Starting /dee2/code/volunteer_pipeline.sh ERR10610858 current disk space = 1548925321216 free memory = 1435576588 ERR10610858 SRAfilesize 73e2e889980a3684e59dcbf48ecd78ae ERR10610858.sra ERR10610858.sra file validated ERR10610858 is paired end ERR10610858 is conventional basespace ERR10610858 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610858_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 47 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.986 32.0 25.0 33.0 18.0 33.0 2 29.571 32.0 28.0 33.0 18.0 33.0 3 30.835 33.0 31.0 33.0 25.0 33.0 4 30.4885 33.0 31.0 33.0 25.0 34.0 5 30.92575 33.0 32.0 33.0 25.0 34.0 6 33.50775 37.0 33.0 38.0 16.0 38.0 7 34.2685 38.0 34.0 38.0 26.0 38.0 8 34.63 38.0 35.0 38.0 26.0 38.0 9 34.789 38.0 35.0 38.0 26.0 38.0 10-11 34.607124999999996 38.0 35.5 38.0 26.0 38.0 12-13 34.515375 38.0 35.0 38.0 26.0 38.0 14-15 34.62825 38.0 35.0 38.0 26.0 38.0 16-17 34.567 38.0 35.0 38.0 25.5 38.0 18-19 34.69375 38.0 35.0 38.0 26.0 38.0 20-21 23.97925 22.0 21.5 28.5 15.0 33.5 22-23 32.269 35.5 30.5 37.0 20.0 37.5 24-25 34.22725 38.0 34.0 38.0 20.5 38.0 26-27 34.59225 38.0 35.0 38.0 25.0 38.0 28-29 34.517250000000004 38.0 35.0 38.0 24.5 38.0 30-31 34.789875 38.0 35.5 38.0 25.0 38.0 32-33 34.6965 38.0 35.5 38.0 25.0 38.0 34-35 34.588 38.0 35.0 38.0 25.0 38.0 36-37 34.57 38.0 35.0 38.0 25.0 38.0 38-39 34.74225 38.0 36.0 38.0 25.0 38.0 40-41 34.730374999999995 38.0 35.5 38.0 25.0 38.0 42-43 34.619 38.0 35.0 38.0 25.0 38.0 44-45 34.56225 38.0 35.0 38.0 25.0 38.0 46-47 34.734875 38.0 35.5 38.0 25.0 38.0 48-49 27.387 27.0 25.5 31.5 19.5 36.0 50-51 29.721625 31.5 27.5 33.5 16.0 37.5 52-53 33.661375 37.5 33.5 38.0 24.0 38.0 54-55 27.2245 27.0 25.0 31.5 19.0 37.0 56-57 29.445500000000003 31.0 27.5 32.5 16.0 37.5 58-59 33.643874999999994 37.0 32.5 38.0 24.0 38.0 60-61 34.532125 38.0 34.5 38.0 25.0 38.0 62-63 34.724125 38.0 35.0 38.0 25.0 38.0 64-65 34.6065 38.0 35.0 38.0 24.5 38.0 66-67 34.82925 38.0 35.5 38.0 25.0 38.0 68-69 34.79125 38.0 35.5 38.0 25.5 38.0 70-71 34.56975 38.0 35.0 38.0 25.0 38.0 72-73 24.017249999999997 22.0 21.0 27.5 15.0 36.5 74-75 31.833999999999996 34.0 29.0 37.0 16.0 38.0 76-77 34.177875 38.0 34.0 38.0 24.5 38.0 78-79 34.546625 38.0 35.0 38.0 25.0 38.0 80-81 34.689125000000004 38.0 35.5 38.0 25.0 38.0 82-83 34.724875 38.0 35.0 38.0 25.0 38.0 84-85 34.71725 38.0 35.5 38.0 25.0 38.0 86-87 34.596875 38.0 35.0 38.0 25.0 38.0 88-89 34.6495 38.0 35.0 38.0 25.0 38.0 90-91 34.589375000000004 38.0 35.0 38.0 25.0 38.0 92-93 34.494749999999996 38.0 35.0 38.0 25.0 38.0 94-95 33.20125 37.0 31.0 38.0 19.0 38.0 96-97 34.178625 38.0 34.0 38.0 23.0 38.0 98-99 25.695875 26.5 24.5 26.5 18.0 32.5 100-101 26.989625 27.5 25.0 31.5 15.0 33.5 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 9.0 19 36.0 20 42.0 21 45.0 22 53.0 23 49.0 24 57.0 25 87.0 26 85.0 27 76.0 28 112.0 29 110.0 30 133.0 31 183.0 32 231.0 33 322.0 34 511.0 35 1290.0 36 488.0 37 80.