Starting /dee2/code/volunteer_pipeline.sh ERR10610848 current disk space = 1549109510144 free memory = 1445240608 ERR10610848 SRAfilesize 56b505847d3160dc708bbab3ccb1fcfa ERR10610848.sra ERR10610848.sra file validated ERR10610848 is paired end ERR10610848 is conventional basespace ERR10610848 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610848_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.78225 18.0 18.0 31.0 18.0 32.0 2 29.99975 32.0 27.0 33.0 25.0 33.0 3 30.6885 33.0 31.0 33.0 25.0 33.0 4 30.17425 33.0 30.0 33.0 25.0 33.0 5 31.35 33.0 32.0 33.0 27.0 34.0 6 33.6405 37.0 33.0 38.0 16.0 38.0 7 34.2735 38.0 34.0 38.0 26.0 38.0 8 34.54625 38.0 35.0 38.0 26.0 38.0 9 34.70125 38.0 35.0 38.0 26.0 38.0 10-11 34.77675 38.0 35.5 38.0 26.5 38.0 12-13 34.78875 38.0 35.0 38.0 26.0 38.0 14-15 34.68575 38.0 35.0 38.0 26.0 38.0 16-17 34.662499999999994 38.0 35.0 38.0 26.0 38.0 18-19 34.8205 38.0 35.5 38.0 26.0 38.0 20-21 23.982875 22.0 21.5 28.5 15.0 33.0 22-23 32.4075 35.5 30.5 37.0 20.0 37.5 24-25 34.460125000000005 38.0 34.5 38.0 25.0 38.0 26-27 34.841 38.0 36.0 38.0 25.5 38.0 28-29 34.843375 38.0 36.0 38.0 25.0 38.0 30-31 34.9105 38.0 36.0 38.0 26.0 38.0 32-33 35.02275 38.0 36.0 38.0 27.0 38.0 34-35 34.932249999999996 38.0 35.5 38.0 26.0 38.0 36-37 34.809 38.0 35.5 38.0 25.0 38.0 38-39 34.968 38.0 36.0 38.0 26.0 38.0 40-41 35.0105 38.0 36.0 38.0 27.0 38.0 42-43 34.803375 38.0 36.0 38.0 25.0 38.0 44-45 34.814 38.0 36.0 38.0 25.0 38.0 46-47 34.90925 38.0 36.0 38.0 25.0 38.0 48-49 27.389125 27.0 26.0 31.5 19.5 35.5 50-51 29.852125 32.0 27.5 33.5 16.0 37.5 52-53 33.910125 37.5 33.5 38.0 24.5 38.0 54-55 27.13975 27.0 25.0 31.5 19.0 36.5 56-57 29.634999999999998 31.0 27.5 33.0 16.0 37.0 58-59 33.905375 37.5 33.5 38.0 24.5 38.0 60-61 34.6275 38.0 35.0 38.0 25.0 38.0 62-63 34.900999999999996 38.0 36.0 38.0 26.0 38.0 64-65 34.831375 38.0 35.5 38.0 26.0 38.0 66-67 34.92775 38.0 36.0 38.0 26.0 38.0 68-69 34.894125 38.0 36.0 38.0 26.0 38.0 70-71 34.880624999999995 38.0 36.0 38.0 26.0 38.0 72-73 23.953875 22.0 21.0 27.5 15.0 36.5 74-75 32.094500000000004 35.5 29.5 37.0 20.0 38.0 76-77 34.33825 38.0 34.0 38.0 25.0 38.0 78-79 34.612875 38.0 35.0 38.0 25.0 38.0 80-81 34.9915 38.0 36.0 38.0 27.0 38.0 82-83 35.11225 38.0 36.0 38.0 27.0 38.0 84-85 35.005250000000004 38.0 36.0 38.0 27.0 38.0 86-87 34.943124999999995 38.0 36.0 38.0 26.5 38.0 88-89 34.879374999999996 38.0 35.5 38.0 26.5 38.0 90-91 34.806125 38.0 35.5 38.0 26.0 38.0 92-93 34.705749999999995 38.0 35.0 38.0 25.5 38.0 94-95 33.58525 37.0 33.0 38.0 19.5 38.0 96-97 34.3805 38.0 34.5 38.0 23.5 38.0 98-99 25.845125000000003 26.5 24.5 26.5 18.5 32.5 100-101 27.374 28.0 25.0 32.0 15.0 34.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 3.0 19 22.0 20 33.0 21 49.0 22 51.0 23 54.0 24 46.0 25 65.0 26 76.0 27 90.0 28 99.0 29 118.0 30 159.0 31 191.0 32 238.0 33 277.0 34 504.0 35 1411.0 36 464.0 37 48.