Starting /dee2/code/volunteer_pipeline.sh ERR10610854 current disk space = 1549088133120 free memory = 1369479760 ERR10610854 SRAfilesize a2b04d70d1701b6758908c07268ce8aa ERR10610854.sra ERR10610854.sra file validated ERR10610854 is paired end ERR10610854 is conventional basespace ERR10610854 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610854_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.617 32.0 27.0 33.0 18.0 33.0 2 30.3505 33.0 30.0 33.0 18.0 33.0 3 30.66175 33.0 31.0 33.0 25.0 34.0 4 30.64575 33.0 31.0 33.0 25.0 34.0 5 30.7315 33.0 32.0 33.0 25.0 34.0 6 33.073 37.0 31.0 38.0 16.0 38.0 7 33.25175 37.0 32.0 38.0 16.0 38.0 8 32.831 37.0 31.0 38.0 16.0 38.0 9 33.201 38.0 31.0 38.0 16.0 38.0 10-11 33.4775 38.0 33.0 38.0 16.0 38.0 12-13 33.627125 38.0 33.5 38.0 16.0 38.0 14-15 33.678375 38.0 33.5 38.0 16.0 38.0 16-17 33.693 38.0 33.0 38.0 16.0 38.0 18-19 33.56375 38.0 33.0 38.0 16.0 38.0 20-21 33.673375 38.0 33.0 38.0 16.0 38.0 22-23 33.760125 38.0 33.5 38.0 16.0 38.0 24-25 33.256125 37.5 32.0 38.0 16.0 38.0 26-27 33.666125 38.0 33.0 38.0 16.0 38.0 28-29 33.768375000000006 38.0 33.5 38.0 16.0 38.0 30-31 33.8745 38.0 33.5 38.0 16.0 38.0 32-33 33.9955 38.0 34.0 38.0 16.0 38.0 34-35 34.131 38.0 34.0 38.0 20.5 38.0 36-37 33.9285 38.0 34.0 38.0 16.0 38.0 38-39 33.99125 38.0 34.0 38.0 16.0 38.0 40-41 33.828 38.0 33.5 38.0 16.0 38.0 42-43 33.8755 38.0 33.5 38.0 16.0 38.0 44-45 34.015875 38.0 34.0 38.0 16.0 38.0 46-47 33.792125 38.0 33.5 38.0 16.0 38.0 48-49 33.93775 38.0 34.0 38.0 16.0 38.0 50-51 33.852125 38.0 34.0 38.0 16.0 38.0 52-53 33.729 38.0 33.5 38.0 16.0 38.0 54-55 33.6565 38.0 33.5 38.0 16.0 38.0 56-57 33.792125 38.0 33.5 38.0 16.0 38.0 58-59 33.656625 38.0 33.0 38.0 16.0 38.0 60-61 33.82225 38.0 33.5 38.0 16.0 38.0 62-63 33.664625 38.0 33.0 38.0 16.0 38.0 64-65 33.735375000000005 38.0 33.5 38.0 16.0 38.0 66-67 33.816375 38.0 34.0 38.0 16.0 38.0 68-69 33.835499999999996 38.0 33.5 38.0 16.0 38.0 70-71 33.755624999999995 38.0 34.0 38.0 16.0 38.0 72-73 33.715 38.0 33.5 38.0 16.0 38.0 74-75 33.774125 38.0 34.0 38.0 16.0 38.0 76-77 33.7115 38.0 34.0 38.0 15.5 38.0 78-79 33.729749999999996 38.0 34.0 38.0 16.0 38.0 80-81 33.85225 38.0 34.0 38.0 15.5 38.0 82-83 33.590625 38.0 34.0 38.0 15.0 38.0 84-85 33.691625 38.0 34.0 38.0 15.5 38.0 86-87 33.487750000000005 38.0 33.5 38.0 15.5 38.0 88-89 33.263374999999996 38.0 33.0 38.0 15.0 38.0 90-91 33.62925 38.0 33.5 38.0 15.0 38.0 92-93 33.38125 38.0 33.0 38.0 15.0 38.0 94-95 33.4355 38.0 33.5 38.0 15.0 38.0 96-97 33.312875000000005 38.0 33.0 38.0 15.0 38.0 98-99 32.745625000000004 37.0 31.0 38.0 15.0 38.0 100-101 32.108999999999995 36.5 29.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 2.0 18 16.0 19 45.0 20 48.0 21 42.0 22 65.0 23 86.0 24 71.0 25 72.0 26 76.0 27 103.0 28 95.0 29 117.0 30 138.0 31 149.0 32 182.0 33 231.0 34 273.0 35 376.0 36 590.0 37 1223.