Starting /dee2/code/volunteer_pipeline.sh ERR10610850 current disk space = 1549130039296 free memory = 1599582704 ERR10610850 SRAfilesize f043e9d72ce9e6c629a2fd43b879cbe5 ERR10610850.sra ERR10610850.sra file validated ERR10610850 is paired end ERR10610850 is conventional basespace ERR10610850 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610850_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.97025 32.0 25.0 33.0 18.0 33.0 2 29.75875 32.0 28.0 33.0 18.0 33.0 3 30.91175 33.0 32.0 33.0 25.0 33.0 4 30.562 33.0 31.0 33.0 25.0 34.0 5 31.187 33.0 32.0 33.0 27.0 34.0 6 33.762 37.0 33.0 38.0 16.0 38.0 7 34.76625 38.0 35.0 38.0 26.0 38.0 8 34.61175 38.0 35.0 38.0 26.0 38.0 9 34.93 38.0 36.0 38.0 26.0 38.0 10-11 34.900125 38.0 36.0 38.0 26.5 38.0 12-13 34.69025 38.0 35.0 38.0 26.0 38.0 14-15 34.86225 38.0 36.0 38.0 26.5 38.0 16-17 34.718125 38.0 36.0 38.0 25.5 38.0 18-19 34.831875 38.0 36.0 38.0 26.5 38.0 20-21 24.00175 22.0 21.5 28.5 15.0 33.5 22-23 32.446375 35.5 30.5 37.0 20.5 37.5 24-25 34.439125000000004 38.0 34.5 38.0 25.0 38.0 26-27 34.87225 38.0 36.0 38.0 26.0 38.0 28-29 34.8365 38.0 36.0 38.0 25.0 38.0 30-31 34.91575 38.0 36.0 38.0 26.0 38.0 32-33 35.05225 38.0 36.0 38.0 26.0 38.0 34-35 34.905249999999995 38.0 35.5 38.0 26.0 38.0 36-37 34.758624999999995 38.0 35.5 38.0 25.0 38.0 38-39 34.8835 38.0 36.0 38.0 26.0 38.0 40-41 35.026375 38.0 36.0 38.0 27.0 38.0 42-43 34.84725 38.0 36.0 38.0 26.0 38.0 44-45 34.85275 38.0 36.0 38.0 26.0 38.0 46-47 34.931875000000005 38.0 36.0 38.0 25.0 38.0 48-49 27.488625 27.0 26.0 31.5 20.5 36.0 50-51 29.9685 32.0 27.5 33.5 16.0 37.5 52-53 33.891375 37.5 33.5 38.0 24.5 38.0 54-55 27.29975 27.0 25.0 31.5 19.5 37.0 56-57 29.6735 31.0 27.5 33.0 20.0 37.5 58-59 33.941375 37.5 33.5 38.0 25.0 38.0 60-61 34.694 38.0 35.0 38.0 25.0 38.0 62-63 34.897375 38.0 36.0 38.0 27.0 38.0 64-65 34.87325 38.0 36.0 38.0 26.0 38.0 66-67 34.999375 38.0 36.0 38.0 27.0 38.0 68-69 35.11175 38.0 36.0 38.0 27.0 38.0 70-71 34.784499999999994 38.0 35.5 38.0 25.0 38.0 72-73 24.224375000000002 22.0 21.0 27.5 15.0 37.0 74-75 31.9185 35.0 30.0 37.0 20.0 38.0 76-77 34.361374999999995 38.0 34.0 38.0 25.0 38.0 78-79 34.696375 38.0 35.0 38.0 25.5 38.0 80-81 34.85525 38.0 36.0 38.0 26.0 38.0 82-83 34.923125 38.0 36.0 38.0 26.5 38.0 84-85 34.96475 38.0 36.0 38.0 27.0 38.0 86-87 34.86775 38.0 36.0 38.0 26.5 38.0 88-89 34.806625 38.0 35.5 38.0 25.5 38.0 90-91 34.762625 38.0 35.5 38.0 25.5 38.0 92-93 34.740624999999994 38.0 35.0 38.0 25.5 38.0 94-95 33.364375 37.0 32.0 38.0 19.0 38.0 96-97 34.248875 38.0 34.5 38.0 23.0 38.0 98-99 25.909375 26.5 25.0 26.5 18.5 32.5 100-101 27.21 27.5 25.0 32.0 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 5.0 19 27.0 20 30.0 21 42.0 22 43.0 23 57.0 24 62.0 25 74.0 26 58.0 27 88.0 28 100.0 29 116.0 30 152.0 31 164.0 32 225.0 33 309.0 34 487.0 35 1369.0 36 521.0 37 70.