Starting /dee2/code/volunteer_pipeline.sh ERR10610853 current disk space = 1549069901824 free memory = 1598023656 ERR10610853 SRAfilesize 7ecd3e2fbebba19c83e5054107cac074 ERR10610853.sra ERR10610853.sra file validated ERR10610853 is paired end ERR10610853 is conventional basespace ERR10610853 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610853_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.955 18.0 18.0 30.0 18.0 32.0 2 28.289 29.0 27.0 31.0 18.0 33.0 3 28.39725 31.0 27.0 33.0 18.0 33.0 4 29.84875 32.0 30.0 33.0 15.0 33.0 5 30.11725 33.0 31.0 33.0 15.0 33.0 6 32.21725 36.0 29.0 38.0 16.0 38.0 7 33.12775 37.0 31.0 38.0 16.0 38.0 8 33.4485 37.0 33.0 38.0 16.0 38.0 9 33.62175 38.0 33.0 38.0 16.0 38.0 10-11 30.738875 35.0 23.0 38.0 16.0 38.0 12-13 33.509875 37.5 32.0 38.0 16.0 38.0 14-15 34.033 38.0 33.5 38.0 16.0 38.0 16-17 34.221999999999994 38.0 34.0 38.0 20.0 38.0 18-19 34.19425 38.0 34.0 38.0 16.0 38.0 20-21 33.97325 38.0 34.0 38.0 16.0 38.0 22-23 34.039375 38.0 34.0 38.0 20.5 38.0 24-25 34.096875 38.0 34.0 38.0 16.0 38.0 26-27 34.052 38.0 34.0 38.0 20.0 38.0 28-29 33.776250000000005 38.0 33.5 38.0 16.0 38.0 30-31 33.259125 38.0 32.0 38.0 16.0 38.0 32-33 33.816125 38.0 34.0 38.0 16.0 38.0 34-35 33.8185 38.0 34.0 38.0 16.0 38.0 36-37 34.0025 38.0 34.0 38.0 16.0 38.0 38-39 33.952375 38.0 34.0 38.0 16.0 38.0 40-41 33.94 38.0 34.0 38.0 16.0 38.0 42-43 34.127624999999995 38.0 34.0 38.0 20.0 38.0 44-45 34.056625 38.0 34.0 38.0 20.0 38.0 46-47 33.9685 38.0 34.0 38.0 16.0 38.0 48-49 33.997875 38.0 34.0 38.0 16.0 38.0 50-51 34.133624999999995 38.0 34.0 38.0 16.0 38.0 52-53 34.119375 38.0 34.0 38.0 20.0 38.0 54-55 34.076375 38.0 34.0 38.0 16.0 38.0 56-57 34.124125 38.0 34.0 38.0 20.0 38.0 58-59 34.151375 38.0 34.0 38.0 20.0 38.0 60-61 34.290875 38.0 34.5 38.0 24.0 38.0 62-63 34.32625 38.0 34.0 38.0 24.0 38.0 64-65 34.395375 38.0 34.5 38.0 24.5 38.0 66-67 34.378625 38.0 34.5 38.0 24.5 38.0 68-69 34.08925 38.0 34.0 38.0 16.0 38.0 70-71 34.165625 38.0 34.0 38.0 16.0 38.0 72-73 34.417 38.0 34.5 38.0 24.5 38.0 74-75 34.235625 38.0 34.0 38.0 16.0 38.0 76-77 34.323125 38.0 34.0 38.0 24.0 38.0 78-79 34.038 38.0 34.0 38.0 16.0 38.0 80-81 34.0505 38.0 34.0 38.0 20.0 38.0 82-83 34.036625 38.0 34.0 38.0 16.0 38.0 84-85 34.156125 38.0 34.0 38.0 22.5 38.0 86-87 34.091125 38.0 34.0 38.0 19.5 38.0 88-89 33.956375 38.0 34.0 38.0 20.0 38.0 90-91 33.89725 38.0 34.0 38.0 16.0 38.0 92-93 33.578875 38.0 33.5 38.0 15.0 38.0 94-95 33.772875 38.0 34.0 38.0 15.5 38.0 96-97 34.058 38.0 34.0 38.0 22.0 38.0 98-99 33.9215 38.0 34.0 38.0 18.0 38.0 100-101 33.026875000000004 37.0 31.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 16.0 19 34.0 20 42.0 21 45.0 22 60.0 23 57.0 24 72.0 25 73.0 26 74.0 27 97.0 28 94.0 29 109.0 30 128.0 31 149.0 32 182.0 33 215.0 34 289.0 35 398.0 36 810.0 37 1053.