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.145312105130145 9.577963103361133 11.473338387667424 53.803386403841294 2 20.575 16.45 40.400000000000006 22.575 3 20.8 19.825 25.324999999999996 34.050000000000004 4 24.875 28.249999999999996 21.75 25.124999999999996 5 24.474999999999998 31.324999999999996 24.8 19.400000000000002 6 19.275000000000002 33.975 26.075 20.674999999999997 7 15.986990242682012 22.641981486114584 42.10657993495121 19.264448336252187 8 19.394394394394393 21.996996996996998 32.65765765765766 25.95095095095095 9 18.689016762571928 20.740555416562422 35.72679509632224 24.843632724543408 10-11 20.860430215107552 31.55327663831916 23.936968484242122 23.649324662331164 12-13 21.920720270101288 24.059022133299987 28.198074277854197 25.82218331874453 14-15 21.040100250626566 26.71679197994987 27.807017543859647 24.43609022556391 16-17 22.035808188305996 27.006385376236388 26.380368098159508 24.577438337298112 18-19 20.407652869826183 27.097661623108664 27.24771789421033 25.24696761285482 20-21 21.370513942728522 26.760035013129922 26.785044391646867 25.084406652494685 22-23 21.1875 26.8375 26.875 25.1 24-25 21.41517689711214 26.2782847855982 27.315914489311165 24.990623827978496 26-27 21.332999874953106 26.172314617981744 28.260597724146553 24.234087782918596 28-29 21.2 26.625 27.1375 25.0375 30-31 20.9375 26.775 27.3375 24.95 32-33 20.962500000000002 26.75 27.800000000000004 24.4875 34-35 21.425 26.8 26.9125 24.8625 36-37 20.8875 26.174999999999997 27.3 25.637500000000003 38-39 21.2 26.674999999999997 27.325 24.8 40-41 22.162499999999998 26.3625 26.887499999999996 24.587500000000002 42-43 22.25 25.887500000000003 27.2625 24.6 44-45 21.575 26.5125 26.525 25.387500000000003 46-47 20.7875 27.3125 27.175 24.725 48-49 21.1125 25.2375 26.5375 27.1125 50-51 21.125 27.237499999999997 26.450000000000003 25.1875 52-53 21.5375 26.8375 26.487500000000004 25.137500000000003 54-55 21.4125 26.375 28.075 24.1375 56-57 21.6625 26.5375 27.650000000000002 24.15 58-59 21.275 26.6625 26.85 25.2125 60-61 22.1875 26.187500000000004 26.8625 24.762500000000003 62-63 21.9375 26.687499999999996 26.424999999999997 24.95 64-65 20.95 26.775 26.650000000000002 25.624999999999996 66-67 20.8875 26.6 26.987499999999997 25.525 68-69 21.375 26.937499999999996 26.637499999999996 25.05 70-71 22.225 26.224999999999998 26.6 24.95 72-73 21.637500000000003 26.05 26.575 25.7375 74-75 21.512500000000003 26.424999999999997 27.462500000000002 24.6 76-77 20.5125 27.237499999999997 27.474999999999998 24.775 78-79 21.075 25.525 27.375 26.025 80-81 21.75 27.0125 25.95 25.2875 82-83 21.462500000000002 26.4125 26.387500000000003 25.7375 84-85 22.6375 26.087500000000002 26.737499999999997 24.5375 86-87 22.025 25.6125 27.737499999999997 24.625 88-89 22.175 26.7625 26.1625 24.9 90-91 22.075 27.375 25.8625 24.6875 92-93 22.275 26.1 26.8375 24.7875 94-95 22.5125 25.912499999999998 26.5375 25.0375 96-97 21.7375 27.0125 26.1 25.15 98-99 22.162499999999998 25.9625 26.724999999999998 25.15 100-101 22.662499999999998 26.650000000000002 25.9625 24.725 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 3.0 28 2.5 29 3.0 30 6.5 31 10.0 32 14.5 33 21.5 34 25.5 35 32.5 36 49.5 37 72.0 38 97.0 39 123.0 40 152.0 41 194.5 42 224.0 43 234.0 44 240.0 45 254.0 46 247.0 47 206.5 48 204.0 49 201.5 50 180.0 51 161.0 52 140.5 53 131.0 54 129.5 55 125.0 56 107.5 57 83.5 58 77.0 59 65.5 60 39.5 61 33.0 62 28.0 63 21.0 64 15.0 65 12.5 66 13.0 67 8.5 68 4.0 69 2.