Starting /dee2/code/volunteer_pipeline.sh ERR10610849 current disk space = 1549156360192 free memory = 1596846180 ERR10610849 SRAfilesize 94b703b731e0dc80a77df28f5cb5c99d ERR10610849.sra ERR10610849.sra file validated ERR10610849 is paired end ERR10610849 is conventional basespace ERR10610849 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610849_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.6545 33.0 30.0 33.0 18.0 33.0 2 30.32475 33.0 30.0 33.0 18.0 34.0 3 30.68475 33.0 31.0 33.0 25.0 34.0 4 30.226 33.0 30.0 33.0 25.0 34.0 5 31.01 33.0 32.0 33.0 27.0 34.0 6 33.62325 37.0 33.0 38.0 16.0 38.0 7 34.3605 38.0 34.0 38.0 26.0 38.0 8 34.64 38.0 34.0 38.0 26.0 38.0 9 34.93175 38.0 35.0 38.0 26.0 38.0 10-11 34.725875 38.0 35.0 38.0 26.0 38.0 12-13 34.665625 38.0 35.0 38.0 26.0 38.0 14-15 34.66475 38.0 35.0 38.0 26.0 38.0 16-17 34.6235 38.0 35.0 38.0 26.0 38.0 18-19 34.749750000000006 38.0 35.5 38.0 26.5 38.0 20-21 23.853625 22.0 21.5 28.5 15.0 33.0 22-23 32.355125 35.5 30.5 37.0 20.5 37.5 24-25 34.33325 38.0 34.5 38.0 24.5 38.0 26-27 34.801625 38.0 35.5 38.0 26.0 38.0 28-29 34.86775 38.0 36.0 38.0 26.0 38.0 30-31 34.961625 38.0 36.0 38.0 27.0 38.0 32-33 34.83775 38.0 36.0 38.0 25.0 38.0 34-35 34.83425 38.0 35.5 38.0 26.0 38.0 36-37 34.71425 38.0 35.0 38.0 25.0 38.0 38-39 34.77875 38.0 36.0 38.0 26.0 38.0 40-41 34.954499999999996 38.0 36.0 38.0 27.0 38.0 42-43 34.70025 38.0 35.5 38.0 25.0 38.0 44-45 34.703 38.0 35.0 38.0 25.0 38.0 46-47 34.89375 38.0 35.5 38.0 26.0 38.0 48-49 27.478749999999998 27.0 26.0 31.5 20.5 35.5 50-51 29.727125 31.0 27.5 33.5 16.0 37.0 52-53 33.76925 37.5 33.5 38.0 20.5 38.0 54-55 27.102875 27.0 25.0 31.5 19.0 36.5 56-57 29.596249999999998 31.0 27.5 33.0 16.0 37.0 58-59 33.756 37.5 33.5 38.0 24.5 38.0 60-61 34.587374999999994 38.0 34.5 38.0 25.0 38.0 62-63 34.875125 38.0 35.5 38.0 26.0 38.0 64-65 34.76325 38.0 35.5 38.0 26.0 38.0 66-67 34.834375 38.0 35.5 38.0 26.0 38.0 68-69 34.82525 38.0 35.5 38.0 26.0 38.0 70-71 34.7595 38.0 35.5 38.0 25.0 38.0 72-73 24.065 22.0 21.0 27.5 15.0 37.0 74-75 31.938125 35.0 29.0 37.0 20.0 38.0 76-77 34.285624999999996 38.0 34.0 38.0 25.0 38.0 78-79 34.574875 38.0 35.0 38.0 25.0 38.0 80-81 34.805125000000004 38.0 36.0 38.0 25.0 38.0 82-83 34.861374999999995 38.0 35.5 38.0 25.5 38.0 84-85 34.918 38.0 36.0 38.0 27.0 38.0 86-87 34.734375 38.0 35.5 38.0 25.0 38.0 88-89 34.755375 38.0 35.0 38.0 25.5 38.0 90-91 34.761375 38.0 35.0 38.0 26.0 38.0 92-93 34.6095 38.0 35.0 38.0 25.0 38.0 94-95 33.21175 37.0 31.0 38.0 19.0 38.0 96-97 34.424125000000004 38.0 34.5 38.0 24.0 38.0 98-99 25.8335 26.5 25.0 26.5 18.5 32.5 100-101 27.131 27.5 25.0 32.0 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 7.0 19 23.0 20 40.0 21 36.0 22 43.0 23 56.0 24 57.0 25 79.0 26 70.0 27 93.0 28 121.0 29 108.0 30 141.0 31 193.0 32 208.0 33 307.0 34 512.0 35 1270.0 36 553.0 37 81.