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 27.70083102493075 11.080332409972298 14.479979853941071 46.73885671115588 2 22.175 18.675 36.375 22.775000000000002 3 21.45 21.9 23.275000000000002 33.375 4 24.775 28.499999999999996 21.775 24.95 5 23.325000000000003 33.525 23.974999999999998 19.175 6 18.575 34.375 25.275 21.775 7 15.575 22.825 42.25 19.35 8 19.2 23.1 31.075000000000003 26.625 9 17.65 22.1 34.675 25.575 10-11 21.125 31.5375 23.375 23.962500000000002 12-13 21.675 24.6875 27.950000000000003 25.687500000000004 14-15 20.87293646823412 26.850925462731368 28.076538269134566 24.19959979989995 16-17 22.415301912739093 27.053381672709087 26.103262907863485 24.428053506688336 18-19 21.085542771385693 27.201100550275136 26.388194097048522 25.325162581290645 20-21 20.655163790947736 31.657914478619652 21.342835708927232 26.344086021505376 22-23 22.543135783945985 26.056514128532132 26.144036009002253 25.256314078519633 24-25 21.212500000000002 27.237499999999997 26.687499999999996 24.8625 26-27 21.3625 27.487499999999997 26.474999999999998 24.675 28-29 21.837500000000002 26.450000000000003 25.85 25.8625 30-31 21.525 27.025 26.987499999999997 24.462500000000002 32-33 21.75 26.3125 26.487500000000004 25.45 34-35 21.425 26.4125 27.0 25.162499999999998 36-37 22.6875 26.437500000000004 25.912499999999998 24.962500000000002 38-39 21.625 27.3 25.9875 25.087500000000002 40-41 22.037499999999998 26.0125 26.700000000000003 25.25 42-43 22.0875 26.9125 26.1 24.9 44-45 22.175 26.2625 25.912499999999998 25.650000000000002 46-47 21.6 26.75 26.224999999999998 25.424999999999997 48-49 23.225 26.9125 25.3 24.5625 50-51 22.1875 27.474999999999998 25.575 24.762500000000003 52-53 22.0 26.674999999999997 25.650000000000002 25.674999999999997 54-55 21.462500000000002 29.825000000000003 24.0625 24.65 56-57 21.875 27.487499999999997 25.5 25.137500000000003 58-59 21.625 27.0875 25.525 25.7625 60-61 23.1375 26.2125 25.8 24.85 62-63 23.05 25.9875 26.125 24.837500000000002 64-65 22.025 26.275 26.125 25.575 66-67 21.9 27.275 25.8125 25.0125 68-69 22.8875 25.974999999999998 26.8625 24.275 70-71 22.237499999999997 25.974999999999998 25.924999999999997 25.8625 72-73 23.0375 29.612500000000004 23.9875 23.3625 74-75 22.35 27.05 25.825 24.775 76-77 21.525 26.525 26.025 25.924999999999997 78-79 22.8 26.8375 25.412499999999998 24.95 80-81 21.575 26.825 26.900000000000002 24.7 82-83 22.5125 25.912499999999998 26.0375 25.5375 84-85 22.725 25.575 27.462500000000002 24.2375 86-87 22.525000000000002 25.900000000000002 26.337500000000002 25.2375 88-89 22.9375 26.450000000000003 25.662499999999998 24.95 90-91 22.825 25.6125 26.35 25.2125 92-93 23.575 25.900000000000002 25.75 24.775 94-95 22.6125 26.437500000000004 25.3 25.650000000000002 96-97 22.0875 26.5625 25.874999999999996 25.474999999999998 98-99 23.325000000000003 27.875 24.337500000000002 24.462500000000002 100-101 23.200000000000003 25.6125 26.1 25.087500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 2.0 27 3.5 28 5.0 29 5.0 30 5.5 31 9.5 32 14.0 33 12.5 34 18.0 35 33.5 36 48.0 37 67.5 38 88.5 39 107.5 40 130.0 41 164.5 42 209.0 43 246.0 44 246.5 45 234.5 46 229.5 47 230.0 48 223.5 49 194.5 50 180.0 51 161.5 52 142.5 53 136.5 54 128.5 55 120.0 56 97.0 57 85.5 58 86.0 59 69.5 60 54.0 61 51.0 62 44.0 63 31.5 64 19.5 65 18.0 66 18.5 67 12.5 68 7.5 69 4.0 70 2.