Starting /dee2/code/volunteer_pipeline.sh ERR10610856 current disk space = 1549045579776 free memory = 1596854476 ERR10610856 SRAfilesize 9eefa08f16a4f1f3d823e01db3bc65af ERR10610856.sra ERR10610856.sra file validated ERR10610856 is paired end ERR10610856 is conventional basespace ERR10610856 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610856_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.47525 32.0 25.0 33.0 18.0 33.0 2 26.265 28.0 18.0 31.0 18.0 33.0 3 27.49275 29.0 25.0 31.0 18.0 33.0 4 29.3425 32.0 27.0 33.0 15.0 33.0 5 29.6045 32.0 30.0 33.0 15.0 33.0 6 32.12375 36.0 29.0 38.0 16.0 38.0 7 32.423 36.0 29.0 38.0 16.0 38.0 8 32.535 37.0 30.0 38.0 16.0 38.0 9 32.90475 37.0 30.0 38.0 16.0 38.0 10-11 30.528624999999998 35.0 22.5 38.0 16.0 38.0 12-13 33.274625 37.5 31.5 38.0 16.0 38.0 14-15 33.545875 38.0 33.0 38.0 16.0 38.0 16-17 33.766000000000005 38.0 33.5 38.0 16.0 38.0 18-19 33.753875 38.0 33.0 38.0 16.0 38.0 20-21 33.5475 38.0 33.0 38.0 16.0 38.0 22-23 33.710375 38.0 33.5 38.0 16.0 38.0 24-25 33.83175 38.0 34.0 38.0 16.0 38.0 26-27 33.740875 38.0 33.5 38.0 16.0 38.0 28-29 33.552 38.0 33.5 38.0 16.0 38.0 30-31 33.046375 38.0 31.0 38.0 16.0 38.0 32-33 33.698499999999996 38.0 33.0 38.0 16.0 38.0 34-35 33.679249999999996 38.0 33.5 38.0 16.0 38.0 36-37 33.638625 38.0 33.5 38.0 16.0 38.0 38-39 33.66375 38.0 33.5 38.0 16.0 38.0 40-41 33.579 38.0 33.0 38.0 16.0 38.0 42-43 33.90875 38.0 34.0 38.0 16.0 38.0 44-45 33.729749999999996 38.0 34.0 38.0 16.0 38.0 46-47 33.884875 38.0 34.0 38.0 16.0 38.0 48-49 33.7265 38.0 34.0 38.0 16.0 38.0 50-51 33.979 38.0 34.0 38.0 16.0 38.0 52-53 33.88849999999999 38.0 34.0 38.0 16.0 38.0 54-55 33.778375 38.0 33.5 38.0 16.0 38.0 56-57 33.7115 38.0 33.5 38.0 16.0 38.0 58-59 33.878874999999994 38.0 33.5 38.0 16.0 38.0 60-61 33.99125 38.0 34.0 38.0 16.0 38.0 62-63 34.01875 38.0 34.0 38.0 16.0 38.0 64-65 34.023125 38.0 34.0 38.0 16.0 38.0 66-67 34.134 38.0 34.0 38.0 16.0 38.0 68-69 33.889250000000004 38.0 34.0 38.0 16.0 38.0 70-71 33.98325 38.0 34.0 38.0 16.0 38.0 72-73 33.928875000000005 38.0 34.0 38.0 16.0 38.0 74-75 34.01675 38.0 34.0 38.0 16.0 38.0 76-77 34.03375 38.0 34.0 38.0 16.0 38.0 78-79 33.87325 38.0 34.0 38.0 16.0 38.0 80-81 33.865125 38.0 34.0 38.0 16.0 38.0 82-83 33.912125 38.0 34.0 38.0 16.0 38.0 84-85 33.80675 38.0 34.0 38.0 16.0 38.0 86-87 33.82275 38.0 34.0 38.0 16.0 38.0 88-89 33.628625 38.0 33.5 38.0 15.5 38.0 90-91 33.704875 38.0 34.0 38.0 16.0 38.0 92-93 33.48125 38.0 33.5 38.0 15.0 38.0 94-95 33.561125000000004 38.0 34.0 38.0 15.0 38.0 96-97 33.72 38.0 34.0 38.0 15.0 38.0 98-99 33.734750000000005 38.0 34.0 38.0 15.0 38.0 100-101 32.776 37.5 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 8.0 18 13.0 19 36.0 20 56.0 21 61.0 22 64.0 23 73.0 24 70.0 25 85.0 26 100.0 27 99.0 28 87.0 29 118.0 30 142.0 31 141.0 32 176.0 33 197.0 34 256.0 35 389.0 36 729.0 37 1100.