Starting /dee2/code/volunteer_pipeline.sh ERR10610855 current disk space = 1549097369600 free memory = 1604128664 ERR10610855 SRAfilesize 2931a6769a6e0a0af194a71d01a6fd8d ERR10610855.sra ERR10610855.sra file validated ERR10610855 is paired end ERR10610855 is conventional basespace ERR10610855 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610855_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.672 18.0 18.0 28.0 18.0 32.0 2 28.25 32.0 27.0 32.0 18.0 33.0 3 29.2725 32.0 27.0 33.0 18.0 33.0 4 29.74325 32.0 30.0 33.0 15.0 33.0 5 30.22425 33.0 31.0 33.0 15.0 33.0 6 31.7635 36.0 29.0 38.0 16.0 38.0 7 31.63175 36.0 29.0 38.0 16.0 38.0 8 31.807 36.0 29.0 38.0 16.0 38.0 9 32.57775 37.0 29.0 38.0 16.0 38.0 10-11 33.102625 37.5 31.0 38.0 16.0 38.0 12-13 33.2745 38.0 32.0 38.0 16.0 38.0 14-15 33.297375 38.0 32.0 38.0 16.0 38.0 16-17 33.391000000000005 38.0 33.0 38.0 16.0 38.0 18-19 33.380125 38.0 32.0 38.0 16.0 38.0 20-21 33.387625 38.0 32.0 38.0 16.0 38.0 22-23 33.483000000000004 38.0 33.0 38.0 16.0 38.0 24-25 32.91475 37.5 31.0 38.0 16.0 38.0 26-27 33.250125 38.0 31.0 38.0 16.0 38.0 28-29 33.40325 38.0 33.0 38.0 16.0 38.0 30-31 33.574875000000006 38.0 33.0 38.0 16.0 38.0 32-33 33.509625 38.0 33.0 38.0 16.0 38.0 34-35 33.720625 38.0 33.5 38.0 16.0 38.0 36-37 33.444 38.0 33.0 38.0 16.0 38.0 38-39 33.597125 38.0 33.0 38.0 16.0 38.0 40-41 33.5995 38.0 33.0 38.0 16.0 38.0 42-43 33.614875 38.0 33.0 38.0 16.0 38.0 44-45 33.81625 38.0 34.0 38.0 16.0 38.0 46-47 33.480125 38.0 33.0 38.0 16.0 38.0 48-49 33.52475 38.0 33.0 38.0 16.0 38.0 50-51 33.340375 38.0 33.0 38.0 16.0 38.0 52-53 33.377875 38.0 32.0 38.0 16.0 38.0 54-55 33.38125 38.0 33.0 38.0 16.0 38.0 56-57 33.579499999999996 38.0 33.0 38.0 16.0 38.0 58-59 33.370875 38.0 33.0 38.0 16.0 38.0 60-61 33.349625 38.0 32.5 38.0 16.0 38.0 62-63 33.289500000000004 38.0 32.5 38.0 16.0 38.0 64-65 33.41675 38.0 33.0 38.0 16.0 38.0 66-67 33.366125 38.0 33.0 38.0 16.0 38.0 68-69 33.501374999999996 38.0 33.0 38.0 16.0 38.0 70-71 33.514624999999995 38.0 33.0 38.0 16.0 38.0 72-73 33.20975 38.0 32.0 38.0 16.0 38.0 74-75 33.469 38.0 33.0 38.0 16.0 38.0 76-77 33.364875 38.0 33.0 38.0 15.5 38.0 78-79 33.276624999999996 38.0 32.0 38.0 16.0 38.0 80-81 33.34825 38.0 33.0 38.0 15.5 38.0 82-83 33.215875 38.0 33.0 38.0 15.0 38.0 84-85 33.381625 38.0 33.0 38.0 15.5 38.0 86-87 33.151125 38.0 32.0 38.0 15.5 38.0 88-89 32.911625 38.0 31.0 38.0 15.0 38.0 90-91 33.225375 38.0 33.0 38.0 15.0 38.0 92-93 33.06725 38.0 32.0 38.0 15.0 38.0 94-95 33.0175 38.0 31.5 38.0 15.0 38.0 96-97 32.939375 37.5 31.0 38.0 15.0 38.0 98-99 32.463499999999996 37.0 29.0 38.0 15.0 38.0 100-101 31.8805 36.0 28.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 2.0 18 26.0 19 39.0 20 62.0 21 65.0 22 87.0 23 66.0 24 82.0 25 93.0 26 99.0 27 99.0 28 126.0 29 140.0 30 148.0 31 132.0 32 198.0 33 229.0 34 236.0 35 364.0 36 686.0 37 1020.