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.075 8 0.1 9 0.075 10-11 0.05 12-13 0.0375 14-15 0.25 16-17 0.1625 18-19 0.0375 20-21 0.0375 22-23 0.0 24-25 0.0125 26-27 0.0375 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11482043500253 97.975 2 0.7334344967121902 1.4500000000000002 3 0.05058168942842691 0.15 4 0.07587253414264036 0.3 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3875 0.0 0.0 0.0 0.0 82-83 0.45 0.0 0.0 0.0 0.0 84-85 0.6000000000000001 0.0 0.0 0.0 0.0 86-87 0.8375 0.0 0.0 0.0 0.0 88-89 1.1375000000000002 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610854 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610854_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.239 32.0 27.0 33.0 18.0 33.0 2 29.7605 32.0 28.0 33.0 18.0 34.0 3 26.43175 30.0 18.0 33.0 18.0 33.0 4 28.40525 32.0 27.0 33.0 15.0 33.0 5 29.12525 32.0 27.0 33.0 15.0 33.0 6 26.46425 29.0 16.0 37.0 15.0 38.0 7 30.27 34.0 26.0 38.0 16.0 38.0 8 31.91075 36.0 29.0 38.0 16.0 38.0 9 32.46625 37.0 29.0 38.0 16.0 38.0 10-11 32.978 37.0 31.0 38.0 16.0 38.0 12-13 33.26725 38.0 31.0 38.0 16.0 38.0 14-15 33.284875 38.0 32.0 38.0 16.0 38.0 16-17 33.2525 38.0 32.0 38.0 16.0 38.0 18-19 32.977000000000004 37.5 30.0 38.0 16.0 38.0 20-21 33.02775 38.0 31.0 38.0 16.0 38.0 22-23 33.187375 38.0 31.0 38.0 16.0 38.0 24-25 32.68875 37.0 29.0 38.0 16.0 38.0 26-27 32.798249999999996 37.0 30.0 38.0 16.0 38.0 28-29 31.232374999999998 35.5 23.0 38.0 16.0 38.0 30-31 32.590125 37.0 28.5 38.0 16.0 38.0 32-33 33.341750000000005 38.0 33.0 38.0 16.0 38.0 34-35 33.17100000000001 38.0 31.0 38.0 16.0 38.0 36-37 32.700375 37.5 30.5 38.0 16.0 38.0 38-39 33.1475 38.0 31.0 38.0 16.0 38.0 40-41 33.284 38.0 32.0 38.0 16.0 38.0 42-43 33.209 38.0 32.0 38.0 16.0 38.0 44-45 33.41225 38.0 33.0 38.0 16.0 38.0 46-47 33.250625 38.0 32.5 38.0 16.0 38.0 48-49 33.35175 38.0 33.0 38.0 16.0 38.0 50-51 33.494375000000005 38.0 33.0 38.0 16.0 38.0 52-53 33.49375 38.0 33.0 38.0 16.0 38.0 54-55 33.518249999999995 38.0 33.0 38.0 16.0 38.0 56-57 33.363625 38.0 33.0 38.0 16.0 38.0 58-59 33.254125 38.0 33.0 38.0 16.0 38.0 60-61 33.393625 38.0 33.0 38.0 16.0 38.0 62-63 33.3495 38.0 33.0 38.0 16.0 38.0 64-65 33.210750000000004 38.0 32.0 38.0 16.0 38.0 66-67 33.315375 38.0 32.5 38.0 16.0 38.0 68-69 33.351375 38.0 33.0 38.0 16.0 38.0 70-71 33.061499999999995 38.0 31.5 38.0 16.0 38.0 72-73 33.135999999999996 38.0 31.0 38.0 16.0 38.0 74-75 33.298500000000004 38.0 32.5 38.0 16.0 38.0 76-77 33.255875 38.0 33.0 38.0 16.0 38.0 78-79 32.795 37.5 31.0 38.0 15.5 38.0 80-81 32.716375 37.0 30.0 38.0 15.5 38.0 82-83 32.60125 37.0 29.0 38.0 15.0 38.0 84-85 33.051 38.0 31.0 38.0 15.5 38.0 86-87 32.772125 37.0 30.5 38.0 15.0 38.0 88-89 32.908500000000004 38.0 31.0 38.0 15.0 38.0 90-91 32.712625 37.5 31.0 38.0 15.0 38.0 92-93 32.639875 37.0 30.0 38.0 15.0 38.0 94-95 32.748125 37.0 30.5 38.0 15.0 38.0 96-97 32.723375000000004 37.0 31.0 38.0 15.0 38.0 98-99 32.57025 37.0 31.0 38.0 15.0 38.0 100-101 30.846624999999996 35.0 27.0 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 9.0 18 40.0 19 47.0 20 67.0 21 72.0 22 69.0 23 86.0 24 96.0 25 84.0 26 108.0 27 118.0 28 117.0 29 140.0 30 157.0 31 148.0 32 192.0 33 217.0 34 303.0 35 398.0 36 624.0 37 908.