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.549658832448824 15.137730603992924 10.083396512509477 49.22921405104878 2 21.95 17.925 38.824999999999996 21.3 3 23.025000000000002 21.05 23.825 32.1 4 27.500000000000004 27.325 20.225 24.95 5 26.5 30.775000000000002 24.349999999999998 18.375 6 21.955488872218055 33.083270817704424 24.48112028007002 20.4801200300075 7 16.25 21.75 41.725 20.275000000000002 8 21.375 22.1 31.15 25.374999999999996 9 20.7 20.1 33.45 25.75 10-11 23.375 28.9875 24.099999999999998 23.5375 12-13 21.8 24.3625 26.9125 26.924999999999997 14-15 22.0625 25.3125 27.3125 25.3125 16-17 21.8 25.7625 27.462500000000002 24.975 18-19 21.8625 26.674999999999997 26.337500000000002 25.124999999999996 20-21 21.7 25.9875 26.7125 25.6 22-23 22.475 26.1 26.025 25.4 24-25 22.3625 25.4875 26.5625 25.587500000000002 26-27 21.85 26.5625 25.95 25.637500000000003 28-29 22.0 26.150000000000002 26.900000000000002 24.95 30-31 22.8 25.624999999999996 26.3625 25.2125 32-33 22.5125 25.424999999999997 27.1 24.962500000000002 34-35 23.275000000000002 26.237500000000004 25.837500000000002 24.65 36-37 22.900000000000002 25.937500000000004 25.4875 25.674999999999997 38-39 22.650000000000002 26.1625 26.724999999999998 24.462500000000002 40-41 22.275 26.2125 26.3125 25.2 42-43 22.275 25.1875 26.724999999999998 25.8125 44-45 22.7125 25.362499999999997 25.974999999999998 25.95 46-47 22.8875 26.737499999999997 25.7 24.675 48-49 22.3 26.2875 25.7375 25.674999999999997 50-51 22.975 26.4625 26.5125 24.05 52-53 23.3625 25.937500000000004 25.2125 25.4875 54-55 22.412499999999998 25.5 26.5375 25.55 56-57 22.425 26.35 26.3 24.925 58-59 22.525000000000002 25.424999999999997 25.900000000000002 26.150000000000002 60-61 22.6875 25.337500000000002 26.650000000000002 25.324999999999996 62-63 22.45 25.4875 26.5375 25.525 64-65 22.8 26.437500000000004 26.2625 24.5 66-67 22.6875 25.974999999999998 26.0 25.337500000000002 68-69 22.912499999999998 26.1125 26.337500000000002 24.637500000000003 70-71 22.8 26.35 25.387500000000003 25.4625 72-73 22.85 24.9125 26.237500000000004 26.0 74-75 22.675 25.9625 26.2875 25.074999999999996 76-77 22.4375 26.1625 25.937500000000004 25.4625 78-79 23.3 26.05 25.0625 25.587500000000002 80-81 23.3125 25.912499999999998 25.8 24.975 82-83 22.537499999999998 26.575 25.474999999999998 25.412499999999998 84-85 22.8625 25.174999999999997 26.125 25.837500000000002 86-87 22.45 25.25 26.6 25.7 88-89 24.025 25.587500000000002 25.337500000000002 25.05 90-91 23.5375 26.25 25.3 24.9125 92-93 23.225 25.1 26.0 25.674999999999997 94-95 23.05 25.650000000000002 25.75 25.55 96-97 23.05 25.5375 25.912499999999998 25.5 98-99 23.400000000000002 25.5375 26.125 24.9375 100-101 23.1625 25.362499999999997 25.85 25.624999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.5 26 2.0 27 1.0 28 1.5 29 2.5 30 2.0 31 6.5 32 10.5 33 13.0 34 23.0 35 32.5 36 41.5 37 56.0 38 84.5 39 110.5 40 132.5 41 182.5 42 212.5 43 210.0 44 214.5 45 231.5 46 222.5 47 210.0 48 204.0 49 187.0 50 181.0 51 147.0 52 133.5 53 140.0 54 117.0 55 104.0 56 99.0 57 88.0 58 87.0 59 80.5 60 71.0 61 64.5 62 56.0 63 51.5 64 41.0 65 30.5 66 32.5 67 32.0 68 19.0 69 10.0 70 7.5 71 4.5 72 2.0 73 1.0 74 1.5 75 1.