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.75031525851198 13.316519546027743 9.331651954602775 51.6015132408575 2 19.025 15.875 42.825 22.275 3 20.674999999999997 20.525 24.25 34.55 4 26.6 25.775 21.675 25.95 5 24.5 33.2 22.95 19.35 6 19.45 34.9 24.575 21.075 7 15.478869717429358 22.455613903475868 42.06051512878219 20.005001250312578 8 18.25912956478239 23.88694347173587 31.29064532266133 26.563281640820406 9 17.883941970985493 22.63631815907954 33.691845922961484 25.78789394697349 10-11 22.758534450418907 30.936601225459547 22.896086032262097 23.40877829185945 12-13 21.245467050143805 24.934350381393024 27.885457046392396 25.934725522070778 14-15 20.859433725883235 26.10874467551992 27.862691054873466 25.169130543723377 16-17 22.12489050181454 26.91778250531848 26.054311099987487 24.90301589287949 18-19 21.633112417156433 25.534575465799676 27.047642866074778 25.78466925096911 20-21 20.76509563695462 27.94099262407801 26.578322290286287 24.715589448681087 22-23 20.890111263907986 27.17839729966246 27.040880110013752 24.8906113264158 24-25 21.092773193298324 26.63165791447862 27.144286071517882 25.131282820705174 26-27 20.967741935483872 27.11927981995499 26.906726681670417 25.006251562890725 28-29 21.175 27.6125 26.85 24.3625 30-31 20.7 27.200000000000003 26.4125 25.687500000000004 32-33 21.45 25.900000000000002 27.650000000000002 25.0 34-35 21.8625 26.6625 26.1125 25.362499999999997 36-37 21.175 26.75 26.85 25.224999999999998 38-39 21.29016127015877 27.265908238529818 26.328291036379547 25.115639454931866 40-41 21.325 26.9625 26.450000000000003 25.2625 42-43 21.3 26.525 27.8375 24.337500000000002 44-45 21.075 26.637499999999996 27.125 25.162499999999998 46-47 21.325 26.787499999999998 26.724999999999998 25.162499999999998 48-49 20.925 26.575 27.150000000000002 25.35 50-51 20.4875 26.8625 27.224999999999998 25.424999999999997 52-53 21.5 27.237499999999997 26.237500000000004 25.025 54-55 21.087500000000002 26.5375 26.3125 26.0625 56-57 21.8625 26.174999999999997 26.625 25.337500000000002 58-59 21.337500000000002 27.1125 26.950000000000003 24.6 60-61 21.7375 27.0125 26.387500000000003 24.8625 62-63 22.525000000000002 26.237500000000004 27.1125 24.125 64-65 21.825 26.775 26.174999999999997 25.224999999999998 66-67 20.7375 27.650000000000002 26.0 25.6125 68-69 21.45 27.800000000000004 25.924999999999997 24.825 70-71 22.3 27.037499999999998 25.937500000000004 24.725 72-73 21.8875 27.075 26.887499999999996 24.15 74-75 21.3 27.200000000000003 27.237499999999997 24.2625 76-77 21.825 26.35 26.650000000000002 25.174999999999997 78-79 21.6625 26.6125 26.025 25.7 80-81 21.475 26.4125 27.075 25.0375 82-83 22.287499999999998 26.7125 26.55 24.45 84-85 22.375 26.424999999999997 26.0 25.2 86-87 21.637500000000003 26.5625 26.8375 24.962500000000002 88-89 22.85 26.575 26.087500000000002 24.4875 90-91 22.0125 26.787499999999998 26.0375 25.162499999999998 92-93 21.390173771721464 26.065758219777475 26.815851981497683 25.728216027003377 94-95 21.9375 28.000000000000004 25.900000000000002 24.1625 96-97 21.7875 27.224999999999998 25.887500000000003 25.1 98-99 22.425 27.1125 25.7625 24.7 100-101 22.787499999999998 27.3375 25.837500000000002 24.0375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 1.0 28 2.5 29 3.5 30 5.5 31 7.0 32 9.0 33 18.0 34 29.5 35 43.0 36 51.0 37 68.5 38 98.0 39 135.0 40 164.0 41 185.5 42 213.5 43 228.5 44 245.5 45 252.5 46 240.5 47 236.0 48 215.0 49 190.0 50 176.0 51 159.0 52 156.0 53 138.5 54 116.0 55 109.0 56 97.0 57 75.5 58 60.5 59 57.5 60 50.5 61 41.0 62 34.5 63 25.5 64 16.0 65 11.5 66 12.0 67 10.5 68 7.0 69 3.