Starting /dee2/code/volunteer_pipeline.sh ERR10610851 current disk space = 1549127507968 free memory = 1413982596 ERR10610851 SRAfilesize 9cef0ca205964d2d27207b92810ee2a6 ERR10610851.sra ERR10610851.sra file validated ERR10610851 is paired end ERR10610851 is conventional basespace ERR10610851 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610851_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.1765 32.0 25.0 33.0 18.0 33.0 2 25.9785 28.0 18.0 31.0 18.0 33.0 3 27.59225 29.0 25.0 31.0 18.0 33.0 4 29.42125 32.0 28.0 33.0 15.0 33.0 5 29.5575 32.0 30.0 33.0 15.0 33.0 6 32.23275 36.0 29.0 38.0 16.0 38.0 7 32.5085 36.0 29.0 38.0 16.0 38.0 8 32.5225 37.0 30.0 38.0 16.0 38.0 9 32.97475 37.0 31.0 38.0 16.0 38.0 10-11 30.511375 34.5 23.0 38.0 16.0 38.0 12-13 33.2515 37.0 31.5 38.0 16.0 38.0 14-15 33.654624999999996 38.0 33.0 38.0 16.0 38.0 16-17 33.774625 38.0 33.0 38.0 16.0 38.0 18-19 33.7975 38.0 34.0 38.0 16.0 38.0 20-21 33.676625 38.0 33.0 38.0 16.0 38.0 22-23 33.848375000000004 38.0 33.5 38.0 16.0 38.0 24-25 33.8235 38.0 34.0 38.0 16.0 38.0 26-27 33.8385 38.0 34.0 38.0 16.0 38.0 28-29 33.526125 38.0 32.5 38.0 16.0 38.0 30-31 33.078875 38.0 30.5 38.0 16.0 38.0 32-33 33.697625 38.0 33.0 38.0 16.0 38.0 34-35 33.9005 38.0 34.0 38.0 16.0 38.0 36-37 33.8185 38.0 34.0 38.0 16.0 38.0 38-39 33.81625 38.0 33.5 38.0 16.0 38.0 40-41 33.66675 38.0 33.5 38.0 16.0 38.0 42-43 33.8005 38.0 33.5 38.0 16.0 38.0 44-45 33.936375 38.0 34.0 38.0 16.0 38.0 46-47 33.800125 38.0 34.0 38.0 16.0 38.0 48-49 33.74025 38.0 33.5 38.0 16.0 38.0 50-51 33.99025 38.0 34.0 38.0 16.0 38.0 52-53 33.943625 38.0 34.0 38.0 16.0 38.0 54-55 33.836625 38.0 33.5 38.0 16.0 38.0 56-57 33.925375 38.0 34.0 38.0 16.0 38.0 58-59 33.928375 38.0 34.0 38.0 16.0 38.0 60-61 34.065124999999995 38.0 34.0 38.0 16.0 38.0 62-63 34.116125 38.0 34.0 38.0 16.0 38.0 64-65 34.117875 38.0 34.0 38.0 16.0 38.0 66-67 34.063 38.0 34.0 38.0 16.0 38.0 68-69 33.975624999999994 38.0 34.0 38.0 16.0 38.0 70-71 33.979124999999996 38.0 34.0 38.0 16.0 38.0 72-73 34.150875 38.0 34.0 38.0 24.0 38.0 74-75 33.999875 38.0 34.0 38.0 16.0 38.0 76-77 33.997875 38.0 34.0 38.0 16.0 38.0 78-79 33.883875 38.0 34.0 38.0 16.0 38.0 80-81 33.95025 38.0 34.0 38.0 16.0 38.0 82-83 33.79975 38.0 34.0 38.0 16.0 38.0 84-85 33.891875 38.0 34.0 38.0 16.0 38.0 86-87 33.741125 38.0 34.0 38.0 16.0 38.0 88-89 33.67700000000001 38.0 34.0 38.0 16.0 38.0 90-91 33.760625000000005 38.0 34.0 38.0 16.0 38.0 92-93 33.694 38.0 33.0 38.0 16.0 38.0 94-95 33.570875 38.0 33.5 38.0 15.0 38.0 96-97 33.714625 38.0 34.0 38.0 15.0 38.0 98-99 33.845124999999996 38.0 34.0 38.0 18.0 38.0 100-101 32.787625 37.0 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 9.0 19 31.0 20 42.0 21 48.0 22 67.0 23 57.0 24 84.0 25 95.0 26 89.0 27 90.0 28 135.0 29 121.0 30 131.0 31 151.0 32 189.0 33 217.0 34 294.0 35 371.0 36 728.0 37 1050.