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.006054490413725 10.216952573158427 11.125126135216952 44.6518668012109 2 21.65 14.649999999999999 39.475 24.224999999999998 3 21.85 20.8 23.1 34.25 4 24.725 30.25 20.375 24.65 5 24.05 31.175000000000004 26.200000000000003 18.575 6 18.4 34.9 26.325 20.375 7 15.25 23.225 43.525000000000006 18.0 8 19.650000000000002 23.075000000000003 31.025000000000002 26.25 9 19.0 21.224999999999998 33.725 26.05 10-11 21.95 32.074999999999996 23.6375 22.3375 12-13 21.727715964495562 26.290786348293537 26.365795724465556 25.61570196274534 14-15 21.32849637227921 26.932699524643482 27.45809357017763 24.280710532899676 16-17 21.623311655827916 26.40070035017509 27.00100050025013 24.974987493746873 18-19 22.191643732799598 26.394796097072803 26.36977733299975 25.04378283712785 20-21 20.16008004002001 31.353176588294147 21.773386693346673 26.713356678339167 22-23 21.608103038639488 27.31024134050269 25.97223958984619 25.109416031011627 24-25 21.12764095511939 26.915864483060382 26.990873859232405 24.965620702587824 26-27 22.0875 26.787499999999998 26.737499999999997 24.3875 28-29 22.2125 26.9125 26.8125 24.0625 30-31 21.099999999999998 27.487499999999997 25.662499999999998 25.75 32-33 21.975 26.5625 26.5375 24.925 34-35 21.425 27.1375 26.237500000000004 25.2 36-37 22.115264408051004 26.915864483060382 26.115764470558823 24.85310663832979 38-39 21.975 25.775 27.224999999999998 25.025 40-41 21.637500000000003 27.525 26.637499999999996 24.2 42-43 22.6875 26.025 26.075 25.2125 44-45 21.925 26.8 26.825 24.45 46-47 21.4875 27.6125 26.075 24.825 48-49 23.9 27.200000000000003 24.7375 24.1625 50-51 21.9 26.6125 26.474999999999998 25.0125 52-53 22.325 26.9125 25.324999999999996 25.4375 54-55 21.8 29.725 23.025000000000002 25.45 56-57 21.349999999999998 26.775 27.0125 24.8625 58-59 22.1375 26.875 25.624999999999996 25.362499999999997 60-61 23.1375 25.85 26.674999999999997 24.337500000000002 62-63 21.65 26.25 26.887499999999996 25.2125 64-65 21.212500000000002 26.424999999999997 26.275 26.087500000000002 66-67 22.1375 27.775 25.25 24.837500000000002 68-69 21.875 26.5625 26.7125 24.85 70-71 21.65 26.9625 26.575 24.8125 72-73 23.175 29.6375 23.7625 23.425 74-75 22.0125 26.4625 26.6125 24.9125 76-77 22.0 27.5125 25.5 24.9875 78-79 22.25 26.6625 25.775 25.3125 80-81 21.762500000000003 26.3625 26.1625 25.7125 82-83 21.349999999999998 27.075 26.8125 24.762500000000003 84-85 23.375 26.5625 25.45 24.6125 86-87 22.0125 26.6 26.1 25.2875 88-89 23.24040505063133 26.790848856107015 25.29066133266658 24.678084760595073 90-91 22.8125 27.025 25.4 24.762500000000003 92-93 22.99037379672459 27.490936367045883 25.690711338917367 23.827978497312163 94-95 22.1 26.237500000000004 26.2125 25.45 96-97 21.875 27.1375 25.45 25.5375 98-99 24.3125 27.450000000000003 24.3125 23.925 100-101 22.287499999999998 26.4625 25.924999999999997 25.324999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 1.5 29 2.0 30 3.0 31 6.0 32 9.5 33 19.5 34 30.0 35 36.0 36 49.5 37 70.5 38 100.5 39 122.0 40 139.5 41 179.5 42 198.0 43 209.0 44 223.5 45 231.5 46 250.5 47 240.0 48 214.0 49 194.0 50 189.0 51 184.5 52 164.0 53 147.0 54 127.5 55 108.0 56 100.0 57 88.0 58 72.5 59 62.0 60 52.0 61 42.5 62 35.5 63 27.5 64 20.0 65 16.0 66 12.0 67 8.5 68 4.0 69 2.0 70 2.0 71 1.