Starting /dee2/code/volunteer_pipeline.sh ERR10610857 current disk space = 1548944973824 free memory = 1410948392 ERR10610857 SRAfilesize 146c22e0c9e4eb6286205e21ad35c2ce ERR10610857.sra ERR10610857.sra file validated ERR10610857 is paired end ERR10610857 is conventional basespace ERR10610857 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610857_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.5565 32.0 30.0 33.0 18.0 33.0 2 30.48125 33.0 31.0 33.0 18.0 33.0 3 30.78375 33.0 31.0 33.0 25.0 34.0 4 30.053 33.0 29.0 33.0 25.0 34.0 5 30.761 33.0 32.0 33.0 25.0 34.0 6 33.28325 37.0 32.0 38.0 16.0 38.0 7 34.2475 38.0 34.0 38.0 26.0 38.0 8 34.33275 38.0 34.0 38.0 16.0 38.0 9 34.7335 38.0 35.0 38.0 26.0 38.0 10-11 34.616125 38.0 35.0 38.0 26.0 38.0 12-13 34.51575 38.0 35.0 38.0 26.0 38.0 14-15 34.5095 38.0 35.0 38.0 25.5 38.0 16-17 34.637125 38.0 35.0 38.0 26.0 38.0 18-19 34.562 38.0 35.0 38.0 21.0 38.0 20-21 23.880499999999998 22.0 21.5 28.5 15.0 33.0 22-23 32.1315 35.5 30.5 37.0 16.0 37.5 24-25 34.223375000000004 38.0 34.0 38.0 24.5 38.0 26-27 34.645625 38.0 35.0 38.0 25.5 38.0 28-29 34.588625 38.0 35.0 38.0 25.0 38.0 30-31 34.797875000000005 38.0 35.5 38.0 25.0 38.0 32-33 34.643 38.0 35.0 38.0 25.0 38.0 34-35 34.623125 38.0 35.0 38.0 25.0 38.0 36-37 34.503875 38.0 35.0 38.0 24.5 38.0 38-39 34.609 38.0 35.0 38.0 25.0 38.0 40-41 34.64575 38.0 35.0 38.0 25.0 38.0 42-43 34.4345 38.0 35.0 38.0 25.0 38.0 44-45 34.491875 38.0 35.0 38.0 25.0 38.0 46-47 34.648375 38.0 35.0 38.0 25.0 38.0 48-49 27.245874999999998 27.0 25.5 31.5 19.5 35.5 50-51 29.607875 31.0 27.5 33.0 16.0 36.5 52-53 33.6455 37.5 33.5 38.0 20.0 38.0 54-55 27.19025 27.0 25.0 31.5 19.5 36.5 56-57 29.521625 31.0 27.5 33.0 16.0 37.0 58-59 33.675 37.5 33.5 38.0 20.0 38.0 60-61 34.338499999999996 38.0 34.5 38.0 24.5 38.0 62-63 34.61525 38.0 35.0 38.0 25.0 38.0 64-65 34.494375000000005 38.0 35.0 38.0 24.5 38.0 66-67 34.60675 38.0 35.0 38.0 25.0 38.0 68-69 34.640125 38.0 35.0 38.0 25.0 38.0 70-71 34.551 38.0 35.0 38.0 25.0 38.0 72-73 24.037 22.0 21.0 27.5 15.0 36.5 74-75 31.677124999999997 34.0 29.0 37.0 16.0 38.0 76-77 34.187875 38.0 34.0 38.0 24.5 38.0 78-79 34.5535 38.0 35.0 38.0 25.0 38.0 80-81 34.646 38.0 35.0 38.0 25.0 38.0 82-83 34.809875 38.0 35.5 38.0 25.0 38.0 84-85 34.781 38.0 35.0 38.0 25.5 38.0 86-87 34.680625 38.0 35.0 38.0 25.0 38.0 88-89 34.587375 38.0 35.0 38.0 25.0 38.0 90-91 34.559375 38.0 35.0 38.0 24.0 38.0 92-93 34.611875 38.0 35.0 38.0 25.0 38.0 94-95 33.222375 37.0 31.0 38.0 19.0 38.0 96-97 34.2435 38.0 34.5 38.0 23.0 38.0 98-99 25.939375 26.5 24.5 26.5 18.5 32.5 100-101 27.100375 27.5 24.5 32.0 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 11.0 19 32.0 20 35.0 21 39.0 22 57.0 23 60.0 24 76.0 25 75.0 26 80.0 27 80.0 28 109.0 29 132.0 30 145.0 31 151.0 32 253.0 33 279.0 34 481.0 35 1316.0 36 537.0 37 51.