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 26.727181038830057 9.203227433182047 9.732728189611699 54.3368633383762 2 20.549999999999997 16.975 36.35 26.125 3 24.006001500375092 20.10502625656414 23.40585146286572 32.483120780195044 4 28.849999999999998 26.8 20.925 23.425 5 25.15 32.525 23.45 18.875 6 20.724999999999998 32.95 25.974999999999998 20.349999999999998 7 16.6 22.175 41.15 20.075000000000003 8 18.75 21.9 32.9 26.450000000000003 9 20.05 20.275000000000002 34.1 25.575 10-11 21.9375 30.9625 23.3875 23.7125 12-13 21.102637829728714 24.04050506313289 27.490936367045883 27.365920740092513 14-15 20.6176544136034 25.84396099024756 27.994498624656167 25.543885971492873 16-17 22.20555138784696 25.76894223555889 27.169292323080768 24.85621405351338 18-19 21.30799049643616 26.559959984994375 26.384894335375762 25.747155183193698 20-21 20.0450168813305 30.648993372514692 21.970739027135174 27.335250719019633 22-23 22.46530816352044 26.915864483060382 25.328166020752597 25.29066133266658 24-25 21.61520190023753 25.890736342042754 26.553319164895612 25.9407425928241 26-27 21.6 26.85 25.5375 26.0125 28-29 20.837500000000002 26.525 27.5625 25.074999999999996 30-31 22.025 25.7 27.0 25.275 32-33 22.5 27.474999999999998 26.2875 23.7375 34-35 22.275 27.187499999999996 25.8625 24.675 36-37 22.702837854731843 26.403300412551566 25.978247280910118 24.915614451806476 38-39 21.65 26.4625 26.6625 25.224999999999998 40-41 21.7375 26.687499999999996 25.687500000000004 25.887500000000003 42-43 21.975 26.174999999999997 26.237500000000004 25.6125 44-45 22.375 25.5625 27.325 24.7375 46-47 22.35 26.3625 25.8125 25.474999999999998 48-49 23.0 25.9875 26.125 24.887500000000003 50-51 21.9 26.9125 25.2875 25.900000000000002 52-53 22.400000000000002 26.2875 25.8125 25.5 54-55 21.6 29.4 23.95 25.05 56-57 22.5875 26.637499999999996 26.025 24.75 58-59 20.9375 27.125 26.487500000000004 25.45 60-61 21.7 25.85 27.0625 25.387500000000003 62-63 23.150000000000002 25.624999999999996 25.687500000000004 25.5375 64-65 21.6125 26.575 26.375 25.4375 66-67 21.325 26.0625 26.05 26.5625 68-69 21.6625 26.337500000000002 26.325 25.674999999999997 70-71 22.112499999999997 27.250000000000004 25.662499999999998 24.975 72-73 23.25 30.25 23.575 22.925 74-75 22.7 26.0125 25.837500000000002 25.45 76-77 22.7 26.4125 25.4375 25.45 78-79 22.0 26.25 27.150000000000002 24.6 80-81 23.375 25.1875 25.724999999999998 25.7125 82-83 23.4875 26.0 25.674999999999997 24.837500000000002 84-85 22.75 25.924999999999997 25.887500000000003 25.4375 86-87 22.85 26.174999999999997 25.474999999999998 25.5 88-89 21.965245655706962 26.940867608451057 25.803225403175396 25.29066133266658 90-91 22.8125 26.724999999999998 25.374999999999996 25.087500000000002 92-93 23.06538317289661 26.378297287160894 25.55319414926866 25.003125390673837 94-95 22.2125 26.55 26.3125 24.925 96-97 23.025000000000002 25.775 25.8 25.4 98-99 23.0125 28.6125 24.6 23.775 100-101 22.925 26.187500000000004 26.187500000000004 24.7 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 0.5 28 1.0 29 2.0 30 3.0 31 4.5 32 8.0 33 12.0 34 18.5 35 28.0 36 45.0 37 68.0 38 89.5 39 113.5 40 152.0 41 172.0 42 196.5 43 215.5 44 214.5 45 228.5 46 242.5 47 221.0 48 196.5 49 194.5 50 191.0 51 181.0 52 155.5 53 137.0 54 124.0 55 117.5 56 119.0 57 103.5 58 80.5 59 66.5 60 59.5 61 53.5 62 47.0 63 37.5 64 26.5 65 24.5 66 19.5 67 14.0 68 7.0 69 3.0 70 2.