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62330487192365 99.175 2 0.30135610246107486 0.6 3 0.07533902561526871 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.5125 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.775 0.0 0.0 0.0 0.0 88-89 1.0125000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610853 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610853_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.819 33.0 28.0 33.0 18.0 34.0 2 30.384 33.0 31.0 33.0 18.0 34.0 3 30.4645 33.0 31.0 33.0 18.0 34.0 4 30.158 33.0 31.0 33.0 15.0 34.0 5 30.0015 33.0 31.0 33.0 15.0 34.0 6 33.48675 38.0 33.0 38.0 16.0 38.0 7 33.90775 38.0 34.0 38.0 16.0 38.0 8 33.52825 38.0 33.0 38.0 16.0 38.0 9 33.70625 38.0 33.0 38.0 16.0 38.0 10-11 33.555625 38.0 33.0 38.0 16.0 38.0 12-13 33.58775 38.0 33.0 38.0 16.0 38.0 14-15 33.570375 38.0 33.0 38.0 16.0 38.0 16-17 32.932874999999996 37.5 31.0 38.0 16.0 38.0 18-19 33.491 38.0 32.0 38.0 16.0 38.0 20-21 33.618125 38.0 33.5 38.0 16.0 38.0 22-23 33.5475 38.0 33.0 38.0 16.0 38.0 24-25 33.81 38.0 33.5 38.0 16.0 38.0 26-27 33.46425 38.0 33.0 38.0 16.0 38.0 28-29 33.336625 38.0 32.5 38.0 16.0 38.0 30-31 33.43625 38.0 33.0 38.0 16.0 38.0 32-33 33.593125 38.0 33.0 38.0 16.0 38.0 34-35 33.639375 38.0 33.0 38.0 16.0 38.0 36-37 33.398250000000004 38.0 33.0 38.0 16.0 38.0 38-39 33.7 38.0 33.0 38.0 16.0 38.0 40-41 33.694874999999996 38.0 33.5 38.0 16.0 38.0 42-43 33.33625 38.0 32.5 38.0 16.0 38.0 44-45 33.6185 38.0 33.5 38.0 16.0 38.0 46-47 33.532 38.0 33.0 38.0 16.0 38.0 48-49 33.651375 38.0 33.5 38.0 16.0 38.0 50-51 33.542375 38.0 33.0 38.0 16.0 38.0 52-53 33.568625 38.0 33.0 38.0 16.0 38.0 54-55 33.401375 38.0 33.0 38.0 16.0 38.0 56-57 33.450375 38.0 33.0 38.0 16.0 38.0 58-59 33.496 38.0 33.0 38.0 16.0 38.0 60-61 33.65575 38.0 33.0 38.0 16.0 38.0 62-63 33.44825 38.0 33.0 38.0 16.0 38.0 64-65 33.701499999999996 38.0 33.5 38.0 16.0 38.0 66-67 33.561375 38.0 33.5 38.0 16.0 38.0 68-69 33.614375 38.0 33.0 38.0 16.0 38.0 70-71 33.570499999999996 38.0 33.0 38.0 16.0 38.0 72-73 33.500625 38.0 33.0 38.0 16.0 38.0 74-75 33.51625 38.0 33.0 38.0 16.0 38.0 76-77 33.3815 38.0 33.0 38.0 16.0 38.0 78-79 33.43475 38.0 33.0 38.0 16.0 38.0 80-81 33.217749999999995 38.0 32.0 38.0 16.0 38.0 82-83 33.32925 38.0 33.0 38.0 16.0 38.0 84-85 33.429625 38.0 33.5 38.0 16.0 38.0 86-87 33.3585 38.0 33.0 38.0 15.0 38.0 88-89 33.15625 38.0 32.5 38.0 15.0 38.0 90-91 33.2565 38.0 33.0 38.0 15.0 38.0 92-93 33.213 38.0 33.0 38.0 15.0 38.0 94-95 33.187 38.0 33.0 38.0 15.0 38.0 96-97 33.078625 38.0 32.0 38.0 15.0 38.0 98-99 33.0835 38.0 32.0 38.0 15.0 38.0 100-101 31.850499999999997 36.5 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 7.0 18 20.0 19 43.0 20 66.0 21 61.0 22 83.0 23 70.0 24 77.0 25 80.0 26 93.0 27 83.0 28 106.0 29 122.0 30 150.0 31 164.0 32 159.0 33 189.0 34 233.0 35 369.0 36 566.0 37 1259.