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.25347134561979 11.007321383489018 10.022721534965918 42.71648573592527 2 24.7 15.275 36.475 23.549999999999997 3 21.655413853463365 21.630407601900476 23.88097024256064 32.83320830207552 4 25.0 28.65 21.075 25.275 5 24.9 31.05 25.25 18.8 6 20.175 33.225 25.6 21.0 7 15.75 22.325 41.875 20.05 8 19.525000000000002 21.099999999999998 32.175 27.200000000000003 9 20.474999999999998 20.75 34.125 24.65 10-11 22.95 30.125 22.375 24.55 12-13 22.15 24.575 27.037499999999998 26.237500000000004 14-15 22.675 25.55 26.950000000000003 24.825 16-17 22.4625 25.7125 26.5125 25.3125 18-19 22.2625 26.937499999999996 26.087500000000002 24.712500000000002 20-21 20.962500000000002 31.3 21.9 25.837500000000002 22-23 22.6375 25.374999999999996 27.200000000000003 24.7875 24-25 21.425 27.0 26.137500000000003 25.4375 26-27 21.025 26.650000000000002 27.400000000000002 24.925 28-29 23.2875 25.9625 26.6 24.15 30-31 22.1875 25.900000000000002 26.637499999999996 25.275 32-33 21.587500000000002 26.3625 27.250000000000004 24.8 34-35 22.237499999999997 26.275 26.187500000000004 25.3 36-37 21.675 26.4625 26.487500000000004 25.374999999999996 38-39 22.275 25.637500000000003 26.387500000000003 25.7 40-41 21.9375 26.55 26.075 25.4375 42-43 22.4375 25.874999999999996 26.687499999999996 25.0 44-45 22.25 26.4625 26.625 24.6625 46-47 21.8125 25.974999999999998 27.237499999999997 24.975 48-49 23.95 26.325 25.162499999999998 24.5625 50-51 21.8 26.05 26.487500000000004 25.662499999999998 52-53 22.4625 26.700000000000003 25.874999999999996 24.962500000000002 54-55 21.4375 29.25 23.9125 25.4 56-57 22.175 25.874999999999996 26.8625 25.087500000000002 58-59 22.35 25.874999999999996 26.5375 25.2375 60-61 22.2 26.325 26.474999999999998 25.0 62-63 22.2625 26.900000000000002 26.5375 24.3 64-65 23.3625 25.5125 26.2125 24.9125 66-67 23.0375 26.200000000000003 25.825 24.9375 68-69 22.537499999999998 25.7875 26.7625 24.9125 70-71 22.412499999999998 26.450000000000003 25.974999999999998 25.162499999999998 72-73 23.175 30.8125 23.2625 22.75 74-75 22.775000000000002 25.924999999999997 26.137500000000003 25.162499999999998 76-77 22.662499999999998 25.974999999999998 26.025 25.337500000000002 78-79 22.3375 26.650000000000002 25.55 25.4625 80-81 22.6875 25.4375 26.637499999999996 25.2375 82-83 23.1125 26.75 25.337500000000002 24.8 84-85 23.0375 26.2875 24.975 25.7 86-87 22.125 26.075 27.025 24.775 88-89 22.9875 25.5625 25.8125 25.637500000000003 90-91 23.0125 25.8 26.2625 24.925 92-93 22.975 26.35 25.087500000000002 25.587500000000002 94-95 22.875 25.95 26.5375 24.637500000000003 96-97 23.3 26.6 24.9 25.2 98-99 23.8625 27.35 24.85 23.9375 100-101 23.775 26.387500000000003 25.6 24.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 2.5 29 2.0 30 2.5 31 4.0 32 6.5 33 12.0 34 22.0 35 38.0 36 48.5 37 55.0 38 82.5 39 108.5 40 130.5 41 169.5 42 192.0 43 212.0 44 224.5 45 230.5 46 240.5 47 235.0 48 216.5 49 198.0 50 200.0 51 180.5 52 158.5 53 137.5 54 113.0 55 111.0 56 105.0 57 87.5 58 76.0 59 74.0 60 65.0 61 55.0 62 49.5 63 44.5 64 38.5 65 27.5 66 15.5 67 10.5 68 7.0 69 3.5 70 1.5 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610858 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610858_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.255 33.0 31.0 33.0 18.0 34.0 2 30.6215 33.0 31.0 33.0 18.0 34.0 3 30.21825 33.0 29.0 33.0 18.0 34.0 4 29.855 33.0 30.0 33.0 15.0 34.0 5 30.1305 33.0 31.0 33.0 15.0 34.0 6 33.414 38.0 33.0 38.0 