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.025 16-17 0.025 18-19 0.0375 20-21 0.0375 22-23 0.0125 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.94997498749375 99.9 2 0.05002501250625312 0.1 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.44999999999999996 0.0 0.0 0.0 0.0 86-87 0.6125 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610849 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610849_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.1905 33.0 31.0 33.0 18.0 34.0 2 30.63175 33.0 31.0 33.0 18.0 34.0 3 30.22425 33.0 29.0 33.0 18.0 34.0 4 29.93325 33.0 31.0 33.0 15.0 34.0 5 30.21275 33.0 31.0 33.0 15.0 34.0 6 33.3605 38.0 32.0 38.0 16.0 38.0 7 34.03425 38.0 34.0 38.0 16.0 38.0 8 33.9705 38.0 34.0 38.0 16.0 38.0 9 33.8745 38.0 34.0 38.0 16.0 38.0 10-11 33.926875 38.0 34.0 38.0 16.0 38.0 12-13 33.831625 38.0 33.5 38.0 16.0 38.0 14-15 33.8025 38.0 33.5 38.0 16.0 38.0 16-17 33.870875 38.0 33.5 38.0 16.0 38.0 18-19 33.699875000000006 38.0 33.5 38.0 16.0 38.0 20-21 33.71525 38.0 33.5 38.0 16.0 38.0 22-23 33.98475 38.0 34.0 38.0 16.0 38.0 24-25 34.052375 38.0 34.0 38.0 16.0 38.0 26-27 33.8645 38.0 34.0 38.0 16.0 38.0 28-29 34.04325 38.0 34.0 38.0 16.0 38.0 30-31 34.205 38.0 34.0 38.0 20.0 38.0 32-33 34.090625 38.0 34.0 38.0 16.0 38.0 34-35 33.750875 38.0 33.5 38.0 16.0 38.0 36-37 33.9905 38.0 34.0 38.0 16.0 38.0 38-39 33.968625 38.0 34.0 38.0 16.0 38.0 40-41 34.10925 38.0 34.0 38.0 16.0 38.0 42-43 34.300625 38.0 34.5 38.0 20.0 38.0 44-45 34.045249999999996 38.0 34.0 38.0 16.0 38.0 46-47 34.171499999999995 38.0 34.0 38.0 20.0 38.0 48-49 34.082625 38.0 34.0 38.0 16.0 38.0 50-51 34.015375000000006 38.0 34.0 38.0 16.0 38.0 52-53 34.057249999999996 38.0 34.0 38.0 16.0 38.0 54-55 34.031 38.0 34.0 38.0 16.0 38.0 56-57 34.00675 38.0 34.0 38.0 20.0 38.0 58-59 34.053 38.0 34.0 38.0 16.0 38.0 60-61 33.912125 38.0 34.0 38.0 16.0 38.0 62-63 34.068 38.0 34.0 38.0 16.0 38.0 64-65 33.992 38.0 34.0 38.0 16.0 38.0 66-67 33.981125000000006 38.0 34.0 38.0 16.0 38.0 68-69 34.114374999999995 38.0 34.0 38.0 16.0 38.0 70-71 33.964875000000006 38.0 34.0 38.0 16.0 38.0 72-73 34.07825 38.0 34.0 38.0 20.0 38.0 74-75 33.686625 38.0 34.0 38.0 16.0 38.0 76-77 33.892375 38.0 34.0 38.0 16.0 38.0 78-79 33.8885 38.0 34.0 38.0 16.0 38.0 80-81 33.767250000000004 38.0 34.0 38.0 16.0 38.0 82-83 33.8975 38.0 34.0 38.0 16.0 38.0 84-85 33.87625 38.0 34.0 38.0 16.0 38.0 86-87 33.988249999999994 38.0 34.0 38.0 16.0 38.0 88-89 33.722 38.0 34.0 38.0 16.0 38.0 90-91 33.834375 38.0 34.0 38.0 16.0 38.0 92-93 33.697375 38.0 34.0 38.0 15.0 38.0 94-95 33.5625 38.0 33.5 38.0 15.0 38.0 96-97 25.113 21.5 19.0 35.0 14.5 38.0 98-99 21.520625 20.5 19.0 22.5 14.0 29.5 100-101 28.497875 30.5 23.5 35.5 15.0 37.