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.73551637279597 8.614609571788414 10.780856423173804 55.869017632241814 2 17.775 15.4 37.3 29.525000000000002 3 19.55 18.825 26.525 35.099999999999994 4 25.1 28.725 21.175 25.0 5 23.799999999999997 30.525000000000002 26.974999999999998 18.7 6 20.125 32.475 26.575 20.825 7 16.05 21.75 41.925000000000004 20.275000000000002 8 19.75 21.825 31.275 27.150000000000002 9 18.35 20.625 34.875 26.150000000000002 10-11 21.512500000000003 28.5625 26.1 23.825 12-13 21.34817408704352 23.13656828414207 28.08904452226113 27.426213106553277 14-15 21.248124062031014 25.57528764382191 28.301650825412704 24.874937468734366 16-17 22.91041041041041 25.713213213213216 26.13863863863864 25.237737737737735 18-19 22.52252252252252 26.101101101101097 26.001001001001 25.375375375375377 20-21 21.795673377516568 25.04689258471927 27.035138176816304 26.12229586094785 22-23 21.892973243310827 26.069017254313575 27.569392348087025 24.468617154288573 24-25 21.205301325331334 25.10627656914228 27.031757939484873 26.65666416604151 26-27 21.527690961370173 25.9407425928241 26.828353544193025 25.703212901612705 28-29 22.340292536567073 25.703212901612705 26.840855106888363 25.115639454931866 30-31 22.575 25.424999999999997 26.437500000000004 25.5625 32-33 22.075 25.162499999999998 26.5875 26.174999999999997 34-35 21.8875 25.924999999999997 26.8 25.387500000000003 36-37 22.537499999999998 25.662499999999998 26.5 25.3 38-39 22.55 26.2125 26.125 25.112499999999997 40-41 21.45 26.6625 26.437500000000004 25.45 42-43 22.35 25.687500000000004 25.6125 26.35 44-45 21.675 26.075 26.4625 25.7875 46-47 22.5 26.0 25.324999999999996 26.174999999999997 48-49 22.275 25.974999999999998 26.224999999999998 25.525 50-51 21.462500000000002 26.087500000000002 26.637499999999996 25.8125 52-53 22.325 24.9375 27.250000000000004 25.4875 54-55 22.725 24.9875 25.650000000000002 26.637499999999996 56-57 21.3875 26.125 26.75 25.7375 58-59 22.287499999999998 25.7875 26.650000000000002 25.275 60-61 21.987499999999997 25.1875 26.5125 26.3125 62-63 22.7 24.95 26.387500000000003 25.9625 64-65 21.5625 26.775 26.650000000000002 25.0125 66-67 22.525000000000002 25.0625 26.5625 25.85 68-69 22.275 25.724999999999998 26.3125 25.687500000000004 70-71 23.05 25.825 26.1125 25.0125 72-73 22.5625 25.3125 26.0375 26.087500000000002 74-75 22.675 24.637500000000003 27.2625 25.424999999999997 76-77 22.675 25.95 25.75 25.624999999999996 78-79 22.537499999999998 25.837500000000002 26.5625 25.0625 80-81 22.7625 25.7 26.275 25.2625 82-83 22.7625 25.074999999999996 27.187499999999996 24.975 84-85 22.95 24.962500000000002 26.875 25.2125 86-87 21.95 26.6 25.587500000000002 25.8625 88-89 21.912499999999998 26.625 26.0125 25.45 90-91 23.025000000000002 25.362499999999997 25.7 25.912499999999998 92-93 23.525 25.5625 25.637500000000003 25.275 94-95 23.2625 25.837500000000002 25.937500000000004 24.962500000000002 96-97 22.6375 25.874999999999996 24.8 26.687499999999996 98-99 22.6875 26.4125 25.7625 25.137500000000003 100-101 23.05 25.912499999999998 25.650000000000002 25.387500000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 1.5 27 2.5 28 3.0 29 3.0 30 3.0 31 5.5 32 10.0 33 13.5 34 21.5 35 28.0 36 42.5 37 64.0 38 77.5 39 102.5 40 138.5 41 185.0 42 209.5 43 202.5 44 202.5 45 217.5 46 228.0 47 224.5 48 211.0 49 198.0 50 193.0 51 173.0 52 147.0 53 134.0 54 114.0 55 113.0 56 106.5 57 82.5 58 81.0 59 71.5 60 65.0 61 61.0 62 48.0 63 39.5 64 34.0 65 33.5 66 28.0 67 26.5 68 24.0 69 11.5 70 6.5 71 4.5 72 3.5 73 2.