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.225 14.499999999999998 14.2 41.075 2 26.424999999999997 21.65 33.525 18.4 3 22.425 24.95 26.924999999999997 25.7 4 25.85 30.325000000000003 20.424999999999997 23.400000000000002 5 27.35 32.15 21.675 18.825 6 22.925 35.375 22.2 19.5 7 21.125 16.425 39.050000000000004 23.400000000000002 8 23.025000000000002 22.3 26.3 28.375 9 23.474999999999998 22.375 27.950000000000003 26.200000000000003 10-11 27.05 27.8125 21.212500000000002 23.925 12-13 25.575 23.625 24.725 26.075 14-15 24.975 26.224999999999998 25.5375 23.2625 16-17 26.325 24.85 24.8125 24.0125 18-19 25.3 26.6125 24.637500000000003 23.45 20-21 25.4875 26.6625 24.325 23.525 22-23 24.6875 25.3 25.2375 24.775 24-25 24.837500000000002 25.5125 25.0625 24.587500000000002 26-27 25.525 26.075 24.637500000000003 23.7625 28-29 25.074999999999996 26.137500000000003 25.3125 23.474999999999998 30-31 25.4625 25.937500000000004 25.162499999999998 23.4375 32-33 25.35 25.7125 24.8625 24.075 34-35 24.925 25.837500000000002 25.95 23.2875 36-37 24.65 25.2375 26.087500000000002 24.025 38-39 24.837500000000002 26.2125 25.224999999999998 23.724999999999998 40-41 25.7875 26.950000000000003 24.7375 22.525000000000002 42-43 25.4875 26.0375 25.474999999999998 23.0 44-45 25.412499999999998 25.5625 25.324999999999996 23.7 46-47 25.2 25.0625 25.575 24.1625 48-49 25.15 25.25 25.2875 24.3125 50-51 25.362499999999997 26.8375 25.2625 22.537499999999998 52-53 26.187500000000004 25.5 24.7875 23.525 54-55 25.387500000000003 25.8125 25.575 23.225 56-57 25.35 25.224999999999998 26.337500000000002 23.0875 58-59 26.0375 26.224999999999998 25.424999999999997 22.3125 60-61 24.875 25.374999999999996 26.55 23.200000000000003 62-63 24.8125 25.2 26.0 23.9875 64-65 24.696761285482054 26.43491309240965 25.734650493935224 23.133675128173063 66-67 25.4375 26.5875 25.374999999999996 22.6 68-69 25.4 26.0 25.55 23.05 70-71 24.875 25.887500000000003 26.5375 22.7 72-73 25.8625 25.6 25.924999999999997 22.6125 74-75 24.5125 26.125 26.137500000000003 23.225 76-77 25.412499999999998 25.5625 26.1625 22.8625 78-79 25.5375 26.3 24.425 23.7375 80-81 26.0125 25.624999999999996 25.4375 22.925 82-83 25.362499999999997 26.137500000000003 25.924999999999997 22.575 84-85 25.124999999999996 24.9875 26.25 23.6375 86-87 25.025 26.4125 25.825 22.7375 88-89 25.2625 25.825 25.912499999999998 23.0 90-91 24.5 27.150000000000002 25.624999999999996 22.725 92-93 24.474999999999998 26.375 25.587500000000002 23.5625 94-95 25.8 26.224999999999998 25.3125 22.662499999999998 96-97 25.8125 26.5625 25.05 22.575 98-99 26.087500000000002 26.487500000000004 25.0375 22.3875 100-101 25.775 26.400000000000002 25.05 22.775000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 2.5 29 3.5 30 3.5 31 4.0 32 6.0 33 12.0 34 17.0 35 25.5 36 36.5 37 54.0 38 76.5 39 100.5 40 134.5 41 159.0 42 180.0 43 205.0 44 209.0 45 211.5 46 224.0 47 230.0 48 208.5 49 175.0 50 163.5 51 147.0 52 129.0 53 128.0 54 128.5 55 116.5 56 104.5 57 87.5 58 82.0 59 95.5 60 92.5 61 78.0 62 66.5 63 58.5 64 52.5 65 45.5 66 41.0 67 33.0 68 22.0 69 19.5 70 13.0 71 6.0 72 3.5 73 2.0 74 1.