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.070707070707073 10.85858585858586 11.136363636363637 50.93434343434343 2 22.05 18.775 34.425 24.75 3 23.474999999999998 20.65 23.25 32.625 4 27.3 27.200000000000003 20.7 24.8 5 24.675 32.2 23.325000000000003 19.8 6 18.375 35.225 25.575 20.825 7 15.325 21.9 42.625 20.150000000000002 8 19.475 22.075 31.225 27.224999999999998 9 17.599999999999998 21.975 34.275 26.150000000000002 10-11 21.925 30.925000000000004 23.4375 23.7125 12-13 21.877734716839605 24.103012876609576 27.740967620952617 26.2782847855982 14-15 21.205301325331334 26.36909227306827 27.144286071517882 25.28132033008252 16-17 21.767941985496375 26.544136034008503 26.93173293323331 24.756189047261813 18-19 21.705426356589147 27.45686421605401 25.668917229307326 25.168792198049513 20-21 21.305326331582897 31.032758189547387 22.06801700425106 25.593898474618655 22-23 21.890236279534943 26.828353544193025 26.153269158644832 25.128141017627204 24-25 21.665208151018877 26.453306663332913 26.56582072759095 25.315664458057256 26-27 21.3 27.375 26.137500000000003 25.1875 28-29 21.8 26.650000000000002 26.6625 24.887500000000003 30-31 21.4375 27.237499999999997 26.35 24.975 32-33 21.425 26.2875 27.775 24.5125 34-35 21.762500000000003 26.4125 26.6 25.224999999999998 36-37 21.09013626703338 26.453306663332913 26.59082385298162 25.86573321665208 38-39 21.3 26.424999999999997 26.424999999999997 25.85 40-41 21.575 27.1 25.35 25.974999999999998 42-43 21.45 26.8375 26.8375 24.875 44-45 21.55 26.35 26.6 25.5 46-47 21.875 26.275 26.487500000000004 25.362499999999997 48-49 23.4375 26.787499999999998 25.337500000000002 24.4375 50-51 21.1875 26.05 26.924999999999997 25.837500000000002 52-53 22.95 25.7375 26.8375 24.474999999999998 54-55 21.525 29.549999999999997 24.65 24.275 56-57 21.45 27.0125 26.5125 25.025 58-59 22.575 26.525 26.637499999999996 24.2625 60-61 22.6 26.0625 25.95 25.387500000000003 62-63 22.1 26.8375 25.1875 25.874999999999996 64-65 22.3125 26.950000000000003 26.05 24.6875 66-67 22.162499999999998 26.487500000000004 25.35 26.0 68-69 22.537499999999998 26.375 26.575 24.5125 70-71 22.225 26.5 25.887500000000003 25.387500000000003 72-73 23.175 29.4375 24.0625 23.325000000000003 74-75 22.237499999999997 27.075 25.7625 24.925 76-77 22.400000000000002 26.5 26.775 24.325 78-79 22.675 25.912499999999998 26.4625 24.95 80-81 22.35 27.1 25.575 24.975 82-83 21.8 26.4625 25.874999999999996 25.8625 84-85 22.95 26.4625 25.2375 25.35 86-87 21.762500000000003 27.237499999999997 26.424999999999997 24.575 88-89 22.415301912739093 26.878359794974372 25.928241030128767 24.778097262157768 90-91 22.400000000000002 26.25 26.125 25.224999999999998 92-93 22.55 26.6625 25.2375 25.55 94-95 22.237499999999997 26.7625 26.5 24.5 96-97 23.075000000000003 26.3 25.3125 25.3125 98-99 24.212500000000002 27.9125 23.8125 24.0625 100-101 22.7375 26.7625 25.687500000000004 24.8125 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.0 26 0.0 27 1.0 28 1.0 29 1.0 30 4.5 31 8.0 32 8.5 33 14.0 34 22.0 35 31.0 36 46.0 37 66.0 38 88.0 39 115.5 40 144.0 41 172.5 42 190.5 43 206.5 44 232.5 45 254.0 46 249.0 47 232.0 48 220.5 49 213.5 50 201.5 51 189.0 52 166.5 53 134.0 54 115.0 55 99.0 56 92.5 57 87.5 58 68.0 59 56.0 60 56.5 61 52.0 62 41.0 63 30.5 64 24.0 65 16.0 66 15.5 67 14.5 68 9.0 69 4.5 70 3.0 71 1.