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.05 14-15 0.05 16-17 0.1 18-19 0.1 20-21 0.0375 22-23 0.025 24-25 0.025 26-27 0.0125 28-29 0.0125 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52249308871576 99.0 2 0.42724302588590096 0.8500000000000001 3 0.050263885398341285 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.575 0.0 0.0 0.0 0.0 84-85 0.75 0.0 0.0 0.0 0.0 86-87 0.8999999999999999 0.0 0.0 0.0 0.0 88-89 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610856 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610856_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.64775 33.0 28.0 33.0 18.0 34.0 2 30.0305 33.0 28.0 33.0 18.0 34.0 3 30.143 33.0 30.0 33.0 18.0 34.0 4 29.84425 33.0 30.0 33.0 15.0 34.0 5 29.72275 33.0 30.0 33.0 15.0 34.0 6 33.232 38.0 31.0 38.0 16.0 38.0 7 33.64975 38.0 33.0 38.0 16.0 38.0 8 33.2275 38.0 31.0 38.0 16.0 38.0 9 33.49825 38.0 33.0 38.0 16.0 38.0 10-11 33.207125000000005 38.0 31.0 38.0 16.0 38.0 12-13 33.396125 38.0 32.5 38.0 16.0 38.0 14-15 33.34075 38.0 32.5 38.0 16.0 38.0 16-17 32.724999999999994 37.5 30.0 38.0 16.0 38.0 18-19 33.069374999999994 37.5 31.0 38.0 16.0 38.0 20-21 33.197625 38.0 31.5 38.0 16.0 38.0 22-23 33.279375 38.0 32.0 38.0 16.0 38.0 24-25 33.249125 38.0 32.0 38.0 16.0 38.0 26-27 33.223625 38.0 32.0 38.0 16.0 38.0 28-29 32.964124999999996 38.0 30.0 38.0 16.0 38.0 30-31 33.155375 38.0 31.5 38.0 16.0 38.0 32-33 33.28675 38.0 33.0 38.0 16.0 38.0 34-35 33.402375 38.0 33.0 38.0 16.0 38.0 36-37 33.040375 38.0 31.0 38.0 16.0 38.0 38-39 33.3895 38.0 33.0 38.0 16.0 38.0 40-41 33.431625 38.0 32.0 38.0 16.0 38.0 42-43 33.09375 38.0 31.5 38.0 16.0 38.0 44-45 33.428 38.0 33.0 38.0 16.0 38.0 46-47 33.425375 38.0 33.0 38.0 16.0 38.0 48-49 33.501125 38.0 33.0 38.0 16.0 38.0 50-51 33.241625 38.0 32.0 38.0 16.0 38.0 52-53 33.20575 38.0 31.0 38.0 16.0 38.0 54-55 33.233125 38.0 32.0 38.0 16.0 38.0 56-57 33.064125000000004 38.0 31.0 38.0 16.0 38.0 58-59 33.2065 38.0 32.0 38.0 16.0 38.0 60-61 33.28175 38.0 31.5 38.0 16.0 38.0 62-63 33.069625 38.0 32.0 38.0 16.0 38.0 64-65 33.305499999999995 38.0 32.5 38.0 16.0 38.0 66-67 33.332125000000005 38.0 32.0 38.0 16.0 38.0 68-69 33.368375 38.0 33.0 38.0 16.0 38.0 70-71 33.408875 38.0 33.0 38.0 16.0 38.0 72-73 33.305 38.0 32.0 38.0 16.0 38.0 74-75 33.30625 38.0 33.0 38.0 16.0 38.0 76-77 33.033625 38.0 31.0 38.0 16.0 38.0 78-79 33.06575 38.0 31.0 38.0 16.0 38.0 80-81 32.910125 38.0 31.0 38.0 16.0 38.0 82-83 32.987625 38.0 31.0 38.0 15.0 38.0 84-85 33.049 38.0 31.5 38.0 15.5 38.0 86-87 33.114125 38.0 31.5 38.0 15.0 38.0 88-89 32.90775 38.0 31.0 38.0 15.0 38.0 90-91 32.79875 38.0 31.0 38.0 15.0 38.0 92-93 32.729375000000005 38.0 31.0 38.0 15.0 38.0 94-95 32.862750000000005 38.0 31.0 38.0 15.0 38.0 96-97 32.773624999999996 37.5 31.0 38.0 15.0 38.0 98-99 32.841625 38.0 31.0 38.0 15.0 38.0 100-101 31.57475 36.0 27.