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 4.0 17 3.0 18 16.0 19 52.0 20 44.0 21 55.0 22 65.0 23 58.0 24 73.0 25 94.0 26 93.0 27 78.0 28 101.0 29 115.0 30 147.0 31 162.0 32 166.0 33 216.0 34 269.0 35 468.0 36 1164.0 37 556.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.70692673168292 15.478869717429358 15.403850962740684 41.410352588147035 2 26.35 21.375 33.900000000000006 18.375 3 20.705176294073517 24.256064016004 28.207051762940733 26.831707926981746 4 26.450000000000003 30.025000000000002 20.549999999999997 22.975 5 28.182045511377847 32.83320830207552 20.030007501875467 18.95473868467117 6 20.825 34.75 24.05 20.375 7 20.875 16.2 39.225 23.7 8 23.025000000000002 21.25 27.275 28.449999999999996 9 24.275 22.650000000000002 28.725 24.349999999999998 10-11 26.0375 29.462500000000002 21.8125 22.6875 12-13 25.9625 22.85 25.624999999999996 25.5625 14-15 24.5 26.2625 25.5625 23.674999999999997 16-17 26.1 24.587500000000002 25.337500000000002 23.974999999999998 18-19 25.825 26.400000000000002 25.112499999999997 22.662499999999998 20-21 25.637500000000003 25.8 25.5625 23.0 22-23 24.887500000000003 27.075 24.5375 23.5 24-25 25.174999999999997 25.9875 25.7 23.1375 26-27 25.412499999999998 26.075 25.1 23.4125 28-29 24.637500000000003 24.6625 27.212500000000002 23.4875 30-31 25.112499999999997 25.8125 25.887500000000003 23.1875 32-33 25.55 26.5625 25.124999999999996 22.7625 34-35 24.6875 26.237500000000004 25.650000000000002 23.425 36-37 25.0375 25.7375 26.1 23.125 38-39 26.200000000000003 26.325 25.2875 22.1875 40-41 26.087500000000002 25.624999999999996 24.9125 23.375 42-43 23.8625 25.9875 25.874999999999996 24.275 44-45 24.962500000000002 26.625 25.837500000000002 22.575 46-47 25.587500000000002 26.35 24.525 23.5375 48-49 25.9875 25.7625 25.624999999999996 22.625 50-51 25.674999999999997 26.1 25.7 22.525000000000002 52-53 25.2375 26.400000000000002 25.0125 23.35 54-55 25.874999999999996 25.825 25.85 22.45 56-57 26.275 26.075 25.4875 22.162499999999998 58-59 25.1875 26.224999999999998 24.95 23.6375 60-61 24.6 26.625 26.1625 22.6125 62-63 25.8 25.8 26.075 22.325 64-65 24.875 26.2125 26.3 22.6125 66-67 25.1875 26.0625 25.7125 23.0375 68-69 24.925 26.424999999999997 26.2875 22.3625 70-71 25.6125 26.9125 25.7 21.775 72-73 24.887500000000003 26.200000000000003 26.4625 22.45 74-75 25.4875 26.35 25.7625 22.400000000000002 76-77 24.762500000000003 26.25 26.400000000000002 22.5875 78-79 24.9125 26.724999999999998 25.8625 22.5 80-81 25.387500000000003 25.650000000000002 26.0125 22.95 82-83 25.087500000000002 26.1 26.2125 22.6 84-85 24.349999999999998 26.887499999999996 26.087500000000002 22.675 86-87 25.9875 25.9625 26.0125 22.037499999999998 88-89 25.575 25.912499999999998 25.8625 22.650000000000002 90-91 24.8625 26.4125 26.400000000000002 22.325 92-93 25.2125 26.775 25.912499999999998 22.1 94-95 25.5625 26.275 25.55 22.6125 96-97 25.2125 26.724999999999998 25.8625 22.2 98-99 24.349999999999998 28.6125 23.7625 23.275000000000002 100-101 26.0375 26.674999999999997 25.837500000000002 21.