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.075 16-17 0.05 18-19 0.075 20-21 0.05 22-23 0.0375 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.8500000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610850 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610850_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.45525 33.0 31.0 33.0 18.0 34.0 2 30.72975 33.0 31.0 33.0 18.0 34.0 3 30.451 33.0 29.0 33.0 18.0 34.0 4 30.11225 33.0 31.0 33.0 15.0 34.0 5 30.40225 33.0 31.0 33.0 15.0 34.0 6 33.612 38.0 33.0 38.0 16.0 38.0 7 34.06075 38.0 34.0 38.0 16.0 38.0 8 34.065 38.0 34.0 38.0 16.0 38.0 9 33.88925 38.0 34.0 38.0 16.0 38.0 10-11 33.953375 38.0 34.0 38.0 16.0 38.0 12-13 34.096625 38.0 34.0 38.0 16.0 38.0 14-15 33.960750000000004 38.0 33.5 38.0 16.0 38.0 16-17 34.16075 38.0 34.0 38.0 16.0 38.0 18-19 34.02925 38.0 34.0 38.0 16.0 38.0 20-21 33.901250000000005 38.0 33.5 38.0 16.0 38.0 22-23 34.039874999999995 38.0 34.0 38.0 16.0 38.0 24-25 34.21125 38.0 34.0 38.0 20.0 38.0 26-27 33.969750000000005 38.0 34.0 38.0 16.0 38.0 28-29 34.17425 38.0 34.0 38.0 20.0 38.0 30-31 34.392125 38.0 34.5 38.0 24.0 38.0 32-33 34.175 38.0 34.0 38.0 16.0 38.0 34-35 33.9645 38.0 34.0 38.0 20.0 38.0 36-37 34.1805 38.0 34.0 38.0 20.0 38.0 38-39 34.1335 38.0 34.0 38.0 20.0 38.0 40-41 34.23175 38.0 34.0 38.0 16.0 38.0 42-43 34.424125000000004 38.0 35.0 38.0 24.5 38.0 44-45 34.485625 38.0 35.0 38.0 25.0 38.0 46-47 34.274874999999994 38.0 34.0 38.0 16.0 38.0 48-49 34.261875 38.0 34.5 38.0 20.0 38.0 50-51 34.295375 38.0 34.5 38.0 20.5 38.0 52-53 34.212999999999994 38.0 34.0 38.0 20.5 38.0 54-55 34.147875 38.0 34.0 38.0 16.0 38.0 56-57 34.309375 38.0 34.5 38.0 20.0 38.0 58-59 34.209125 38.0 34.0 38.0 20.0 38.0 60-61 34.317625 38.0 34.0 38.0 20.5 38.0 62-63 34.333875 38.0 34.5 38.0 24.5 38.0 64-65 34.123125 38.0 34.0 38.0 16.0 38.0 66-67 34.11875 38.0 34.0 38.0 20.0 38.0 68-69 34.23325 38.0 34.5 38.0 20.0 38.0 70-71 34.128 38.0 34.0 38.0 20.0 38.0 72-73 34.287 38.0 34.0 38.0 20.0 38.0 74-75 33.870375 38.0 34.0 38.0 16.0 38.0 76-77 34.131874999999994 38.0 34.0 38.0 16.0 38.0 78-79 34.126625000000004 38.0 34.0 38.0 16.0 38.0 80-81 34.093625 38.0 34.0 38.0 20.0 38.0 82-83 34.091375 38.0 34.0 38.0 16.0 38.0 84-85 34.106875 38.0 34.0 38.0 20.0 38.0 86-87 34.098375000000004 38.0 34.0 38.0 16.0 38.0 88-89 34.161874999999995 38.0 34.0 38.0 19.5 38.0 90-91 34.054 38.0 34.0 38.0 19.5 38.0 92-93 33.942625 38.0 34.0 38.0 18.0 38.0 94-95 33.675625 38.0 34.0 38.0 15.0 38.0 96-97 25.454375 21.5 19.0 36.0 14.5 38.0 98-99 21.5765 20.5 18.5 22.5 14.0 29.5 100-101 28.78575 30.5 23.5 36.5 15.0 37.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 7.0 18 18.0 19 36.0 20 41.0 21 56.0 22 63.0 23 57.0 24 69.0 25 65.0 26 92.0 27 87.0 28 101.0 29 107.0 30 140.0 31 143.0 32 194.0 33 195.0 34 291.0 35 403.0 36 1234.0 37 600.