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 12.0 18 30.0 19 51.0 20 69.0 21 73.0 22 84.0 23 80.0 24 88.0 25 99.0 26 99.0 27 119.0 28 111.0 29 103.0 30 125.0 31 144.0 32 166.0 33 182.0 34 264.0 35 309.0 36 523.0 37 1269.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.325000000000003 15.425 14.299999999999999 40.949999999999996 2 27.200000000000003 21.375 34.225 17.2 3 22.3 23.474999999999998 26.674999999999997 27.55 4 26.35 30.349999999999998 21.25 22.05 5 28.875 32.1 19.725 19.3 6 21.775 35.875 21.55 20.8 7 20.775 17.625 38.15 23.45 8 23.075000000000003 20.575 27.575 28.775000000000002 9 23.175 22.15 28.4 26.275 10-11 26.3125 27.85 21.875 23.962500000000002 12-13 26.174999999999997 22.8375 25.5375 25.45 14-15 25.912499999999998 25.7125 25.174999999999997 23.200000000000003 16-17 26.2875 25.724999999999998 24.7875 23.200000000000003 18-19 25.05 26.5 24.1375 24.3125 20-21 26.0125 25.337500000000002 25.2375 23.4125 22-23 26.4125 25.7375 23.724999999999998 24.125 24-25 25.2 25.0125 25.6 24.1875 26-27 25.775 26.0 25.4875 22.7375 28-29 26.2625 26.025 24.4875 23.225 30-31 25.5125 25.4375 25.5 23.549999999999997 32-33 24.8125 26.674999999999997 25.4375 23.075000000000003 34-35 26.275 25.9625 24.95 22.8125 36-37 25.525 25.900000000000002 24.4125 24.1625 38-39 25.0625 26.787499999999998 25.8 22.35 40-41 25.912499999999998 25.4875 25.5625 23.0375 42-43 24.9 26.674999999999997 24.775 23.65 44-45 25.687500000000004 26.125 24.6875 23.5 46-47 26.237500000000004 24.9125 25.124999999999996 23.724999999999998 48-49 24.85 26.0375 25.2375 23.875 50-51 26.1125 26.224999999999998 25.362499999999997 22.3 52-53 24.975 25.85 25.7625 23.4125 54-55 24.45 26.275 25.7 23.575 56-57 24.525 26.625 25.837500000000002 23.0125 58-59 26.4625 25.7125 24.175 23.65 60-61 25.45 25.662499999999998 25.674999999999997 23.2125 62-63 26.3 25.1 25.387500000000003 23.2125 64-65 25.687500000000004 26.9125 24.575 22.825 66-67 24.9875 26.0 25.4 23.6125 68-69 25.825 26.187500000000004 25.5625 22.425 70-71 26.025 26.525 25.525 21.925 72-73 24.9 26.150000000000002 26.237500000000004 22.7125 74-75 25.374999999999996 26.2125 25.2125 23.200000000000003 76-77 24.8125 26.137500000000003 25.6 23.45 78-79 25.412499999999998 26.075 25.8625 22.650000000000002 80-81 25.650000000000002 26.1625 25.912499999999998 22.275 82-83 26.137500000000003 27.0625 25.025 21.775 84-85 25.7125 26.55 24.3625 23.375 86-87 24.9875 26.3 25.687500000000004 23.025000000000002 88-89 26.987499999999997 25.4375 24.4375 23.1375 90-91 26.625 25.674999999999997 25.0375 22.662499999999998 92-93 26.3625 26.3 25.587500000000002 21.75 94-95 25.924999999999997 25.9625 25.7875 22.325 96-97 25.2625 25.900000000000002 25.825 23.0125 98-99 25.412499999999998 26.224999999999998 26.237500000000004 22.125 100-101 25.9875 26.174999999999997 25.525 22.3125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 1.5 29 1.0 30 2.0 31 3.5 32 5.0 33 6.0 34 11.0 35 20.5 36 37.0 37 54.5 38 62.5 39 93.0 40 127.0 41 160.0 42 189.5 43 194.0 44 210.5 45 218.0 46 212.5 47 211.5 48 207.5 49 199.5 50 180.5 51 166.0 52 150.0 53 139.0 54 132.0 55 117.5 56 114.0 57 103.0 58 85.5 59 90.5 60 91.5 61 72.5 62 59.0 63 52.0 64 51.5 65 44.0 66 30.5 67 28.0 68 24.5 69 17.5 70 10.0 71 5.5 72 3.5 73 1.