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.428427419354836 9.375 11.920362903225806 53.27620967741935 2 17.474999999999998 17.150000000000002 36.75 28.625 3 18.224999999999998 21.15 26.875 33.75 4 23.425 30.625000000000004 22.725 23.225 5 22.175 32.025 26.85 18.95 6 17.575 33.775 27.975 20.674999999999997 7 15.55 20.8 43.075 20.575 8 17.9 22.425 31.025000000000002 28.65 9 17.849999999999998 22.825 33.675 25.650000000000002 10-11 20.225 30.7125 25.2375 23.825 12-13 20.5375 24.6625 28.050000000000004 26.75 14-15 19.787499999999998 26.5 28.3875 25.324999999999996 16-17 20.953214911183387 27.583187390542907 26.13209907430573 25.331498623967974 18-19 21.290968226169625 28.233675256442332 26.144608456342254 24.330748061045785 20-21 21.375 27.875 26.5625 24.1875 22-23 20.465058132266535 28.01600200025003 26.59082385298162 24.928116014501814 24-25 20.5875 27.35 26.5125 25.55 26-27 21.675 27.5625 26.674999999999997 24.087500000000002 28-29 21.5625 27.05 26.087500000000002 25.3 30-31 21.3125 27.3625 26.724999999999998 24.6 32-33 21.2875 26.474999999999998 26.987499999999997 25.25 34-35 21.4125 26.575 26.487500000000004 25.525 36-37 21.6875 27.750000000000004 25.874999999999996 24.6875 38-39 21.175 27.3875 26.700000000000003 24.7375 40-41 21.712500000000002 27.3 26.6 24.3875 42-43 21.2625 27.0625 26.724999999999998 24.95 44-45 21.525 26.724999999999998 26.5125 25.2375 46-47 21.212500000000002 28.925 25.75 24.1125 48-49 21.512500000000003 26.6625 26.375 25.45 50-51 20.837500000000002 27.85 26.674999999999997 24.637500000000003 52-53 21.6625 26.8375 26.025 25.474999999999998 54-55 21.3125 26.5125 25.974999999999998 26.200000000000003 56-57 20.974999999999998 27.250000000000004 26.224999999999998 25.55 58-59 21.825 26.825 26.424999999999997 24.925 60-61 21.525 27.025 25.887500000000003 25.5625 62-63 21.9 27.5125 25.7875 24.8 64-65 21.9 27.1375 25.5125 25.45 66-67 21.8 27.125 25.650000000000002 25.424999999999997 68-69 22.0 27.037499999999998 26.087500000000002 24.875 70-71 22.95 26.625 26.0625 24.3625 72-73 21.65 27.775 25.387500000000003 25.1875 74-75 22.3625 26.924999999999997 26.1 24.6125 76-77 22.0 26.8 25.650000000000002 25.55 78-79 21.712500000000002 27.525 25.7 25.0625 80-81 21.875 26.724999999999998 26.424999999999997 24.975 82-83 22.175 26.7125 25.662499999999998 25.45 84-85 22.95 26.487500000000004 24.3625 26.200000000000003 86-87 21.475 26.8375 26.5625 25.124999999999996 88-89 22.3 28.0875 25.324999999999996 24.2875 90-91 21.95 26.05 26.2125 25.7875 92-93 22.3125 27.175 25.5625 24.95 94-95 21.9375 26.625 25.5125 25.924999999999997 96-97 21.837500000000002 27.0625 25.587500000000002 25.5125 98-99 22.0875 27.474999999999998 25.887500000000003 24.55 100-101 22.425 27.1625 25.324999999999996 25.087500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 2.0 28 4.0 29 4.5 30 6.0 31 9.5 32 12.0 33 22.5 34 37.5 35 51.0 36 66.0 37 87.0 38 119.0 39 132.0 40 143.0 41 177.0 42 211.5 43 225.0 44 219.5 45 224.0 46 235.0 47 226.5 48 206.0 49 195.5 50 178.5 51 172.0 52 158.5 53 126.5 54 106.0 55 90.5 56 84.5 57 73.5 58 68.0 59 58.5 60 46.5 61 43.5 62 33.5 63 28.5 64 31.5 65 26.0 66 21.0 67 18.0 68 11.0 69 6.