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0375 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0125 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1125 0.0 0.0 0.0 0.0 66-67 0.1375 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.725 0.0 0.0 0.0 0.0 86-87 0.8 0.0 0.0 0.0 0.0 88-89 1.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682814 spots for ERR10610853.sra Written 682814 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra Read 682806 spots for ERR10610853.sra Written 682806 spots for ERR10610853.sra SRR ids: ['ERR10610853.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mdk1u1k0 ERR10610853.sra spots: 13656128 blocks: [[1, 682806], [682807, 1365612], [1365613, 2048418], [2048419, 2731224], [2731225, 3414030], [3414031, 4096836], [4096837, 4779642], [4779643, 5462448], [5462449, 6145254], [6145255, 6828060], [6828061, 7510866], [7510867, 8193672], [8193673, 8876478], [8876479, 9559284], [9559285, 10242090], [10242091, 10924896], [10924897, 11607702], [11607703, 12290508], [12290509, 12973314], [12973315, 13656128]] ERR10610853 file size 3285643 ERR10610853 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610853 ERR10610853_1.fastq ERR10610853_2.fastq Input file: ERR10610853_1.fastq Paired file: ERR10610853_2.fastq trimmed: ERR10610853-trimmed-pair1.fastq, ERR10610853-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:19:19 2024 >> started Fri Dec 6 21:19:32 2024 >> done (12.596s) 13656128 read pairs processed; of these: 38 ( 0.00%) short read pairs filtered out after trimming by size control 744 ( 0.01%) empty read pairs filtered out after trimming by size control 13655346 (99.99%) read pairs available; of these: 432966 ( 3.17%) trimmed read pairs available after processing 13222380 (96.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 2 0.00% 23 0 0.00% 24 1 0.00% 25 0 0.00% 26 3 0.00% 27 3 0.00% 28 0 0.00% 29 3 0.00% 30 5 0.00% 31 5 0.00% 32 9 0.00% 33 6 0.00% 34 18 0.00% 35 12 0.00% 36 19 0.00% 37 22 0.00% 38 17 0.00% 39 88 0.00% 40 30 0.00% 41 43 0.00% 42 40 0.00% 43 47 0.00% 44 62 0.00% 45 60 0.00% 46 74 0.00% 47 91 0.00% 48 98 0.00% 49 107 0.00% 50 137 0.00% 51 150 0.00% 52 193 0.00% 53 213 0.00% 54 190 0.00% 55 232 0.00% 56 271 0.00% 57 282 0.00% 58 351 0.00% 59 399 0.00% 60 490 0.00% 61 518 0.00% 62 622 0.00% 63 706 0.01% 64 788 0.01% 65 900 0.01% 66 968 0.01% 67 1185 0.01% 68 1209 0.01% 69 1359 0.01% 70 1646 0.01% 71 1812 0.01% 72 2068 0.02% 73 2384 0.02% 74 2661 0.02% 75 3069 0.02% 76 3508 0.03% 77 3958 0.03% 78 4434 0.03% 79 5030 0.04% 80 5466 0.04% 81 5981 0.04% 82 6988 0.05% 83 7773 0.06% 84 8643 0.06% 85 9802 0.07% 86 11027 0.08% 87 12029 0.09% 88 13523 0.10% 89 15025 0.11% 90 16262 0.12% 91 18104 0.13% 92 20013 0.15% 93 21528 0.16% 94 24230 0.18% 95 25783 0.19% 96 27735 0.20% 97 31103 0.23% 98 33327 0.24% 99 36457 0.27% 100 39562 0.29% 101 13222380 96.83% 13655346 