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42094662638469 98.725 2 0.4531722054380665 0.8999999999999999 3 0.12588116817724068 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.3125 0.0 0.0 0.0 0.0 78-79 0.3375 0.0 0.0 0.0 0.0 80-81 0.4625 0.0 0.0 0.0 0.0 82-83 0.55 0.0 0.0 0.0 0.0 84-85 0.7125 0.0 0.0 0.0 0.0 86-87 0.8500000000000001 0.0 0.0 0.0 0.0 88-89 1.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680266 spots for ERR10610856.sra Written 680266 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra Read 680262 spots for ERR10610856.sra Written 680262 spots for ERR10610856.sra SRR ids: ['ERR10610856.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g6cysn76 ERR10610856.sra spots: 13605244 blocks: [[1, 680262], [680263, 1360524], [1360525, 2040786], [2040787, 2721048], [2721049, 3401310], [3401311, 4081572], [4081573, 4761834], [4761835, 5442096], [5442097, 6122358], [6122359, 6802620], [6802621, 7482882], [7482883, 8163144], [8163145, 8843406], [8843407, 9523668], [9523669, 10203930], [10203931, 10884192], [10884193, 11564454], [11564455, 12244716], [12244717, 12924978], [12924979, 13605244]] ERR10610856 file size 3273319 ERR10610856 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610856 ERR10610856_1.fastq ERR10610856_2.fastq Input file: ERR10610856_1.fastq Paired file: ERR10610856_2.fastq trimmed: ERR10610856-trimmed-pair1.fastq, ERR10610856-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:26:10 2024 >> started Fri Dec 6 21:26:29 2024 >> done (18.772s) 13605244 read pairs processed; of these: 56 ( 0.00%) short read pairs filtered out after trimming by size control 563 ( 0.00%) empty read pairs filtered out after trimming by size control 13604625 (100.00%) read pairs available; of these: 401240 ( 2.95%) trimmed read pairs available after processing 13203385 (97.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 6 0.00% 29 5 0.00% 30 4 0.00% 31 7 0.00% 32 4 0.00% 33 10 0.00% 34 10 0.00% 35 11 0.00% 36 17 0.00% 37 20 0.00% 38 26 0.00% 39 21 0.00% 40 26 0.00% 41 33 0.00% 42 36 0.00% 43 39 0.00% 44 48 0.00% 45 53 0.00% 46 67 0.00% 47 65 0.00% 48 81 0.00% 49 92 0.00% 50 126 0.00% 51 153 0.00% 52 158 0.00% 53 170 0.00% 54 191 0.00% 55 219 0.00% 56 240 0.00% 57 275 0.00% 58 325 0.00% 59 335 0.00% 60 408 0.00% 61 488 0.00% 62 511 0.00% 63 607 0.00% 64 703 0.01% 65 814 0.01% 66 845 0.01% 67 1010 0.01% 68 1143 0.01% 69 1285 0.01% 70 1524 0.01% 71 1530 0.01% 72 1856 0.01% 73 2044 0.02% 74 2394 0.02% 75 2734 0.02% 76 3127 0.02% 77 3483 0.03% 78 3911 0.03% 79 4540 0.03% 80 5106 0.04% 81 5598 0.04% 82 6147 0.05% 83 7193 0.05% 84 7967 0.06% 85 9016 0.07% 86 10151 0.07% 87 10917 0.08% 88 12613 0.09% 89 13703 0.10% 90 15097 0.11% 91 17052 0.13% 92 18374 0.14% 93 19927 0.15% 94 22461 0.17% 95 24085 0.18% 96 25824 0.19% 97 29217 0.21% 98 31922 0.23% 99 34134 0.25% 100 36891 0.27% 101 13203385 97.05% 13604625 