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7250000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.05 16-17 0.0125 18-19 0.05 20-21 0.025 22-23 0.025 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.07500000000000001 0.0 0.0 0.0 0.0 74-75 0.1625 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.36250000000000004 0.0 0.0 0.0 0.0 84-85 0.6000000000000001 0.0 0.0 0.0 0.0 86-87 0.7625 0.0 0.0 0.0 0.0 88-89 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610848 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610848_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7335 33.0 31.0 33.0 18.0 34.0 2 30.9345 33.0 31.0 33.0 18.0 34.0 3 30.74925 33.0 31.0 33.0 18.0 34.0 4 30.3995 33.0 31.0 33.0 15.0 34.0 5 30.6645 33.0 32.0 33.0 25.0 34.0 6 34.12525 38.0 34.0 38.0 16.0 38.0 7 34.67425 38.0 35.0 38.0 26.0 38.0 8 34.611 38.0 35.0 38.0 26.0 38.0 9 34.496 38.0 35.0 38.0 26.0 38.0 10-11 34.487125 38.0 35.0 38.0 21.0 38.0 12-13 34.513125 38.0 35.0 38.0 21.0 38.0 14-15 34.576499999999996 38.0 35.0 38.0 21.0 38.0 16-17 34.572874999999996 38.0 35.0 38.0 26.0 38.0 18-19 34.43925 38.0 34.5 38.0 20.5 38.0 20-21 34.27675 38.0 34.5 38.0 20.0 38.0 22-23 34.596625 38.0 35.0 38.0 25.0 38.0 24-25 34.753 38.0 35.0 38.0 25.5 38.0 26-27 34.693875 38.0 35.0 38.0 25.0 38.0 28-29 34.664375 38.0 35.0 38.0 25.0 38.0 30-31 34.857 38.0 35.5 38.0 26.0 38.0 32-33 34.635 38.0 35.0 38.0 25.0 38.0 34-35 34.36025 38.0 34.5 38.0 20.5 38.0 36-37 34.63012500000001 38.0 35.0 38.0 25.0 38.0 38-39 34.562375 38.0 35.0 38.0 25.0 38.0 40-41 34.698625 38.0 35.5 38.0 25.0 38.0 42-43 35.01275 38.0 36.0 38.0 27.0 38.0 44-45 34.906375 38.0 36.0 38.0 27.0 38.0 46-47 34.804375 38.0 35.5 38.0 25.0 38.0 48-49 34.880375 38.0 36.0 38.0 26.0 38.0 50-51 34.786500000000004 38.0 35.5 38.0 25.0 38.0 52-53 34.761875 38.0 35.5 38.0 25.0 38.0 54-55 34.8765 38.0 35.5 38.0 26.0 38.0 56-57 34.77175 38.0 35.5 38.0 26.0 38.0 58-59 34.8395 38.0 35.5 38.0 26.0 38.0 60-61 34.723625 38.0 35.0 38.0 25.0 38.0 62-63 34.726124999999996 38.0 35.0 38.0 25.0 38.0 64-65 34.6875 38.0 35.0 38.0 25.0 38.0 66-67 34.690125 38.0 35.0 38.0 25.0 38.0 68-69 34.775625 38.0 35.5 38.0 25.0 38.0 70-71 34.670874999999995 38.0 35.0 38.0 25.0 38.0 72-73 34.69625 38.0 35.0 38.0 25.0 38.0 74-75 34.489125 38.0 35.0 38.0 25.0 38.0 76-77 34.6265 38.0 35.0 38.0 25.0 38.0 78-79 34.765874999999994 38.0 35.0 38.0 25.0 38.0 80-81 34.62625 38.0 35.0 38.0 24.0 38.0 82-83 34.775375 38.0 35.5 38.0 25.0 38.0 84-85 34.701375 38.0 35.0 38.0 25.0 38.0 86-87 34.56625 38.0 35.0 38.0 24.0 38.0 88-89 34.569874999999996 38.0 35.0 38.0 23.5 38.0 90-91 34.609 38.0 35.0 38.0 25.0 38.0 92-93 34.459 38.0 35.0 38.0 23.5 38.0 94-95 34.3475 38.0 34.5 38.0 23.0 38.0 96-97 26.159625 21.5 20.0 37.0 14.5 38.0 98-99 21.6045 20.5 19.0 22.5 14.0 29.0 100-101 29.122500000000002 31.5 24.0 36.5 15.0 37.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 7.0 18 20.0 19 27.0 20 37.0 21 49.0 22 36.0 23 30.0 24 58.0 25 53.0 26 74.0 27 80.0 28 76.0 29 103.0 30 115.0 31 157.0 32 159.0 33 206.0 34 275.0 35 417.0 36 1305.0 37 711.