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.55 14.325 14.025000000000002 44.1 2 27.025 20.5 35.85 16.625 3 20.25 22.825 32.824999999999996 24.099999999999998 4 24.9 32.324999999999996 20.575 22.2 5 27.775 32.225 21.475 18.525 6 21.349999999999998 33.225 26.55 18.875 7 20.7 17.424999999999997 37.675 24.2 8 22.55 22.400000000000002 28.799999999999997 26.25 9 23.775 22.45 30.0 23.775 10-11 26.5375 29.075 22.325 22.0625 12-13 26.215776972121514 22.715339417427177 26.615826978372297 24.453056632079008 14-15 25.374999999999996 26.5375 25.825 22.2625 16-17 25.874999999999996 26.224999999999998 25.525 22.375 18-19 25.5125 26.4625 25.2 22.825 20-21 26.0375 25.85 25.900000000000002 22.2125 22-23 25.5625 26.987499999999997 25.8 21.65 24-25 25.074999999999996 26.25 26.025 22.650000000000002 26-27 24.875 27.625 25.137500000000003 22.3625 28-29 25.35 26.424999999999997 26.4625 21.762500000000003 30-31 24.85 25.912499999999998 26.9625 22.275 32-33 24.925 26.7625 26.0 22.3125 34-35 25.28132033008252 26.481620405101275 25.943985996499126 22.29307326831708 36-37 25.90783871775607 26.35862759829702 25.59479088404708 22.138742799899823 38-39 25.172025522332042 26.460653071437505 26.18541223570624 22.181909170524207 40-41 25.653860593167316 26.579902390188963 25.253410086347138 22.512826930296583 42-43 24.237479603363877 27.224802309526797 25.957072925819002 22.58064516129032 44-45 25.378550869728443 26.78012764359905 25.178325616318357 22.66299587035415 46-47 26.54390579982463 26.10547413253163 26.3434798947764 21.00714017286734 48-49 24.362181090545274 27.01350675337669 25.86293146573287 22.761380690345174 50-51 25.162499999999998 26.2625 26.400000000000002 22.175 52-53 26.137500000000003 26.150000000000002 25.387500000000003 22.325 54-55 25.3125 26.3 26.1625 22.225 56-57 24.762500000000003 26.7125 26.6625 21.8625 58-59 24.715589448681087 26.67833479184898 26.415801975246904 22.190273784223027 60-61 25.343835958989747 27.581895473868467 25.818954738684667 21.255313828457115 62-63 25.6128064032016 26.475737868934466 25.52526263131566 22.386193096548272 64-65 25.081270317579396 25.831457864466117 26.131532883220803 22.95573893473368 66-67 24.637500000000003 26.900000000000002 26.2875 22.175 68-69 24.337500000000002 27.6125 25.75 22.3 70-71 25.28448168063024 26.747530323871448 25.884706765036892 22.083281230461424 72-73 25.406351587896975 27.11927981995499 26.731682920730183 20.742685671417853 74-75 24.45 27.800000000000004 26.25 21.5 76-77 26.053256657082137 26.178272284035504 26.303287910988875 21.465183147893487 78-79 24.981245311327832 26.069017254313575 27.431857964491122 21.517879469867466 80-81 24.446667500312618 27.410278854570464 26.42240840315118 21.720645241965737 82-83 26.003250406300786 26.878359794974372 26.078259782472806 21.040130016252032 84-85 24.90934100287608 27.335250719019633 25.747155183193698 22.00825309491059 86-87 25.30949105914718 27.297736651244215 25.647117669125922 21.745654620482682 88-89 25.11255627813907 26.225612806403202 26.76338169084542 21.898449224612307 90-91 24.6 26.787499999999998 26.687499999999996 21.925 92-93 26.137500000000003 26.575 26.6125 20.674999999999997 94-95 26.437500000000004 27.1625 25.525 20.875 96-97 25.818954738684667 26.71917979494874 25.818954738684667 21.642910727681922 98-99 25.124999999999996 27.375 25.912499999999998 21.587500000000002 100-101 25.5125 27.275 26.0 21.212500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.0 27 0.5 28 0.5 29 1.5 30 3.5 31 5.5 32 6.0 33 6.0 34 15.5 35 30.5 36 43.5 37 64.0 38 82.0 39 107.0 40 153.5 41 182.5 42 198.0 43 209.5 44 225.0 45 237.0 46 217.5 47 229.0 48 238.5 49 208.5 50 183.5 51 175.0 52 166.5 53 156.0 54 144.0 55 127.5 56 114.0 57 96.5 58 78.0 59 66.0 60 52.5 61 42.0 62 43.0 63 28.5 64 14.0 65 15.0 66 14.0 67 7.0 68 2.5 69 2.0 70 1.