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8750000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.05 9 0.05 10-11 0.0375 12-13 0.0375 14-15 0.22499999999999998 16-17 0.11249999999999999 18-19 0.0375 20-21 0.0125 22-23 0.0125 24-25 0.025 26-27 0.025 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8496993987976 99.65 2 0.1002004008016032 0.2 3 0.0501002004008016 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.7250000000000001 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610855 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610855_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.97775 32.0 27.0 33.0 18.0 33.0 2 29.5085 32.0 27.0 33.0 18.0 33.0 3 26.30825 28.0 18.0 33.0 18.0 33.0 4 27.97975 32.0 27.0 33.0 15.0 33.0 5 28.78275 32.0 27.0 33.0 15.0 33.0 6 26.331 29.0 16.0 37.0 15.0 38.0 7 29.66175 31.0 26.0 37.0 16.0 38.0 8 31.7135 36.0 28.0 38.0 16.0 38.0 9 32.09825 37.0 29.0 38.0 16.0 38.0 10-11 32.661125 37.0 29.0 38.0 16.0 38.0 12-13 32.7595 37.0 30.0 38.0 16.0 38.0 14-15 32.822 37.0 30.5 38.0 16.0 38.0 16-17 32.773125 37.0 30.0 38.0 16.0 38.0 18-19 32.61125 37.0 29.0 38.0 16.0 38.0 20-21 32.6245 37.0 29.0 38.0 16.0 38.0 22-23 32.76525 37.0 30.0 38.0 16.0 38.0 24-25 32.376125 37.0 29.0 38.0 16.0 38.0 26-27 32.5745 37.0 29.0 38.0 16.0 38.0 28-29 30.914375 35.5 22.5 38.0 16.0 38.0 30-31 32.035 36.5 28.5 38.0 16.0 38.0 32-33 32.605625 37.0 29.0 38.0 16.0 38.0 34-35 32.614625000000004 37.0 29.0 38.0 16.0 38.0 36-37 32.3325 37.0 29.5 38.0 16.0 38.0 38-39 32.558125000000004 37.0 29.0 38.0 16.0 38.0 40-41 32.748000000000005 37.0 29.0 38.0 16.0 38.0 42-43 32.52475 37.0 29.0 38.0 16.0 38.0 44-45 32.929 37.5 31.0 38.0 16.0 38.0 46-47 32.63575 37.0 29.0 38.0 16.0 38.0 48-49 32.84425 37.5 30.0 38.0 16.0 38.0 50-51 32.957875 38.0 30.5 38.0 16.0 38.0 52-53 32.995125 38.0 31.0 38.0 16.0 38.0 54-55 32.870125 37.5 30.5 38.0 16.0 38.0 56-57 32.80475 37.0 29.5 38.0 16.0 38.0 58-59 32.66875 37.0 29.0 38.0 16.0 38.0 60-61 32.746875 37.0 29.5 38.0 16.0 38.0 62-63 32.786 37.5 30.0 38.0 16.0 38.0 64-65 32.63075 37.5 29.0 38.0 16.0 38.0 66-67 32.759375000000006 37.0 29.5 38.0 16.0 38.0 68-69 32.82125 37.0 30.5 38.0 16.0 38.0 70-71 32.654250000000005 37.0 29.0 38.0 16.0 38.0 72-73 32.609125 37.0 29.0 38.0 16.0 38.0 74-75 32.519499999999994 37.0 29.0 38.0 16.0 38.0 76-77 32.695750000000004 37.0 29.5 38.0 16.0 38.0 78-79 32.117125 37.0 28.0 38.0 15.5 38.0 80-81 32.104375 37.0 28.0 38.0 15.0 38.0 82-83 32.054249999999996 37.0 28.0 38.0 15.0 38.0 84-85 32.396 37.0 29.0 38.0 15.0 38.0 86-87 32.053875000000005 37.0 28.0 38.0 15.0 38.0 88-89 32.16175 37.0 29.0 38.0 15.0 38.0 90-91 31.950125 37.0 28.0 38.0 15.0 38.0 92-93 32.009 37.0 28.5 38.0 15.0 38.0 94-95 32.091875 37.0 29.0 38.0 15.0 38.0 96-97 32.079125 37.0 28.5 38.0 15.0 38.0 98-99 32.111875 37.0 29.0 38.0 15.0 38.0 100-101 30.282375 34.0 25.5 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 5.0 17 20.0 18 33.0 19 64.0 20 76.0 21 87.0 22 99.0 23 84.0 24 110.0 25 116.0 26 124.0 27 118.0 28 121.0 29 153.0 30 170.0 31 157.0 32 188.0 33 213.0 34 260.0 35 367.0 36 650.0 37 785.