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.175 15.75 13.450000000000001 42.625 2 26.525 21.4 33.6 18.475 3 22.875 24.3 27.325 25.5 4 27.05 29.599999999999998 20.424999999999997 22.925 5 27.125 32.475 20.875 19.525000000000002 6 22.325 35.225 21.5 20.95 7 21.2 18.425 37.225 23.150000000000002 8 22.75 21.7 26.924999999999997 28.625 9 23.799999999999997 22.900000000000002 28.7 24.6 10-11 26.8375 28.9 20.9125 23.35 12-13 26.950000000000003 22.162499999999998 25.7875 25.1 14-15 25.0125 26.137500000000003 25.5375 23.3125 16-17 26.4625 25.674999999999997 24.9375 22.925 18-19 26.137500000000003 25.087500000000002 24.962500000000002 23.8125 20-21 25.412499999999998 26.1625 25.362499999999997 23.0625 22-23 25.025 25.85 25.525 23.599999999999998 24-25 25.8125 25.937500000000004 25.337500000000002 22.912499999999998 26-27 25.2875 26.5625 25.4625 22.6875 28-29 25.424999999999997 26.825 24.4375 23.3125 30-31 24.975 25.525 25.0 24.5 32-33 25.1875 25.4625 25.7375 23.6125 34-35 25.775 25.174999999999997 25.650000000000002 23.400000000000002 36-37 25.2375 26.6625 25.162499999999998 22.9375 38-39 25.7125 25.687500000000004 25.9875 22.6125 40-41 25.637500000000003 25.724999999999998 25.275 23.3625 42-43 25.2 26.174999999999997 26.0 22.625 44-45 26.0125 25.1875 25.624999999999996 23.175 46-47 25.2875 26.525 25.587500000000002 22.6 48-49 25.2 25.55 25.7625 23.4875 50-51 25.362499999999997 25.2875 25.837500000000002 23.5125 52-53 25.362499999999997 25.7375 26.237500000000004 22.662499999999998 54-55 25.2 25.474999999999998 25.887500000000003 23.4375 56-57 25.35 26.525 25.924999999999997 22.2 58-59 25.324999999999996 26.487500000000004 25.2 22.9875 60-61 25.2625 25.324999999999996 26.875 22.537499999999998 62-63 24.9125 26.200000000000003 25.9625 22.925 64-65 25.624999999999996 25.25 26.150000000000002 22.975 66-67 24.8125 25.900000000000002 25.837500000000002 23.45 68-69 25.35 26.8125 25.9625 21.875 70-71 25.35 27.187499999999996 25.5125 21.95 72-73 25.0 25.837500000000002 26.487500000000004 22.675 74-75 26.0625 25.8 25.7375 22.400000000000002 76-77 25.2 25.137500000000003 26.4125 23.25 78-79 25.162499999999998 26.900000000000002 25.2 22.7375 80-81 24.85 26.924999999999997 25.874999999999996 22.35 82-83 25.0125 26.2875 25.8625 22.8375 84-85 25.35 25.8125 25.837500000000002 23.0 86-87 25.337500000000002 26.1625 26.5125 21.987499999999997 88-89 26.224999999999998 25.5 25.874999999999996 22.400000000000002 90-91 24.9875 25.924999999999997 26.1 22.9875 92-93 25.087500000000002 27.037499999999998 25.912499999999998 21.9625 94-95 26.3125 26.075 26.025 21.587500000000002 96-97 25.85 26.25 26.0125 21.8875 98-99 24.6625 28.812500000000004 23.875 22.650000000000002 100-101 25.937500000000004 26.525 25.5 22.037499999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 1.5 29 3.5 30 3.5 31 2.5 32 5.5 33 11.0 34 14.0 35 24.0 36 34.5 37 51.5 38 75.0 39 91.0 40 110.0 41 139.0 42 177.0 43 196.5 44 212.5 45 231.0 46 230.0 47 226.0 48 212.5 49 206.5 50 203.5 51 190.0 52 165.0 53 141.0 54 139.5 55 127.0 56 105.5 57 95.0 58 83.5 59 82.0 60 87.0 61 68.0 62 53.0 63 48.5 64 39.5 65 27.5 66 21.0 67 24.5 68 18.5 69 8.5 70 5.0 71 2.