ==> ERR10610847.se.tsv <== BRADI_1g14170v3 110 BRADI_1g53295v3 213 BRADI_1g59795v3 76 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 97 BRADI_1g74790v3 32 BRADI_1g09890v3 0 BRADI_1g77505v3 68 BRADI_1g48960v3 0 ERR10610847 completed mapping pipeline successfully