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.525 15.5 14.099999999999998 41.875 2 27.6 19.625 36.625 16.150000000000002 3 21.224999999999998 23.025000000000002 33.175 22.575 4 25.025 31.7 21.95 21.325 5 27.825 32.1 22.7 17.375 6 21.275 32.550000000000004 27.525 18.65 7 20.925 16.650000000000002 39.2 23.225 8 22.825 21.675 27.825 27.675 9 24.4 22.25 28.875 24.474999999999998 10-11 26.075 29.4875 22.725 21.712500000000002 12-13 25.6125 23.400000000000002 26.674999999999997 24.3125 14-15 24.762500000000003 26.174999999999997 27.3875 21.675 16-17 26.0625 26.137500000000003 25.95 21.85 18-19 24.975 26.337500000000002 25.5 23.1875 20-21 25.074999999999996 26.337500000000002 26.187500000000004 22.400000000000002 22-23 24.975 26.375 26.150000000000002 22.5 24-25 24.587500000000002 25.124999999999996 27.725 22.5625 26-27 24.8 26.474999999999998 26.35 22.375 28-29 25.15 25.25 27.437499999999996 22.162499999999998 30-31 24.837500000000002 26.575 26.337500000000002 22.25 32-33 24.3625 26.0375 26.375 23.225 34-35 25.687500000000004 25.374999999999996 26.0625 22.875 36-37 25.544976196441993 25.808068153345026 26.20897018291155 22.437985467301427 38-39 24.6248124062031 26.525762881440716 26.475737868934466 22.373686843421712 40-41 24.8998998998999 25.425425425425423 26.63913913913914 23.035535535535537 42-43 24.745634970481095 26.278105765607336 26.165054641376713 22.81120462253486 44-45 24.455841881411057 26.720040030022517 26.26970227670753 22.554415811858895 46-47 24.53019293410173 25.933350037584564 27.186168879979956 22.350288148333753 48-49 24.546705014380393 26.47242716018507 26.484931849443544 22.495935975990996 50-51 25.2375 26.150000000000002 26.337500000000002 22.275 52-53 26.0125 25.5625 26.35 22.075 54-55 25.2125 26.3125 26.375 22.1 56-57 24.8125 26.087500000000002 27.037499999999998 22.0625 58-59 25.25 26.3 26.7625 21.6875 60-61 24.975 26.474999999999998 26.687499999999996 21.8625 62-63 24.7 26.637499999999996 26.700000000000003 21.9625 64-65 25.0 26.8375 26.6625 21.5 66-67 24.625 26.525 26.5625 22.287499999999998 68-69 24.05 27.3375 25.687500000000004 22.925 70-71 26.0375 26.85 26.150000000000002 20.962500000000002 72-73 25.624999999999996 26.9125 26.637499999999996 20.825 74-75 25.7375 26.0125 26.937499999999996 21.3125 76-77 24.8 26.1625 26.275 22.7625 78-79 24.587500000000002 25.887500000000003 27.962500000000002 21.5625 80-81 24.875 26.3625 26.987499999999997 21.775 82-83 25.074999999999996 27.400000000000002 25.8625 21.6625 84-85 25.55 25.9875 26.0375 22.425 86-87 25.2125 27.450000000000003 26.5875 20.75 88-89 25.412499999999998 27.150000000000002 26.25 21.1875 90-91 25.637500000000003 26.35 25.9625 22.05 92-93 24.675 27.3 25.5625 22.4625 94-95 25.937500000000004 26.637499999999996 25.8 21.625 96-97 26.1 26.375 26.4625 21.0625 98-99 25.4875 27.125 26.3 21.087500000000002 100-101 26.0375 26.625 26.1125 21.224999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 1.5 25 1.5 26 0.0 27 0.5 28 1.5 29 2.5 30 4.5 31 5.5 32 5.5 33 10.5 34 20.0 35 33.0 36 45.5 37 59.5 38 78.5 39 112.5 40 160.0 41 185.5 42 203.0 43 220.0 44 231.0 45 247.5 46 251.5 47 233.5 48 211.5 49 183.5 50 174.5 51 181.5 52 147.0 53 130.5 54 138.5 55 126.5 56 108.0 57 89.5 58 72.5 59 63.5 60 58.0 61 50.0 62 43.5 63 29.5 64 22.0 65 17.5 66 12.0 67 9.5 68 6.0 69 3.5 70 3.0 71 2.