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.075 18-19 0.075 20-21 0.0 22-23 0.0125 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47196379180286 98.9 2 0.4777470455116922 0.95 3 0.050289162685441285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.35 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610851 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610851_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.79775 33.0 28.0 33.0 18.0 34.0 2 30.2625 33.0 30.0 33.0 18.0 34.0 3 30.35075 33.0 31.0 33.0 18.0 34.0 4 30.03575 33.0 31.0 33.0 15.0 34.0 5 29.87175 33.0 31.0 33.0 15.0 34.0 6 33.316 38.0 32.0 38.0 16.0 38.0 7 33.88575 38.0 34.0 38.0 16.0 38.0 8 33.46025 38.0 33.0 38.0 16.0 38.0 9 33.7505 38.0 33.0 38.0 16.0 38.0 10-11 33.5625 38.0 33.0 38.0 16.0 38.0 12-13 33.60425 38.0 33.0 38.0 16.0 38.0 14-15 33.548500000000004 38.0 33.0 38.0 16.0 38.0 16-17 33.006625 37.5 31.0 38.0 16.0 38.0 18-19 33.43125 38.0 32.5 38.0 16.0 38.0 20-21 33.53975 38.0 33.0 38.0 16.0 38.0 22-23 33.575374999999994 38.0 33.0 38.0 16.0 38.0 24-25 33.579 38.0 33.5 38.0 16.0 38.0 26-27 33.39875 38.0 32.0 38.0 16.0 38.0 28-29 33.274625 38.0 32.0 38.0 16.0 38.0 30-31 33.454375 38.0 33.0 38.0 16.0 38.0 32-33 33.60125 38.0 33.0 38.0 16.0 38.0 34-35 33.692625 38.0 33.0 38.0 16.0 38.0 36-37 33.45225 38.0 33.0 38.0 16.0 38.0 38-39 33.613625 38.0 33.0 38.0 16.0 38.0 40-41 33.754625000000004 38.0 33.5 38.0 16.0 38.0 42-43 33.30325 38.0 32.0 38.0 16.0 38.0 44-45 33.78775 38.0 33.0 38.0 16.0 38.0 46-47 33.61725 38.0 33.0 38.0 16.0 38.0 48-49 33.630875 38.0 33.5 38.0 16.0 38.0 50-51 33.534375 38.0 33.0 38.0 16.0 38.0 52-53 33.585499999999996 38.0 33.0 38.0 16.0 38.0 54-55 33.3465 38.0 32.0 38.0 16.0 38.0 56-57 33.582875 38.0 33.0 38.0 16.0 38.0 58-59 33.443625 38.0 33.0 38.0 16.0 38.0 60-61 33.6445 38.0 33.0 38.0 16.0 38.0 62-63 33.36525 38.0 33.0 38.0 16.0 38.0 64-65 33.635999999999996 38.0 33.0 38.0 16.0 38.0 66-67 33.574124999999995 38.0 33.0 38.0 16.0 38.0 68-69 33.703875 38.0 33.5 38.0 16.0 38.0 70-71 33.46525 38.0 33.0 38.0 16.0 38.0 72-73 33.584 38.0 33.0 38.0 16.0 38.0 74-75 33.52075 38.0 33.0 38.0 16.0 38.0 76-77 33.35225 38.0 33.0 38.0 16.0 38.0 78-79 33.379125 38.0 33.0 38.0 16.0 38.0 80-81 33.343 38.0 33.0 38.0 16.0 38.0 82-83 33.379374999999996 38.0 33.0 38.0 16.0 38.0 84-85 33.329375 38.0 33.0 38.0 16.0 38.0 86-87 33.467875 38.0 33.0 38.0 15.5 38.0 88-89 33.212875 38.0 33.0 38.0 15.0 38.0 90-91 33.07875 38.0 31.5 38.0 15.0 38.0 92-93 33.341625 38.0 33.0 38.0 15.0 38.0 94-95 33.289875 38.0 33.0 38.0 15.0 38.0 96-97 33.170125 38.0 33.0 38.0 15.0 38.0 98-99 33.245875 38.0 33.0 38.0 15.0 38.0 100-101 32.188625 37.0 29.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 22.0 19 44.0 20 63.0 21 60.0 22 76.0 23 60.0 24 82.0 25 92.0 26 92.0 27 102.0 28 114.0 29 115.0 30 156.0 31 152.0 32 161.0 33 181.0 34 252.0 35 322.0 36 551.0 37 1300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.924999999999997 15.9 14.35 37.824999999999996 2 29.425 20.525 33.25 16.8 3 22.400000000000002 23.925 28.875 24.8 4 27.275 29.975 20.9 21.85 5 29.625 32.375 20.175 17.825 6 22.15 35.075 22.425 20.349999999999998 7 21.95 15.9 39.475 22.675 8 23.875 21.175 26.825 28.125 9 22.975 21.9 29.775000000000002 25.35 10-11 26.400000000000002 