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.025 16-17 0.025 18-19 0.025 20-21 0.025 22-23 0.0125 24-25 0.0125 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0125 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0125 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.97499374843711 99.95 2 0.025006251562890724 0.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.6375 0.0 0.0 0.0 0.0 88-89 0.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610857 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610857_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.12325 33.0 30.0 33.0 18.0 34.0 2 30.3775 33.0 31.0 33.0 18.0 34.0 3 30.089 33.0 29.0 33.0 18.0 34.0 4 29.884 33.0 30.0 33.0 15.0 34.0 5 30.1555 33.0 31.0 33.0 15.0 34.0 6 33.24525 38.0 32.0 38.0 16.0 38.0 7 33.79725 38.0 33.0 38.0 16.0 38.0 8 33.77875 38.0 33.0 38.0 16.0 38.0 9 33.73625 38.0 34.0 38.0 16.0 38.0 10-11 33.606125 38.0 33.0 38.0 16.0 38.0 12-13 33.685874999999996 38.0 33.0 38.0 16.0 38.0 14-15 33.678875000000005 38.0 33.5 38.0 16.0 38.0 16-17 33.722750000000005 38.0 33.0 38.0 16.0 38.0 18-19 33.68025 38.0 33.5 38.0 16.0 38.0 20-21 33.453375 38.0 33.0 38.0 16.0 38.0 22-23 33.649249999999995 38.0 33.0 38.0 16.0 38.0 24-25 33.724000000000004 38.0 33.5 38.0 16.0 38.0 26-27 33.628 38.0 33.0 38.0 16.0 38.0 28-29 33.706875 38.0 33.0 38.0 16.0 38.0 30-31 33.90625 38.0 34.0 38.0 16.0 38.0 32-33 33.685125 38.0 33.5 38.0 16.0 38.0 34-35 33.329125000000005 38.0 32.0 38.0 16.0 38.0 36-37 33.641875 38.0 33.0 38.0 16.0 38.0 38-39 33.561499999999995 38.0 33.0 38.0 16.0 38.0 40-41 33.749375 38.0 33.5 38.0 16.0 38.0 42-43 34.010625000000005 38.0 34.0 38.0 16.0 38.0 44-45 33.854625 38.0 34.0 38.0 16.0 38.0 46-47 33.746375 38.0 34.0 38.0 16.0 38.0 48-49 33.751999999999995 38.0 34.0 38.0 16.0 38.0 50-51 33.74925 38.0 33.5 38.0 16.0 38.0 52-53 33.690625 38.0 33.5 38.0 16.0 38.0 54-55 33.605375 38.0 33.5 38.0 16.0 38.0 56-57 33.76575 38.0 33.5 38.0 16.0 38.0 58-59 33.830124999999995 38.0 34.0 38.0 16.0 38.0 60-61 33.640125 38.0 33.5 38.0 16.0 38.0 62-63 33.762875 38.0 33.0 38.0 16.0 38.0 64-65 33.535125 38.0 33.0 38.0 16.0 38.0 66-67 33.724000000000004 38.0 33.5 38.0 16.0 38.0 68-69 33.755875 38.0 34.0 38.0 16.0 38.0 70-71 33.712125 38.0 33.5 38.0 16.0 38.0 72-73 33.627875 38.0 34.0 38.0 16.0 38.0 74-75 33.364625000000004 38.0 33.0 38.0 16.0 38.0 76-77 33.65675 38.0 33.5 38.0 16.0 38.0 78-79 33.731625 38.0 34.0 38.0 16.0 38.0 80-81 33.56 38.0 33.5 38.0 16.0 38.0 82-83 33.614875 38.0 33.5 38.0 16.0 38.0 84-85 33.704499999999996 38.0 34.0 38.0 16.0 38.0 86-87 33.4785 38.0 33.0 38.0 15.5 38.0 88-89 33.486125 38.0 33.0 38.0 15.5 38.0 90-91 33.378125 38.0 33.0 38.0 15.0 38.0 92-93 33.26625 38.0 33.0 38.0 15.0 38.0 94-95 33.129999999999995 38.0 32.5 38.0 15.0 38.0 96-97 25.50375 21.5 19.0 36.0 14.5 38.0 98-99 21.405875 20.5 19.0 22.5 14.0 29.0 100-101 28.076625 29.5 23.0 35.5 15.