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.22499999999999998 38-39 0.05 40-41 0.1 42-43 0.4875 44-45 0.075 46-47 0.22499999999999998 48-49 0.0375 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87481221832749 99.725 2 0.10015022533800699 0.2 3 0.025037556334501748 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 0.95 0.0 0.0 0.0 0.0 88-89 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134951 spots for ERR10610855.sra Written 134951 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra Read 134934 spots for ERR10610855.sra Written 134934 spots for ERR10610855.sra SRR ids: ['ERR10610855.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_e0j61agl ERR10610855.sra spots: 2698697 blocks: [[1, 134934], [134935, 269868], [269869, 404802], [404803, 539736], [539737, 674670], [674671, 809604], [809605, 944538], [944539, 1079472], [1079473, 1214406], [1214407, 1349340], [1349341, 1484274], [1484275, 1619208], [1619209, 1754142], [1754143, 1889076], [1889077, 2024010], [2024011, 2158944], [2158945, 2293878], [2293879, 2428812], [2428813, 2563746], [2563747, 2698697]] ERR10610855 file size 646150 ERR10610855 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610855 ERR10610855_1.fastq ERR10610855_2.fastq Input file: ERR10610855_1.fastq Paired file: ERR10610855_2.fastq trimmed: ERR10610855-trimmed-pair1.fastq, ERR10610855-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:17:09 2024 >> started Fri Dec 6 21:17:12 2024 >> done (3.107s) 2698697 read pairs processed; of these: 13 ( 0.00%) short read pairs filtered out after trimming by size control 65 ( 0.00%) empty read pairs filtered out after trimming by size control 2698619 (100.00%) read pairs available; of these: 113256 ( 4.20%) trimmed read pairs available after processing 2585363 (95.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 0 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 0 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 0 0.00% 31 2 0.00% 32 0 0.00% 33 2 0.00% 34 2 0.00% 35 2 0.00% 36 3 0.00% 37 3 0.00% 38 4 0.00% 39 5 0.00% 40 5 0.00% 41 11 0.00% 42 14 0.00% 43 10 0.00% 44 7 0.00% 45 13 0.00% 46 10 0.00% 47 21 0.00% 48 31 0.00% 49 25 0.00% 50 31 0.00% 51 39 0.00% 52 47 0.00% 53 36 0.00% 54 46 0.00% 55 55 0.00% 56 54 0.00% 57 78 0.00% 58 83 0.00% 59 112 0.00% 60 109 0.00% 61 148 0.01% 62 166 0.01% 63 171 0.01% 64 193 0.01% 65 229 0.01% 66 231 0.01% 67 279 0.01% 68 344 0.01% 69 379 0.01% 70 410 0.02% 71 504 0.02% 72 595 0.02% 73 699 0.03% 74 719 0.03% 75 814 0.03% 76 967 0.04% 77 992 0.04% 78 1214 0.04% 79 1319 0.05% 80 1470 0.05% 81 1623 0.06% 82 1898 0.07% 83 2099 0.08% 84 2384 0.09% 85 2664 0.10% 86 2942 0.11% 87 3245 0.12% 88 3757 0.14% 89 4062 0.15% 90 4364 0.16% 91 4696 0.17% 92 5200 0.19% 93 5709 0.21% 94 6041 0.22% 95 6805 0.25% 96 7323 0.27% 97 8101 0.30% 98 8577 0.32% 99 9220 0.34% 100 9837 0.36% 101 2585363 95.80% 2698619 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=3.37 fanout-score-rank=26 prefix-density=0.12 prefix-fanout=2.0 