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.625 14.075 16.5 39.800000000000004 2 29.175 20.25 33.324999999999996 17.25 3 23.625 24.3 26.35 25.724999999999998 4 24.775 30.9 20.65 23.674999999999997 5 28.175 31.15 21.95 18.725 6 23.400000000000002 35.199999999999996 20.4 21.0 7 21.4 17.575 38.725 22.3 8 24.4 22.075 26.650000000000002 26.875 9 24.5 22.625 27.975 24.9 10-11 25.137500000000003 29.262500000000003 21.9625 23.6375 12-13 25.474999999999998 23.225 26.4625 24.837500000000002 14-15 25.75 25.5625 26.487500000000004 22.2 16-17 26.674999999999997 24.9875 25.424999999999997 22.912499999999998 18-19 25.5625 25.5 25.112499999999997 23.825 20-21 25.112499999999997 26.387500000000003 26.0125 22.4875 22-23 25.6125 26.375 24.775 23.2375 24-25 24.975 26.137500000000003 25.525 23.3625 26-27 24.9375 25.575 26.2625 23.225 28-29 25.025 25.5 26.0125 23.4625 30-31 24.5625 26.4125 25.162499999999998 23.8625 32-33 25.412499999999998 26.1625 25.424999999999997 23.0 34-35 24.712500000000002 26.187500000000004 26.525 22.575 36-37 25.4 24.5625 26.325 23.7125 38-39 25.162499999999998 25.9625 25.45 23.425 40-41 25.95 26.05 25.624999999999996 22.375 42-43 25.025 26.6125 25.5625 22.8 44-45 24.8625 26.424999999999997 26.137500000000003 22.575 46-47 25.674999999999997 26.125 24.462500000000002 23.7375 48-49 25.025 25.4625 27.0125 22.5 50-51 26.05 25.275 25.775 22.900000000000002 52-53 25.85 25.424999999999997 25.9625 22.7625 54-55 24.712500000000002 26.0 26.174999999999997 23.1125 56-57 25.525 25.7 26.337500000000002 22.4375 58-59 25.5625 25.3125 25.8 23.325000000000003 60-61 25.775 25.587500000000002 25.775 22.8625 62-63 24.625 26.775 26.674999999999997 21.925 64-65 25.1875 26.237500000000004 25.3 23.275000000000002 66-67 25.424999999999997 26.75 25.474999999999998 22.35 68-69 24.65 26.637499999999996 27.175 21.5375 70-71 26.0125 25.662499999999998 25.674999999999997 22.650000000000002 72-73 25.45 26.187500000000004 26.474999999999998 21.8875 74-75 24.637500000000003 27.4125 25.912499999999998 22.037499999999998 76-77 24.712500000000002 25.7625 26.85 22.675 78-79 24.6 26.787499999999998 26.937499999999996 21.675 80-81 25.3 26.087500000000002 27.0 21.6125 82-83 25.5 26.075 26.724999999999998 21.7 84-85 24.337500000000002 25.8625 27.0125 22.787499999999998 86-87 25.2875 26.787499999999998 26.087500000000002 21.837500000000002 88-89 24.9375 27.250000000000004 25.85 21.9625 90-91 24.5 26.2625 26.7625 22.475 92-93 24.4875 26.187500000000004 26.2625 23.0625 94-95 25.124999999999996 26.200000000000003 25.95 22.725 96-97 25.6125 25.825 25.75 22.8125 98-99 22.925 29.612500000000004 25.05 22.412499999999998 100-101 26.125 26.4625 25.6 21.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.5 28 1.5 29 0.5 30 0.5 31 3.5 32 5.5 33 6.5 34 14.0 35 23.0 36 26.5 37 41.0 38 66.5 39 102.5 40 144.0 41 172.5 42 194.5 43 202.5 44 220.5 45 233.0 46 242.0 47 237.0 48 210.0 49 199.5 50 184.0 51 170.0 52 160.5 53 148.5 54 142.5 55 141.5 56 118.0 57 99.0 58 98.0 59 85.0 60 63.0 61 56.0 62 52.0 63 38.5 64 30.0 65 22.5 66 16.5 67 8.0 68 5.5 69 5.0 70 3.0 71 2.