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 1.0 27 1.0 28 1.0 29 1.0 30 2.5 31 3.0 32 2.5 33 5.0 34 14.0 35 24.0 36 32.5 37 51.5 38 78.0 39 103.0 40 128.5 41 158.0 42 191.0 43 207.0 44 210.0 45 232.5 46 230.5 47 214.5 48 211.5 49 202.5 50 188.5 51 175.0 52 161.5 53 152.5 54 142.0 55 129.5 56 120.0 57 92.0 58 74.5 59 83.5 60 83.0 61 71.5 62 58.5 63 44.0 64 33.5 65 19.5 66 20.5 67 17.5 68 9.5 69 7.5 70 3.0 71 1.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.1166077738516 98.175 2 0.8329126703685007 1.6500000000000001 3 0.025239777889954566 0.075 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0125 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.55 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442006 spots for ERR10610849.sra Written 1442006 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra Read 1442004 spots for ERR10610849.sra Written 1442004 spots for ERR10610849.sra SRR ids: ['ERR10610849.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qr2eczh5 ERR10610849.sra spots: 28840082 blocks: [[1, 1442004], [1442005, 2884008], [2884009, 4326012], [4326013, 5768016], [5768017, 7210020], [7210021, 8652024], [8652025, 10094028], [10094029, 11536032], [11536033, 12978036], [12978037, 14420040], [14420041, 15862044], [15862045, 17304048], [17304049, 18746052], [18746053, 20188056], [20188057, 21630060], [21630061, 23072064], [23072065, 24514068], [24514069, 25956072], [25956073, 27398076], [27398077, 28840082]] ERR10610849 file size 6963006 ERR10610849 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610849 ERR10610849_1.fastq ERR10610849_2.fastq Input file: ERR10610849_1.fastq Paired file: ERR10610849_2.fastq trimmed: ERR10610849-trimmed-pair1.fastq, ERR10610849-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:08:14 2024 >> started Fri Dec 6 21:09:08 2024 >> done (53.533s) 28840082 read pairs processed; of these: 136 ( 0.00%) short read pairs filtered out after trimming by size control 4331 ( 0.02%) empty read pairs filtered out after trimming by size control 28835615 (99.98%) read pairs available; of these: 851978 ( 2.95%) trimmed read pairs available after processing 27983637 (97.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 0 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 5 0.00% 25 2 0.00% 26 5 0.00% 27 7 0.00% 28 11 0.00% 29 11 0.00% 30 14 0.00% 31 20 0.00% 32 27 0.00% 33 20 0.00% 34 26 0.00% 35 30 0.00% 36 39 0.00% 37 52 0.00% 38 52 0.00% 39 61 0.00% 40 67 0.00% 41 101 0.00% 42 90 0.00% 43 123 0.00% 44 88 0.00% 45 154 0.00% 46 169 0.00% 47 156 0.00% 48 227 0.00% 49 247 0.00% 50 283 0.00% 51 331 0.00% 52 359 0.00% 53 425 0.00% 54 445 0.00% 55 467 0.00% 56 574 0.00% 57 627 0.00% 58 717 0.00% 59 846 0.00% 60 917 0.00% 61 1084 0.00% 62 1196 0.00% 63 1399 0.00% 64 1591 0.01% 65 1778 0.01% 66 1985 0.01% 67 2266 0.01% 68 2534 0.01% 69 2859 0.01% 70 3311 0.01% 71 3658 0.01% 72 4112 0.01% 73 4779 0.02% 74 5252 0.02% 75 6062 0.02% 76 6794 0.02% 77 7739 0.03% 78 8619 0.03% 79 9699 0.03% 80 10931 0.04% 81 12279 0.04% 82 13593 0.05% 83 15406 0.05% 84 17216 0.06% 85 19133 0.07% 86 21374 0.07% 87 23404 0.08% 88 