16.0 38.0 7 33.88575 38.0 34.0 38.0 16.0 38.0 8 33.8215 38.0 33.0 38.0 16.0 38.0 9 33.64425 38.0 33.0 38.0 16.0 38.0 10-11 33.74325 38.0 33.0 38.0 16.0 38.0 12-13 33.590125 38.0 33.0 38.0 16.0 38.0 14-15 33.567625 38.0 33.5 38.0 16.0 38.0 16-17 33.68875 38.0 33.0 38.0 16.0 38.0 18-19 33.64 38.0 33.5 38.0 16.0 38.0 20-21 33.461 38.0 33.0 38.0 16.0 38.0 22-23 33.746125 38.0 33.5 38.0 16.0 38.0 24-25 33.8785 38.0 34.0 38.0 16.0 38.0 26-27 33.7085 38.0 33.5 38.0 16.0 38.0 28-29 33.788250000000005 38.0 33.5 38.0 16.0 38.0 30-31 34.042375 38.0 34.0 38.0 16.0 38.0 32-33 34.016 38.0 34.0 38.0 16.0 38.0 34-35 33.555125000000004 38.0 33.0 38.0 16.0 38.0 36-37 33.70025 38.0 33.0 38.0 16.0 38.0 38-39 33.66475 38.0 33.5 38.0 16.0 38.0 40-41 33.9525 38.0 34.0 38.0 16.0 38.0 42-43 34.1345 38.0 34.0 38.0 16.0 38.0 44-45 33.961 38.0 34.0 38.0 16.0 38.0 46-47 33.897375 38.0 34.0 38.0 16.0 38.0 48-49 33.814499999999995 38.0 34.0 38.0 16.0 38.0 50-51 33.758625 38.0 33.5 38.0 16.0 38.0 52-53 33.704625 38.0 33.5 38.0 16.0 38.0 54-55 33.762125 38.0 33.5 38.0 16.0 38.0 56-57 33.853125000000006 38.0 34.0 38.0 16.0 38.0 58-59 33.859625 38.0 34.0 38.0 16.0 38.0 60-61 33.794 38.0 34.0 38.0 16.0 38.0 62-63 33.80525 38.0 34.0 38.0 16.0 38.0 64-65 33.738375 38.0 34.0 38.0 16.0 38.0 66-67 33.72525 38.0 33.5 38.0 16.0 38.0 68-69 33.827625 38.0 34.0 38.0 16.0 38.0 70-71 33.613125 38.0 33.5 38.0 16.0 38.0 72-73 33.791375 38.0 34.0 38.0 16.0 38.0 74-75 33.575 38.0 33.0 38.0 16.0 38.0 76-77 33.74525 38.0 34.0 38.0 16.0 38.0 78-79 33.796875 38.0 34.0 38.0 16.0 38.0 80-81 33.750249999999994 38.0 34.0 38.0 16.0 38.0 82-83 33.70025 38.0 34.0 38.0 16.0 38.0 84-85 33.7355 38.0 34.0 38.0 16.0 38.0 86-87 33.594 38.0 33.5 38.0 16.0 38.0 88-89 33.55975 38.0 33.5 38.0 15.5 38.0 90-91 33.619625 38.0 33.5 38.0 16.0 38.0 92-93 33.522375 38.0 33.5 38.0 15.0 38.0 94-95 33.286375 38.0 33.0 38.0 15.0 38.0 96-97 25.49925 21.5 19.0 36.0 14.5 38.0 98-99 21.389375 20.5 18.5 24.5 14.0 29.0 100-101 28.1265 29.5 23.0 35.5 15.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 5.0 17 7.0 18 22.0 19 38.0 20 61.0 21 66.0 22 54.0 23 80.0 24 82.0 25 81.0 26 85.0 27 78.0 28 109.0 29 135.0 30 138.0 31 148.0 32 175.0 33 237.0 34 324.0 35 403.0 36 1171.0 37 500.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.03250812703176 15.178794698674668 15.203800950237559 39.58489622405602 2 28.599999999999998 20.125 34.25 17.025000000000002 3 24.10602650662666 22.630657664416105 28.257064266066518 25.006251562890725 4 26.1 29.575000000000003 21.025 23.3 5 27.056764191047762 31.98299574893723 20.530132533133283 20.43010752688172 6 21.675 35.075 22.7 20.549999999999997 7 20.1 17.05 38.275 24.575 8 24.95 21.325 27.075 26.650000000000002 9 23.5 21.25 29.45 25.8 10-11 26.3 28.275 21.025 24.4 12-13 26.1625 22.7625 25.637500000000003 25.4375 14-15 24.099999999999998 25.687500000000004 25.7375 24.474999999999998 16-17 25.9875 25.55 24.337500000000002 24.125 18-19 26.1 25.2875 24.8625 23.75 20-21 24.712500000000002 25.112499999999997 25.85 24.325 22-23 25.7 24.95 25.7625 23.5875 24-25 24.1125 26.05 25.912499999999998 23.925 26-27 25.2875 25.7625 25.674999999999997 23.275000000000002 28-29 25.087500000000002 24.6625 25.0375 25.2125 