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=12 prefix-density=0.38 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=28.97 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.6 sequence=GATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCACCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGTTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=5.04 fanout-score-rank=8 prefix-density=0.46 prefix-fanout=3.7 sequence=AAGGAGCTGGAGGAGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=22.67 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=4.5 sequence=AGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGTGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCGGCCAAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCT ERR10610856 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:27:11 Started mapping on | Dec 06 21:27:13 Finished on | Dec 06 21:30:08 Mapping speed, Million of reads per hour | 279.87 Number of input reads | 13604625 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 12222106 Uniquely mapped reads % | 89.84% Average mapped length | 200.10 Number of splices: Total | 8400518 Number of splices: Annotated (sjdb) | 7913616 Number of splices: GT/AG | 8285938 Number of splices: GC/AG | 101118 Number of splices: AT/AC | 3489 Number of splices: Non-canonical | 9973 Mismatch rate per base, % | 0.87% Deletion rate per base | 0.01% Deletion average length | 2.17 Insertion rate per base | 0.01% Insertion average length | 1.82 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339128 % of reads mapped to multiple loci | 2.49% Number of reads mapped to too many loci | 17868 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.35% % of reads unmapped: other | 1.19% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1043391 1043391 1043391 N_multimapping 339128 339128 339128 N_noFeature 444527 11902544 519092 N_ambiguous 286478 1284 42162 UnstrandedReadsAssigned:11491101 PositiveStrandReadsAssigned:318278 NegativeStrandReadsAssigned:11660852 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610856 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610856-trimmed-pair1.fastq ERR10610856-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,604,625 reads, 11,943,926 reads pseudoaligned [quant] estimated average fragment length: 173.636 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,227 rounds 52973 ERR10610856.ke.tsv 35125 ERR10610856.se.tsv 88098 total ==> ERR10610856.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 763.466 23.074 3.83856 PNS24247 1044 871.364 34.3436 5.0059 PNS24249 1928 1755.36 22.1232 1.60073 PNS24246 1044 871.364 34.3436 5.0059 PNS24248 1044 871.364 34.3436 5.0059 PNS24244 1471 1298.36 52.7719 5.16229 PNS24243 293 127.974 0 0 KQK14069 1603 1430.36 1186.87 105.388 KQK14071 474 302.772 39.7967 16.6943 ==> ERR10610856.se.tsv <== BRADI_1g14170v3 1431 BRADI_1g53295v3 42 BRADI_1g59795v3 294 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 203 BRADI_1g74790v3 81 BRADI_1g09890v3 0 BRADI_1g77505v3 295 BRADI_1g48960v3 0 ERR10610856 completed mapping pipeline successfully