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26933736457546 98.5 2 0.7054673721340388 1.4000000000000001 3 0.0 0.0 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.23750000000000002 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.325 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.675 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 0.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra Read 1167614 spots for ERR10610848.sra Written 1167614 spots for ERR10610848.sra Read 1167606 spots for ERR10610848.sra Written 1167606 spots for ERR10610848.sra SRR ids: ['ERR10610848.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qd_2f99q ERR10610848.sra spots: 23352128 blocks: [[1, 1167606], [1167607, 2335212], [2335213, 3502818], [3502819, 4670424], [4670425, 5838030], [5838031, 7005636], [7005637, 8173242], [8173243, 9340848], [9340849, 10508454], [10508455, 11676060], [11676061, 12843666], [12843667, 14011272], [14011273, 15178878], [15178879, 16346484], [16346485, 17514090], [17514091, 18681696], [18681697, 19849302], [19849303, 21016908], [21016909, 22184514], [22184515, 23352128]] ERR10610848 file size 5633893 ERR10610848 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610848 ERR10610848_1.fastq ERR10610848_2.fastq Input file: ERR10610848_1.fastq Paired file: ERR10610848_2.fastq trimmed: ERR10610848-trimmed-pair1.fastq, ERR10610848-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:10:27 2024 >> started Fri Dec 6 21:10:52 2024 >> done (24.765s) 23352128 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 1226 ( 0.01%) empty read pairs filtered out after trimming by size control 23350844 (99.99%) read pairs available; of these: 783005 ( 3.35%) trimmed read pairs available after processing 22567839 (96.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 0 0.00% 20 0 0.00% 21 2 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 5 0.00% 26 4 0.00% 27 2 0.00% 28 5 0.00% 29 5 0.00% 30 3 0.00% 31 3 0.00% 32 6 0.00% 33 7 0.00% 34 18 0.00% 35 19 0.00% 36 26 0.00% 37 30 0.00% 38 38 0.00% 39 31 0.00% 40 49 0.00% 41 59 0.00% 42 60 0.00% 43 69 0.00% 44 91 0.00% 45 98 0.00% 46 115 0.00% 47 116 0.00% 48 130 0.00% 49 208 0.00% 50 199 0.00% 51 241 0.00% 52 277 0.00% 53 303 0.00% 54 356 0.00% 55 388 0.00% 56 424 0.00% 57 506 0.00% 58 606 0.00% 59 681 0.00% 60 791 0.00% 61 951 0.00% 62 1093 0.00% 63 1123 0.00% 64 1336 0.01% 65 1483 0.01% 66 1535 0.01% 67 1913 0.01% 68 2185 0.01% 69 2503 0.01% 70 2816 0.01% 71 3119 0.01% 72 3537 0.02% 73 4151 0.02% 74 4674 0.02% 75 5268 0.02% 76 6260 0.03% 77 6851 0.03% 78 7697 0.03% 79 8952 0.04% 80 9736 0.04% 81 10815 0.05% 82 12415 0.05% 83 14070 0.06% 84 15698 0.07% 85 17429 0.07% 86 19490 0.08% 87 21355 0.09% 88 24280 0.10% 89 26594 0.11% 90 29516 0.13% 91 32648 0.14% 92 36288 0.16% 93 39775 0.17% 94 43576 0.19% 95 47294 0.20% 96 51452 0.22% 97 57536 0.25% 98 61250 0.26% 99 66711 0.29% 100 71648 0.31% 101 22567839 96.65% 23350844 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=2.87 fanout-score-rank=23 prefix-density=0.26 prefix-fanout=2.