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.025 36-37 0.17500000000000002 38-39 0.08750000000000001 40-41 0.11249999999999999 42-43 0.41250000000000003 44-45 0.11249999999999999 46-47 0.21250000000000002 48-49 0.05 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0125 60-61 0.025 62-63 0.05 64-65 0.025 66-67 0.0 68-69 0.0 70-71 0.0375 72-73 0.025 74-75 0.0 76-77 0.0125 78-79 0.025 80-81 0.0375 82-83 0.0125 84-85 0.0375 86-87 0.0375 88-89 0.05 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.025 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.025 0.0 0.0 84-85 0.6000000000000001 0.0 0.025 0.0 0.0 86-87 0.8375 0.0 0.025 0.0 0.0 88-89 1.1375000000000002 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGAGA 15 6.142176E-4 95.0 1 >>END_MODULE Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163232 spots for ERR10610854.sra Written 163232 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra Read 163213 spots for ERR10610854.sra Written 163213 spots for ERR10610854.sra SRR ids: ['ERR10610854.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r8xnpkcd ERR10610854.sra spots: 3264279 blocks: [[1, 163213], [163214, 326426], [326427, 489639], [489640, 652852], [652853, 816065], [816066, 979278], [979279, 1142491], [1142492, 1305704], [1305705, 1468917], [1468918, 1632130], [1632131, 1795343], [1795344, 1958556], [1958557, 2121769], [2121770, 2284982], [2284983, 2448195], [2448196, 2611408], [2611409, 2774621], [2774622, 2937834], [2937835, 3101047], [3101048, 3264279]] ERR10610854 file size 782022 ERR10610854 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610854 ERR10610854_1.fastq ERR10610854_2.fastq Input file: ERR10610854_1.fastq Paired file: ERR10610854_2.fastq trimmed: ERR10610854-trimmed-pair1.fastq, ERR10610854-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:16:51 2024 >> started Fri Dec 6 21:17:09 2024 >> done (18.448s) 3264279 read pairs processed; of these: 10 ( 0.00%) short read pairs filtered out after trimming by size control 132 ( 0.00%) empty read pairs filtered out after trimming by size control 3264137 (100.00%) read pairs available; of these: 136255 ( 4.17%) trimmed read pairs available after processing 3127882 (95.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 0 0.00% 26 0 0.00% 27 1 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 2 0.00% 33 2 0.00% 34 1 0.00% 35 4 0.00% 36 11 0.00% 37 3 0.00% 38 8 0.00% 39 13 0.00% 40 14 0.00% 41 9 0.00% 42 10 0.00% 43 14 0.00% 44 23 0.00% 45 16 0.00% 46 13 0.00% 47 35 0.00% 48 36 0.00% 49 40 0.00% 50 44 0.00% 51 58 0.00% 52 47 0.00% 53 61 0.00% 54 67 0.00% 55 84 0.00% 56 78 0.00% 57 112 0.00% 58 101 0.00% 59 138 0.00% 60 133 0.00% 61 173 0.01% 62 177 0.01% 63 233 0.01% 64 249 0.01% 65 284 0.01% 66 313 0.01% 67 379 0.01% 68 431 0.01% 69 463 0.01% 70 486 0.01% 71 608 0.02% 72 630 0.02% 73 756 0.02% 74 846 0.03% 75 917 0.03% 76 1124 0.03% 77 1219 0.04% 78 1415 0.04% 79 1643 0.05% 80 1817 0.06% 81 1959 0.06% 82 2216 0.07% 83 2458 0.08% 84 2753 0.08% 85 3150 0.10% 86 3632 0.11% 87 3900 0.12% 88 4298 0.13% 89 4725 0.14% 90 5116 0.16% 91 5885 0.18% 92 6322 0.19% 93 6885 0.21% 94 7441 0.23% 95 8091 0.25% 96 8851 0.27% 97 9680 0.30% 98 10391 0.32% 99 11407 0.35% 100 11745 0.36% 101 3127882 