sequence=ACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCTGGGAGTATGGCATCGGTTACATACTTCAGTGCCGTAGCGCCTGGTATGAGCCTCGTGGAGAAGCAATCGCTAGTCCACGGGGCTCATACTTCAGCGCTGCAGCGCTTGGTACTCGGACCTCGGCTCGAGGCATTTTCTCTACCCCTTCTTACCCTGAAAAAGCAGGGTCACCTTGTGTCCTTAAACCTATAACCATCTTTCGGCTAACCTAGCCTCCTCCGTCCCTCCGTACCAACAAGGGGTAGTACAGGAATATTGACCTGTTGTCCATCGACTACGCCTTTCGGCCTGATCTTAGGCCCTGACTCACCCTCCGTGGACGAACCTTGCGGAGGAAACCTTGGGTTTTCGGGGCATTGGATTCTCACCAATGTTTTCGTTACTCAAGCCGACATTCTCGCTTCCGCTTCGTCGACCCCCGCTTTCGCGGTTGCTTCCCTCTAAGGCGGAACGCTCCCCTACCGATGCATTTTGACAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=19 fanout-score=184.18 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.4 sequence=ACAACAACAAAGAATTATAAAGCTGCTTCAGTAATCTCTTCCTTCTC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=22 prefix-density=0.12 prefix-fanout=2.2 sequence=CAAGGCTAAATAC criterion=fanout-score sequence-density=0.05 sequence-density-rank=14 fanout-score=170.62 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=18.6 sequence=GAAGAAGAAGAA ERR10610855 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:17:55 Started mapping on | Dec 06 21:17:55 Finished on | Dec 06 21:18:43 Mapping speed, Million of reads per hour | 202.40 Number of input reads | 2698619 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 2394352 Uniquely mapped reads % | 88.73% Average mapped length | 199.70 Number of splices: Total | 1618253 Number of splices: Annotated (sjdb) | 1525703 Number of splices: GT/AG | 1596304 Number of splices: GC/AG | 18560 Number of splices: AT/AC | 1078 Number of splices: Non-canonical | 2311 Mismatch rate per base, % | 0.91% Deletion rate per base | 0.01% Deletion average length | 2.01 Insertion rate per base | 0.01% Insertion average length | 1.83 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 77350 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 3590 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.99% % of reads unmapped: other | 1.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 226917 226917 226917 N_multimapping 77350 77350 77350 N_noFeature 100776 2332968 117280 N_ambiguous 51694 338 6823 UnstrandedReadsAssigned:2241882 PositiveStrandReadsAssigned:61046 NegativeStrandReadsAssigned:2270249 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610855 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610855-trimmed-pair1.fastq ERR10610855-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,698,619 reads, 2,339,221 reads pseudoaligned [quant] estimated average fragment length: 167.575 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 975 rounds 52973 ERR10610855.ke.tsv 35125 ERR10610855.se.tsv 88098 total ==> ERR10610855.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.62 0 0 PNS24247 1044 877.425 10.4826 8.32363 PNS24249 1928 1761.42 5.96873 2.36086 PNS24246 1044 877.425 10.4826 8.32363 PNS24248 1044 877.425 10.4826 8.32363 PNS24244 1471 1304.42 19.5833 10.4597 PNS24243 293 133.728 0 0 KQK14069 1603 1436.42 31.6665 15.3592 KQK14071 474 309.004 0 0 ==> ERR10610855.se.tsv <== BRADI_1g14170v3 35 BRADI_1g53295v3 71 BRADI_1g59795v3 96 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 181 BRADI_1g74790v3 66 BRADI_1g09890v3 0 BRADI_1g77505v3 52 BRADI_1g48960v3 0 ERR10610855 completed mapping pipeline successfully