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=117.12 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.0 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=32 prefix-density=0.36 prefix-fanout=1.9 sequence=GAAGATGTCTTGCAGCTGTGGATCAAGCTGCAACTGTGGCTCAAACTGCACTTGCGGGAAGATGTACCCAGACCTGGCAGAGCAGGGCAGCACCACCAGCAGCACCCAGGCCCAGGTGGTGGTTCTCGGCATGGCGCCGGAGAAGAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=30 fanout-score=17.48 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.5 sequence=GAGAAGAAACAGGAGCAGTTCGAGATGGCCGGCGTGTCCGGCGAAGGGTGCAGCTGCGGCGACAACTGCAAGTGCAACCCTTGCAACTGTTAGTCCATTAATCATGATGAACTTGTGGTTAGTAAATAAGCGCCGAGTCAGAGCGTGTGGTGTGATTGTGTTGTTGTTTACTTGCTCTTAATTGGTGTATCCTTCCTTGTGAGTATGTATGTATCTGTGTGTCTGTGT ERR10610848 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:11:44 Started mapping on | Dec 06 21:11:44 Finished on | Dec 06 21:15:27 Mapping speed, Million of reads per hour | 376.96 Number of input reads | 23350844 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 20972402 Uniquely mapped reads % | 89.81% Average mapped length | 200.11 Number of splices: Total | 12033402 Number of splices: Annotated (sjdb) | 11183658 Number of splices: GT/AG | 11864903 Number of splices: GC/AG | 145518 Number of splices: AT/AC | 4907 Number of splices: Non-canonical | 18074 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.02% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 1.91 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 619698 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 60722 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.06% % of reads unmapped: other | 2.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1758744 1758744 1758744 N_multimapping 619698 619698 619698 N_noFeature 801508 20335580 937389 N_ambiguous 578834 2181 78812 UnstrandedReadsAssigned:19592060 PositiveStrandReadsAssigned:634641 NegativeStrandReadsAssigned:19956201 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610848 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610848-trimmed-pair1.fastq ERR10610848-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,350,844 reads, 20,436,014 reads pseudoaligned [quant] estimated average fragment length: 167.609 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52973 ERR10610848.ke.tsv 35125 ERR10610848.se.tsv 88098 total ==> ERR10610848.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.478 0 0 PNS24247 1044 877.391 54.995 4.41473 PNS24249 1928 1761.39 21.0583 0.842058 PNS24246 1044 877.391 54.995 4.41473 PNS24248 1044 877.391 54.995 4.41473 PNS24244 1471 1304.39 131.957 7.12523 PNS24243 293 132.663 0 0 KQK14069 1603 1436.39 2002.21 98.1774 KQK14071 474 308.647 52.6168 12.0071 ==> ERR10610848.se.tsv <== BRADI_1g14170v3 2370 BRADI_1g53295v3 96 BRADI_1g59795v3 979 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 338 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 545 BRADI_1g48960v3 0 ERR10610848 completed mapping pipeline successfully