26579 0.09% 89 28796 0.10% 90 31802 0.11% 91 35947 0.12% 92 38993 0.14% 93 42694 0.15% 94 47137 0.16% 95 51008 0.18% 96 55263 0.19% 97 61069 0.21% 98 66077 0.23% 99 71397 0.25% 100 77358 0.27% 101 27983637 97.05% 28835615 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=15 prefix-density=0.33 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=28.57 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.2 sequence=CTTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAG criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=5.04 fanout-score-rank=11 prefix-density=0.40 prefix-fanout=3.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=6.99 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=2.2 sequence=CATGTTTGGGTTCTTCGTCCAGGCCATTGTCACCGGCAAGGGTCCCCT ERR10610849 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:09:56 Started mapping on | Dec 06 21:09:56 Finished on | Dec 06 21:14:40 Mapping speed, Million of reads per hour | 365.52 Number of input reads | 28835615 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 26269369 Uniquely mapped reads % | 91.10% Average mapped length | 200.10 Number of splices: Total | 17710806 Number of splices: Annotated (sjdb) | 16658438 Number of splices: GT/AG | 17467270 Number of splices: GC/AG | 213795 Number of splices: AT/AC | 7273 Number of splices: Non-canonical | 22468 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.01% Deletion average length | 2.05 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 577086 % of reads mapped to multiple loci | 2.00% Number of reads mapped to too many loci | 32547 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.86% % of reads unmapped: other | 0.93% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1989160 1989160 1989160 N_multimapping 577086 577086 577086 N_noFeature 965418 25582290 1130369 N_ambiguous 612712 2658 91783 UnstrandedReadsAssigned:24691239 PositiveStrandReadsAssigned:684421 NegativeStrandReadsAssigned:25047217 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610849 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610849-trimmed-pair1.fastq ERR10610849-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,835,615 reads, 25,674,638 reads pseudoaligned [quant] estimated average fragment length: 176.977 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 ERR10610849.ke.tsv 35125 ERR10610849.se.tsv 88098 total ==> ERR10610849.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 760.155 0 0 PNS24247 1044 868.023 80.9195 5.63037 PNS24249 1928 1752.02 29.1052 1.00333 PNS24246 1044 868.023 80.9195 5.63037 PNS24248 1044 868.023 80.9195 5.63037 PNS24244 1471 1295.02 116.136 5.41633 PNS24243 293 127.285 0 0 KQK14069 1603 1427.02 1338.03 56.6303 KQK14071 474 299.698 58.4686 11.7829 ==> ERR10610849.se.tsv <== BRADI_1g14170v3 1611 BRADI_1g53295v3 136 BRADI_1g59795v3 1032 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 487 BRADI_1g74790v3 155 BRADI_1g09890v3 0 BRADI_1g77505v3 499 BRADI_1g48960v3 0 ERR10610849 completed mapping pipeline successfully