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=25 prefix-density=0.28 prefix-fanout=2.2 sequence=GTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.04 sequence-density-rank=27 fanout-score=24.50 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=4.5 sequence=CCGCACTTGCACTTGCCGTCGTTCTCCGCCGCGGACTCCTGCACCTCGAAGTGGCTCTTCTCGGTGTCAACCATGACGATGCCGTAGCCGTTTCCCTTCTTCACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGCCGCAGCCGCTCGACATGGTGGCCTTAACTTGCTGGGGAGATCGAGTACACGAATCAGCTGTGTTTTGCCTGT criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.03 fanout-score-rank=12 prefix-density=0.26 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=37 fanout-score=35.18 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=4.7 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTTCCGCTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC ERR10610853 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:20:08 Started mapping on | Dec 06 21:20:09 Finished on | Dec 06 21:23:15 Mapping speed, Million of reads per hour | 264.30 Number of input reads | 13655346 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 12444276 Uniquely mapped reads % | 91.13% Average mapped length | 199.90 Number of splices: Total | 8465410 Number of splices: Annotated (sjdb) | 7975629 Number of splices: GT/AG | 8339693 Number of splices: GC/AG | 100397 Number of splices: AT/AC | 3251 Number of splices: Non-canonical | 22069 Mismatch rate per base, % | 0.97% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 240172 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 9948 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.46% % of reads unmapped: other | 0.58% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 970898 970898 970898 N_multimapping 240172 240172 240172 N_noFeature 452196 12092759 529332 N_ambiguous 315993 1260 42119 UnstrandedReadsAssigned:11676087 PositiveStrandReadsAssigned:350257 NegativeStrandReadsAssigned:11872825 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610853 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610853-trimmed-pair1.fastq ERR10610853-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,655,346 reads, 12,121,375 reads pseudoaligned [quant] estimated average fragment length: 172.95 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 ERR10610853.ke.tsv 35125 ERR10610853.se.tsv 88098 total ==> ERR10610853.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 764.163 0 0 PNS24247 1044 872.05 26.0526 3.72995 PNS24249 1928 1756.05 12.1701 0.865268 PNS24246 1044 872.05 26.0526 3.72995 PNS24248 1044 872.05 26.0526 3.72995 PNS24244 1471 1299.05 75.672 7.27281 PNS24243 293 128.981 0 0 KQK14069 1603 1431.05 290.233 25.3212 KQK14071 474 303.691 6.76285 2.7803 ==> ERR10610853.se.tsv <== BRADI_1g14170v3 346 BRADI_1g53295v3 953 BRADI_1g59795v3 103 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 340 BRADI_1g74790v3 64 BRADI_1g09890v3 0 BRADI_1g77505v3 327 BRADI_1g48960v3 0 ERR10610853 completed mapping pipeline successfully