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 7.0 18 23.0 19 48.0 20 54.0 21 71.0 22 81.0 23 61.0 24 89.0 25 87.0 26 90.0 27 99.0 28 91.0 29 147.0 30 132.0 31 156.0 32 184.0 33 190.0 34 262.0 35 448.0 36 1149.0 37 528.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.4 14.549999999999999 15.875 40.175 2 28.000000000000004 20.150000000000002 33.925 17.925 3 22.325 24.175 28.575 24.925 4 26.625 29.675 20.599999999999998 23.1 5 28.299999999999997 32.475 20.424999999999997 18.8 6 21.5 35.575 22.6 20.325 7 21.325 16.55 39.025 23.1 8 24.05 20.825 26.55 28.575 9 23.425 22.8 29.225 24.55 10-11 26.474999999999998 28.212500000000002 22.225 23.0875 12-13 26.0 22.6875 25.887500000000003 25.424999999999997 14-15 24.325 25.724999999999998 26.924999999999997 23.025000000000002 16-17 26.4125 25.2875 24.962500000000002 23.3375 18-19 25.887500000000003 24.4375 26.3125 23.3625 20-21 25.85 26.575 24.3625 23.2125 22-23 25.775 26.05 24.6125 23.5625 24-25 25.137500000000003 25.85 25.837500000000002 23.175 26-27 25.2 26.700000000000003 24.8 23.3 28-29 26.0375 25.775 24.85 23.3375 30-31 25.362499999999997 26.4625 25.724999999999998 22.45 32-33 25.2625 25.4625 25.912499999999998 23.3625 34-35 25.174999999999997 25.900000000000002 25.8125 23.1125 36-37 25.025 26.1125 26.0625 22.8 38-39 25.575 25.687500000000004 26.0 22.7375 40-41 25.624999999999996 26.2125 25.6 22.5625 42-43 24.5125 25.874999999999996 26.674999999999997 22.9375 44-45 25.0375 26.400000000000002 25.387500000000003 23.175 46-47 25.55 25.624999999999996 26.187500000000004 22.6375 48-49 25.2625 25.775 25.3 23.6625 50-51 24.5625 26.05 26.3125 23.075000000000003 52-53 25.45 25.912499999999998 26.0 22.6375 54-55 25.587500000000002 25.4625 25.5125 23.4375 56-57 25.324999999999996 25.7125 27.1125 21.85 58-59 25.412499999999998 24.825 26.6625 23.1 60-61 25.0 25.4625 26.150000000000002 23.3875 62-63 25.374999999999996 25.324999999999996 26.387500000000003 22.912499999999998 64-65 25.937500000000004 24.887500000000003 26.1625 23.0125 66-67 24.349999999999998 26.0625 27.125 22.4625 68-69 24.5125 25.75 26.85 22.8875 70-71 24.6125 25.837500000000002 25.974999999999998 23.575 72-73 25.162499999999998 25.95 26.2625 22.625 74-75 24.7875 26.9625 26.2625 21.987499999999997 76-77 25.912499999999998 25.275 26.5125 22.3 78-79 24.8 25.15 26.55 23.5 80-81 25.162499999999998 26.150000000000002 25.9875 22.7 82-83 24.6625 27.1375 25.8625 22.3375 84-85 25.35 26.0125 26.687499999999996 21.95 86-87 25.8125 25.424999999999997 27.3875 21.375 88-89 24.525 26.525 26.424999999999997 22.525000000000002 90-91 24.875 25.837500000000002 26.2125 23.075000000000003 92-93 25.4 26.7125 25.637500000000003 22.25 94-95 25.7375 25.7875 25.9625 22.5125 96-97 26.0125 26.1625 25.85 21.975 98-99 24.337500000000002 29.099999999999998 24.175 22.3875 100-101 25.7375 27.125 25.8 21.337500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.5 28 0.5 29 0.5 30 2.0 31 2.5 32 3.5 33 10.0 34 17.5 35 23.5 36 30.0 37 47.5 38 74.0 39 91.0 40 118.0 41 148.5 42 171.5 43 211.0 44 243.0 45 245.0 46 229.5 47 232.0 48 233.5 49 206.0 50 186.5 51 175.0 52 165.5 53 167.0 54 141.5 55 115.5 56 107.5 57 88.0 58 80.0 59 75.5 60 60.5 61 53.5 62 54.5 63 46.0 64 35.5 65 27.5 66 22.5 67 21.5 68 15.5 69 7.5 70 6.0 71 3.