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255076 spots for ERR10610850.sra Written 1255076 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra Read 1255073 spots for ERR10610850.sra Written 1255073 spots for ERR10610850.sra SRR ids: ['ERR10610850.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6fnzwlz3 ERR10610850.sra spots: 25101463 blocks: [[1, 1255073], [1255074, 2510146], [2510147, 3765219], [3765220, 5020292], [5020293, 6275365], [6275366, 7530438], [7530439, 8785511], [8785512, 10040584], [10040585, 11295657], [11295658, 12550730], [12550731, 13805803], [13805804, 15060876], [15060877, 16315949], [16315950, 17571022], [17571023, 18826095], [18826096, 20081168], [20081169, 21336241], [21336242, 22591314], [22591315, 23846387], [23846388, 25101463]] ERR10610850 file size 6057560 ERR10610850 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610850 ERR10610850_1.fastq ERR10610850_2.fastq Input file: ERR10610850_1.fastq Paired file: ERR10610850_2.fastq trimmed: ERR10610850-trimmed-pair1.fastq, ERR10610850-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:12:50 2024 >> started Fri Dec 6 21:13:16 2024 >> done (26.564s) 25101463 read pairs processed; of these: 110 ( 0.00%) short read pairs filtered out after trimming by size control 4064 ( 0.02%) empty read pairs filtered out after trimming by size control 25097289 (99.98%) read pairs available; of these: 790132 ( 3.15%) trimmed read pairs available after processing 24307157 (96.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 3 0.00% 21 4 0.00% 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 4 0.00% 26 2 0.00% 27 7 0.00% 28 4 0.00% 29 10 0.00% 30 9 0.00% 31 14 0.00% 32 19 0.00% 33 21 0.00% 34 17 0.00% 35 35 0.00% 36 48 0.00% 37 49 0.00% 38 60 0.00% 39 78 0.00% 40 67 0.00% 41 90 0.00% 42 93 0.00% 43 109 0.00% 44 96 0.00% 45 137 0.00% 46 161 0.00% 47 171 0.00% 48 203 0.00% 49 241 0.00% 50 295 0.00% 51 338 0.00% 52 351 0.00% 53 382 0.00% 54 405 0.00% 55 473 0.00% 56 540 0.00% 57 562 0.00% 58 694 0.00% 59 759 0.00% 60 912 0.00% 61 1060 0.00% 62 1220 0.00% 63 1264 0.01% 64 1514 0.01% 65 1671 0.01% 66 1889 0.01% 67 2197 0.01% 68 2445 0.01% 69 2716 0.01% 70 2936 0.01% 71 3448 0.01% 72 3876 0.02% 73 4370 0.02% 74 4866 0.02% 75 5632 0.02% 76 6464 0.03% 77 7105 0.03% 78 8050 0.03% 79 9287 0.04% 80 10126 0.04% 81 11241 0.04% 82 12722 0.05% 83 14188 0.06% 84 15874 0.06% 85 17910 0.07% 86 19804 0.08% 87 22446 0.09% 88 24564 0.10% 89 26805 0.11% 90 29586 0.12% 91 33159 0.13% 92 36311 0.14% 93 39330 0.16% 94 42650 0.17% 95 47090 0.19% 96 51278 0.20% 97 56815 0.23% 98 61437 0.24% 99 66582 0.27% 100 70734 0.28% 101 24307157 96.85% 25097289 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=25 prefix-density=0.40 prefix-fanout=2.0 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.13 sequence-density-rank=14 fanout-score=41.60 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=8.7 