28.487499999999997 21.8125 23.3 12-13 26.674999999999997 22.3625 26.437500000000004 24.525 14-15 24.962500000000002 25.7 26.687499999999996 22.650000000000002 16-17 25.874999999999996 25.112499999999997 24.775 24.2375 18-19 25.6125 25.587500000000002 25.587500000000002 23.2125 20-21 25.974999999999998 25.45 26.125 22.45 22-23 25.324999999999996 25.3 25.624999999999996 23.75 24-25 25.2625 25.924999999999997 26.3625 22.45 26-27 25.474999999999998 26.075 25.624999999999996 22.825 28-29 26.200000000000003 24.8 25.9625 23.0375 30-31 25.0125 26.325 26.3 22.3625 32-33 25.674999999999997 26.437500000000004 25.1 22.787499999999998 34-35 25.4625 25.85 25.1875 23.5 36-37 25.924999999999997 25.6125 25.637500000000003 22.825 38-39 24.762500000000003 26.424999999999997 26.05 22.7625 40-41 26.0625 25.775 25.6125 22.55 42-43 25.85 25.825 26.150000000000002 22.175 44-45 25.674999999999997 25.362499999999997 26.6125 22.35 46-47 25.137500000000003 26.474999999999998 25.974999999999998 22.412499999999998 48-49 24.675 26.174999999999997 26.424999999999997 22.725 50-51 25.162499999999998 25.637500000000003 27.037499999999998 22.162499999999998 52-53 25.275 25.7875 26.0625 22.875 54-55 24.1125 27.037499999999998 26.674999999999997 22.175 56-57 25.900000000000002 25.374999999999996 25.924999999999997 22.8 58-59 26.087500000000002 25.1 26.9125 21.9 60-61 25.95 25.874999999999996 26.8125 21.3625 62-63 25.090636329541194 26.26578322290286 26.815851981497683 21.827728466058257 64-65 26.42240840315118 25.13442540952857 25.372014505439537 23.071151681880707 66-67 24.375 27.5125 26.700000000000003 21.4125 68-69 25.25 26.700000000000003 26.2875 21.762500000000003 70-71 26.424999999999997 25.650000000000002 25.662499999999998 22.2625 72-73 24.637500000000003 26.424999999999997 26.55 22.3875 74-75 25.337500000000002 26.625 25.7125 22.325 76-77 26.087500000000002 25.662499999999998 25.7875 22.4625 78-79 24.9125 27.0625 26.1 21.925 80-81 25.6 26.1625 25.825 22.412499999999998 82-83 26.200000000000003 26.1 26.2875 21.4125 84-85 25.2875 26.55 26.700000000000003 21.462500000000002 86-87 24.815601950243778 26.903362920365048 26.64083010376297 21.640205025628205 88-89 26.0625 25.587500000000002 26.1 22.25 90-91 25.403175396924617 25.803225403175396 26.978372296537067 21.81522690336292 92-93 25.0375 26.087500000000002 26.8 22.075 94-95 25.5375 26.474999999999998 26.25 21.7375 96-97 26.0375 25.424999999999997 26.85 21.6875 98-99 25.7 26.474999999999998 26.1 21.725 100-101 26.474999999999998 25.7375 26.35 21.4375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.0 27 0.5 28 0.0 29 0.5 30 2.0 31 4.5 32 7.0 33 10.0 34 18.0 35 32.0 36 45.5 37 56.0 38 71.0 39 102.0 40 132.5 41 169.0 42 189.5 43 195.0 44 221.0 45 232.5 46 234.0 47 227.0 48 209.5 49 195.5 50 190.5 51 170.0 52 154.0 53 156.0 54 129.0 55 109.0 56 108.0 57 99.5 58 84.0 59 81.0 60 70.0 61 52.5 62 50.0 63 41.5 64 32.5 65 28.5 66 24.0 67 20.5 68 17.5 69 11.5 70 7.0 71 3.5 72 1.