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.037500000000000006 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1375 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.4625 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.5874999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra Read 1133171 spots for ERR10610857.sra Written 1133171 spots for ERR10610857.sra SRR ids: ['ERR10610857.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_akl_rjqj ERR10610857.sra spots: 22663420 blocks: [[1, 1133171], [1133172, 2266342], [2266343, 3399513], [3399514, 4532684], [4532685, 5665855], [5665856, 6799026], [6799027, 7932197], [7932198, 9065368], [9065369, 10198539], [10198540, 11331710], [11331711, 12464881], [12464882, 13598052], [13598053, 14731223], [14731224, 15864394], [15864395, 16997565], [16997566, 18130736], [18130737, 19263907], [19263908, 20397078], [20397079, 21530249], [21530250, 22663420]] ERR10610857 file size 5467096 ERR10610857 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610857 ERR10610857_1.fastq ERR10610857_2.fastq Input file: ERR10610857_1.fastq Paired file: ERR10610857_2.fastq trimmed: ERR10610857-trimmed-pair1.fastq, ERR10610857-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:29:17 2024 >> started Fri Dec 6 21:29:41 2024 >> done (23.573s) 22663420 read pairs processed; of these: 60 ( 0.00%) short read pairs filtered out after trimming by size control 1191 ( 0.01%) empty read pairs filtered out after trimming by size control 22662169 (99.99%) read pairs available; of these: 770579 ( 3.40%) trimmed read pairs available after processing 21891590 (96.60%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 4 0.00% 27 2 0.00% 28 8 0.00% 29 4 0.00% 30 6 0.00% 31 11 0.00% 32 14 0.00% 33 16 0.00% 34 14 0.00% 35 22 0.00% 36 24 0.00% 37 29 0.00% 38 35 0.00% 39 48 0.00% 40 59 0.00% 41 56 0.00% 42 58 0.00% 43 84 0.00% 44 86 0.00% 45 103 0.00% 46 131 0.00% 47 139 0.00% 48 175 0.00% 49 188 0.00% 50 246 0.00% 51 270 0.00% 52 317 0.00% 53 341 0.00% 54 380 0.00% 55 406 0.00% 56 454 0.00% 57 490 0.00% 58 637 0.00% 59 744 0.00% 60 790 0.00% 61 888 0.00% 62 1072 0.00% 63 1179 0.01% 64 1302 0.01% 65 1487 0.01% 66 1764 0.01% 67 1975 0.01% 68 2186 0.01% 69 2516 0.01% 70 2822 0.01% 71 3223 0.01% 72 3744 0.02% 73 4154 0.02% 74 4713 0.02% 75 5386 0.02% 76 6192 0.03% 77 7003 0.03% 78 7904 0.03% 79 8978 0.04% 80 9704 0.04% 81 11054 0.05% 82 12356 0.05% 83 13957 0.06% 84 15527 0.07% 85 17434 0.08% 86 19729 0.09% 87 21446 0.09% 88 24427 0.11% 89 26791 0.12% 90 29176 0.13% 91 32791 0.14% 92 35250 0.16% 93 38640 0.17% 94 41998 0.19% 95 45823 0.20% 96 