sequence=ATCATCATCATCCCCGCACCCCATCAACTGCTACGTACGGATGAACTAATTAACACACGCATGCATGCAAATATACGATGCTTAATTAATTAACACCGATCGATCCCCATTAAAACCAAACCACATCGATCAGACGTCGAAGGTGTTCTTGCCGGTGAACTTGACCTCAATCGGGCTAACATTCTTCCCGATGCTCCTGAAATTCTGCCCGACGCCCTGCCTGCCGGCGTTCACCTTCTCCGGGTACACCCCGTCCTTGGGGTGGAGGTACTGCACCTCGCCGCTGGGGAAGACGCGG criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=4.44 fanout-score-rank=13 prefix-density=0.41 prefix-fanout=3.4 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCC criterion=fanout-score sequence-density=0.10 sequence-density-rank=25 fanout-score=26.31 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=6.1 sequence=TGCATGCATGTAAAATTGATTGATGGGACGATATGTCTCTCTAGTTGAAATGGTCGACAATGCACTTAATTTGTGTTGTAAAGTACTACTCCGTGCTAGTGTTATGCATGCTATGTGTATGGATGCATGGTGGATCGAGGAGTGGATGTGATTGGTATGTACATTACAGAGGAAGCTGATGGTTCAGTGCTGTAGTATCTTGTGACGATGAT ERR10610850 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:14:03 Started mapping on | Dec 06 21:14:04 Finished on | Dec 06 21:17:54 Mapping speed, Million of reads per hour | 392.83 Number of input reads | 25097289 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 22235060 Uniquely mapped reads % | 88.60% Average mapped length | 200.06 Number of splices: Total | 13157517 Number of splices: Annotated (sjdb) | 12249249 Number of splices: GT/AG | 12975551 Number of splices: GC/AG | 157341 Number of splices: AT/AC | 5354 Number of splices: Non-canonical | 19271 Mismatch rate per base, % | 0.81% Deletion rate per base | 0.01% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 2.00 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 899063 % of reads mapped to multiple loci | 3.58% Number of reads mapped to too many loci | 56719 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.65% % of reads unmapped: other | 1.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1963166 1963166 1963166 N_multimapping 899063 899063 899063 N_noFeature 987348 21592446 1131493 N_ambiguous 583341 2215 85912 UnstrandedReadsAssigned:20664371 PositiveStrandReadsAssigned:640399 NegativeStrandReadsAssigned:21017655 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610850 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610850-trimmed-pair1.fastq ERR10610850-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,097,289 reads, 21,575,120 reads pseudoaligned [quant] estimated average fragment length: 174.353 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,209 rounds 52973 ERR10610850.ke.tsv 35125 ERR10610850.se.tsv 88098 total ==> ERR10610850.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 762.81 0 0 PNS24247 1044 870.647 78.2145 6.15848 PNS24249 1928 1754.65 13.376 0.522595 PNS24246 1044 870.647 78.2145 6.15848 PNS24248 1044 870.647 78.2145 6.15848 PNS24244 1471 1297.65 114.98 6.07429 PNS24243 293 129.08 0 0 KQK14069 1603 1429.65 3291.86 157.849 KQK14071 474 302.351 80.8091 18.3222 ==> ERR10610850.se.tsv <== BRADI_1g14170v3 3846 BRADI_1g53295v3 138 BRADI_1g59795v3 1157 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 321 BRADI_1g74790v3 83 BRADI_1g09890v3 0 BRADI_1g77505v3 533 BRADI_1g48960v3 0 ERR10610850 completed mapping pipeline successfully