95.83% 3264137 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=25 prefix-density=0.18 prefix-fanout=2.1 sequence=CTGTCTCACGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=105.23 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=2.3 sequence=CCGCACTTGCACTTGCCGTCGTTCTCCGCCGCGGACTCCTGCACCTCGAAGTGGCTCTTCTCGGTGTCAACCATGACGATGCCGTAGCCGTTTCCCTTCTTCACACACTGGGTCTTGTCAGCGCAGTCGCAGTTGCCGCAGCCGCTCGACATGGTGGCCTTAACTTGCTGGGGAGATCGAGTACACGAATCAGCTGTGTTTTGCCTGTG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=2.0 sequence=AACAAAAGGGTA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=212.96 fanout-score-rank=1 prefix-density=0.40 prefix-fanout=24.9 sequence=CAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCTCAAGCTCGTGGGCGGCCACTACGACTTCGTCTCCGGCAAGTTCGACACATGGGAGCTCTAAGTCCTCTCATCCGGTTAACTCCTATACATACAACGTATACTTATACATACAGATATGGAGATGACCCTACAGATCGATCCATTGATGTGGATGCGATGCCATGGAGTATATGTACTCGCTATTTTCCAGTACTGCATGCCGGATGGCTCGATGTGAATTTGTAATAAGCAATAGAAGTTTCTACCATTTTCTGACGTGGGGTTGTACTTGTGATGCGTAATTTGGTCATCTTGTGACC ERR10610854 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:18:02 Started mapping on | Dec 06 21:18:03 Finished on | Dec 06 21:22:20 Mapping speed, Million of reads per hour | 45.72 Number of input reads | 3264137 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 2803230 Uniquely mapped reads % | 85.88% Average mapped length | 199.88 Number of splices: Total | 1854367 Number of splices: Annotated (sjdb) | 1742330 Number of splices: GT/AG | 1828048 Number of splices: GC/AG | 22841 Number of splices: AT/AC | 944 Number of splices: Non-canonical | 2534 Mismatch rate per base, % | 0.85% Deletion rate per base | 0.02% Deletion average length | 2.26 Insertion rate per base | 0.01% Insertion average length | 1.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 180878 % of reads mapped to multiple loci | 5.54% Number of reads mapped to too many loci | 8341 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.82% % of reads unmapped: other | 2.51% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 280029 280029 280029 N_multimapping 180878 180878 180878 N_noFeature 143700 2727426 162829 N_ambiguous 65947 314 9419 UnstrandedReadsAssigned:2593583 PositiveStrandReadsAssigned:75490 NegativeStrandReadsAssigned:2630982 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610854 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610854-trimmed-pair1.fastq ERR10610854-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,264,137 reads, 2,712,899 reads pseudoaligned [quant] estimated average fragment length: 167.307 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,105 rounds 52973 ERR10610854.ke.tsv 35125 ERR10610854.se.tsv 88098 total ==> ERR10610854.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.761 0 0 PNS24247 1044 877.693 12.4432 8.17107 PNS24249 1928 1761.69 0 0 PNS24246 1044 877.693 12.4432 8.17107 PNS24248 1044 877.693 12.4432 8.17107 PNS24244 1471 1304.69 20.6703 9.1312 PNS24243 293 134.066 0 0 KQK14069 1603 1436.69 209.669 84.1122 KQK14071 474 308.926 9.70876 18.1133 ==> ERR10610854.se.tsv <== BRADI_1g14170v3 281 BRADI_1g53295v3 15 BRADI_1g59795v3 87 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 47 BRADI_1g74790v3 17 BRADI_1g09890v3 0 BRADI_1g77505v3 62 BRADI_1g48960v3 0 ERR10610854 completed mapping pipeline successfully