50544 0.22% 97 55442 0.24% 98 60247 0.27% 99 63917 0.28% 100 69434 0.31% 101 21891590 96.60% 22662169 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.73 fanout-score-rank=22 prefix-density=0.17 prefix-fanout=2.4 sequence=GCCCAGGCGAGGCCGCCCACGAAGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=248.86 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=28.3 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=33 prefix-density=0.13 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=1400.84 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=30.6 sequence=CTGCTGCTGCGCGCCAAGGCAAACTCCTTGGCGCAGCTGGGGAAGTACACCAGCGACGGCGAGGCCGCCGCTGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAGCCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATGGGAGATGGACATCAGAAAGTATACTGTGTTTTACCACCCTAATTAAGTAAAC ERR10610857 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:30:56 Started mapping on | Dec 06 21:30:56 Finished on | Dec 06 21:34:44 Mapping speed, Million of reads per hour | 357.82 Number of input reads | 22662169 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 20566930 Uniquely mapped reads % | 90.75% Average mapped length | 199.79 Number of splices: Total | 13586606 Number of splices: Annotated (sjdb) | 12745264 Number of splices: GT/AG | 13375916 Number of splices: GC/AG | 166065 Number of splices: AT/AC | 7930 Number of splices: Non-canonical | 36695 Mismatch rate per base, % | 0.91% Deletion rate per base | 0.02% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 405585 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 17700 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.73% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1689654 1689654 1689654 N_multimapping 405585 405585 405585 N_noFeature 738337 19971955 875942 N_ambiguous 522203 2489 66212 UnstrandedReadsAssigned:19306390 PositiveStrandReadsAssigned:592486 NegativeStrandReadsAssigned:19624776 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610857 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610857-trimmed-pair1.fastq ERR10610857-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,662,169 reads, 20,188,244 reads pseudoaligned [quant] estimated average fragment length: 170.594 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 ERR10610857.ke.tsv 35125 ERR10610857.se.tsv 88098 total ==> ERR10610857.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 766.592 23.8732 2.35907 PNS24247 1044 874.406 59.0877 5.11891 PNS24249 1928 1758.41 24.4868 1.05489 PNS24246 1044 874.406 59.0877 5.11891 PNS24248 1044 874.406 59.0877 5.11891 PNS24244 1471 1301.41 144.377 8.40387 PNS24243 293 130.638 0 0 KQK14069 1603 1433.41 1696.49 89.6554 KQK14071 474 305.901 57.0782 14.1346 ==> ERR10610857.se.tsv <== BRADI_1g14170v3 2035 BRADI_1g53295v3 1182 BRADI_1g59795v3 971 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 730 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 481 BRADI_1g48960v3 0 ERR10610857 completed mapping pipeline successfully