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0125 64-65 0.0375 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0125 88-89 0.0 90-91 0.0125 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.1875 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.575 0.0 0.0 0.0 0.0 86-87 0.75 0.0 0.0 0.0 0.0 88-89 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764493 spots for ERR10610851.sra Written 764493 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra Read 764487 spots for ERR10610851.sra Written 764487 spots for ERR10610851.sra SRR ids: ['ERR10610851.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_q4ss89kc ERR10610851.sra spots: 15289746 blocks: [[1, 764487], [764488, 1528974], [1528975, 2293461], [2293462, 3057948], [3057949, 3822435], [3822436, 4586922], [4586923, 5351409], [5351410, 6115896], [6115897, 6880383], [6880384, 7644870], [7644871, 8409357], [8409358, 9173844], [9173845, 9938331], [9938332, 10702818], [10702819, 11467305], [11467306, 12231792], [12231793, 12996279], [12996280, 13760766], [13760767, 14525253], [14525254, 15289746]] ERR10610851 file size 3681284 ERR10610851 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610851 ERR10610851_1.fastq ERR10610851_2.fastq Input file: ERR10610851_1.fastq Paired file: ERR10610851_2.fastq trimmed: ERR10610851-trimmed-pair1.fastq, ERR10610851-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:13:22 2024 >> started Fri Dec 6 21:13:38 2024 >> done (15.459s) 15289746 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 1199 ( 0.01%) empty read pairs filtered out after trimming by size control 15288501 (99.99%) read pairs available; of these: 563061 ( 3.68%) trimmed read pairs available after processing 14725440 (96.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 3 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 1 0.00% 26 1 0.00% 27 1 0.00% 28 1 0.00% 29 1 0.00% 30 5 0.00% 31 6 0.00% 32 15 0.00% 33 5 0.00% 34 10 0.00% 35 14 0.00% 36 14 0.00% 37 25 0.00% 38 25 0.00% 39 29 0.00% 40 26 0.00% 41 49 0.00% 42 47 0.00% 43 69 0.00% 44 57 0.00% 45 77 0.00% 46 105 0.00% 47 109 0.00% 48 117 0.00% 49 153 0.00% 50 163 0.00% 51 223 0.00% 52 233 0.00% 53 237 0.00% 54 252 0.00% 55 292 0.00% 56 347 0.00% 57 403 0.00% 58 442 0.00% 59 529 0.00% 60 647 0.00% 61 711 0.00% 62 816 0.01% 63 880 0.01% 64 964 0.01% 65 1162 0.01% 66 1261 0.01% 67 1391 0.01% 68 1673 0.01% 69 1834 0.01% 70 2031 0.01% 71 2437 0.02% 72 2730 0.02% 73 3144 0.02% 74 3540 0.02% 75 4023 0.03% 76 4574 0.03% 77 5043 0.03% 78 5664 0.04% 79 6527 0.04% 80 7181 0.05% 81 8020 0.05% 82 8835 0.06% 83 10304 0.07% 84 11466 0.07% 85 12984 0.08% 86 14383 0.09% 87 15891 0.10% 88 17493 0.11% 89 19680 0.13% 90 21474 0.14% 91 23695 0.15% 92 25785 0.17% 93 27988 0.18% 94 31081 0.20% 95 33784 0.22% 96 36689 0.24% 97 40858 0.27% 98 43533 0.28% 99 46673 0.31% 100 50123 0.33% 101 14725440 96.32% 15288501 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=16 prefix-density=0.24 prefix-fanout=2.9 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=30.98 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TTTGCTCATTCTTTTTTCATTCATTCATAGGGATAGCGAACGGAACAGAACAGGAACACACGACAGGTAGCATCACGGACAAACACCTAATGGTAACCCTTAAACATCTCAAACCCTACGCGATGGAGCGAGATCTAGGATACTCGGGAGCGATAACATCACAGATAAAAGGTAACAAGGATAACTGGCCACGAGGGGCCCCACCATT criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=32 prefix-density=0.31 prefix-fanout=2.1 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=25 fanout-score=102.03 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=14.7 sequence=AGGAGAAGAAGAGCCTCGAGTGGATGGAGAGGCGAATCAAGCCGGCGGCCATCAAGATCGACGACAGGACCCGCGACGCCAAGGACAACTCCTCGTTACCCTTGGTGCTCAAGAAGGGCAGGATGGAGTACCTGCCGGTGGAGAGGCCAAAGAAGGACGGCACCAAGACGGACGAGGTGTTGGTGGTTGACGTCACGCTGGACCCGTGCGAGCAAGTCAAGTTCGACGTGCTCGTCAACGTGCCCAGAGGCGAGGAAGACAAGGTGGGCCCACAGAACAGCCAGTTCGCCGGATCCTTCTCCACGGTGCCGCACGGCGGCACCATGACCGGCTCCGCCACGACGAAGCCGGTCGTGTCGTGCCGCTTCAAGCTCCAGGAGCTCATCCAAGACCTCAACTGCAACAGGAGCAAGATGCTCAACATCACCCTCGTCCCGGTCGAAGGTGACAAGACCATCGTCGACAACCTGCGCGTCGAGCTTTGCTGATCTATCGGACTAATTAAGATACA ERR10610851 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:14:20 Started mapping on | Dec 06 21:14:20 Finished on | Dec 06 21:16:57 Mapping speed, Million of reads per hour | 350.56 Number of input reads | 15288501 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 13845051 Uniquely mapped reads % | 90.56% Average mapped length | 200.13 Number of splices: Total | 7228120 Number of splices: Annotated (sjdb) | 6719998 Number of splices: GT/AG | 7123140 Number of splices: GC/AG | 95442 Number of splices: AT/AC | 3789 Number of splices: Non-canonical | 5749 Mismatch rate per base, % | 0.75% Deletion rate per base | 0.00% Deletion average length | 1.34 Insertion rate per base | 0.00% Insertion average length | 1.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 277641 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 24214 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.10% % of reads unmapped: other | 1.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1165809 1165809 1165809 N_multimapping 277641 277641 277641 N_noFeature 489139 13391078 584460 N_ambiguous 399680 1389 41743 UnstrandedReadsAssigned:12956232 PositiveStrandReadsAssigned:452584 NegativeStrandReadsAssigned:13218848 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610851 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610851-trimmed-pair1.fastq ERR10610851-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,288,501 reads, 13,562,833 reads pseudoaligned [quant] estimated average fragment length: 166.539 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52973 ERR10610851.ke.tsv 35125 ERR10610851.se.tsv 88098 total ==> ERR10610851.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 770.605 0 0 PNS24247 1044 878.461 59.4121 7.20587 PNS24249 1928 1762.46 17.8146 1.07694 PNS24246 1044 878.461 59.4121 7.20587 PNS24248 1044 878.461 59.4121 7.20587 PNS24244 1471 1305.46 207.949 16.9717 PNS24243 293 133.065 0 0 KQK14069 1603 1437.46 6226.37 461.501 KQK14071 474 309.712 115.792 39.8341 ==> ERR10610851.se.tsv <== BRADI_1g14170v3 6871 BRADI_1g53295v3 142 BRADI_1g59795v3 467 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 367 BRADI_1g74790v3 185 BRADI_1g09890v3 0 BRADI_1g77505v3 421 BRADI_1g48960v3 0 ERR10610851 completed mapping pipeline successfully