30-31 24.6875 26.0375 25.3125 23.962500000000002 32-33 25.662499999999998 25.337500000000002 26.187500000000004 22.8125 34-35 25.825 26.025 25.0375 23.1125 36-37 24.9125 25.85 25.1875 24.05 38-39 25.087500000000002 25.4375 25.7875 23.6875 40-41 25.2 25.1875 26.05 23.5625 42-43 24.587500000000002 26.325 25.05 24.0375 44-45 24.1875 25.9875 26.05 23.775 46-47 24.9375 26.2875 25.2625 23.5125 48-49 24.9 25.2625 26.474999999999998 23.3625 50-51 25.5375 26.4125 25.4625 22.5875 52-53 26.437500000000004 24.525 25.7625 23.275000000000002 54-55 24.2 26.8125 24.8125 24.175 56-57 24.55 26.025 25.900000000000002 23.525 58-59 24.837500000000002 25.8 25.825 23.5375 60-61 25.137500000000003 25.724999999999998 26.0375 23.1 62-63 25.937500000000004 26.387500000000003 25.8 21.875 64-65 25.25 25.874999999999996 25.912499999999998 22.9625 66-67 25.587500000000002 26.3 26.0625 22.05 68-69 24.65 26.2125 26.687499999999996 22.45 70-71 25.387500000000003 25.224999999999998 26.400000000000002 22.9875 72-73 25.3 26.0625 25.674999999999997 22.9625 74-75 24.7875 26.474999999999998 26.1125 22.625 76-77 24.4875 26.400000000000002 25.162499999999998 23.95 78-79 24.825 26.0125 26.5875 22.575 80-81 25.3125 25.15 26.450000000000003 23.0875 82-83 26.700000000000003 25.35 25.1875 22.7625 84-85 25.6125 26.337500000000002 25.424999999999997 22.625 86-87 24.712500000000002 25.974999999999998 26.150000000000002 23.1625 88-89 25.387500000000003 26.525 25.5 22.5875 90-91 24.725 25.5125 25.874999999999996 23.8875 92-93 25.124999999999996 26.2875 26.05 22.537499999999998 94-95 24.712500000000002 26.450000000000003 26.1 22.7375 96-97 26.424999999999997 25.874999999999996 24.925 22.775000000000002 98-99 23.6875 29.075 24.45 22.787499999999998 100-101 24.1125 26.887499999999996 25.7625 23.2375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.5 29 1.5 30 2.5 31 3.5 32 4.0 33 7.0 34 12.5 35 18.0 36 28.0 37 42.0 38 74.0 39 99.5 40 121.0 41 160.0 42 186.0 43 202.0 44 212.0 45 212.5 46 230.0 47 221.5 48 194.0 49 196.0 50 206.0 51 194.5 52 164.5 53 147.5 54 127.0 55 111.0 56 112.5 57 105.5 58 93.5 59 88.5 60 86.0 61 76.5 62 62.5 63 52.0 64 36.0 65 26.0 66 20.5 67 17.0 68 16.0 69 8.5 70 4.5 71 5.5 72 3.0 73 1.5 74 1.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.025 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.7828282828282829 1.55 3 0.07575757575757576 0.22499999999999998 4 0.025252525252525252 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.32499999999999996 0.0 0.0 0.0 0.0 82-83 0.4 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.6625000000000001 0.0 0.0 0.0 0.0 88-89 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288459 spots for ERR10610858.sra Written 1288459 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra Read 1288453 spots for ERR10610858.sra Written 1288453 spots for ERR10610858.sra SRR ids: ['ERR10610858.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6lavsan4 ERR10610858.sra spots: 25769066 blocks: [[1, 1288453], [1288454, 2576906], [2576907, 3865359], [3865360, 5153812], [5153813, 6442265], [6442266, 7730718], [7730719, 9019171], [9019172, 10307624], [10307625, 11596077], [11596078, 12884530], [12884531, 14172983], [14172984, 15461436], [15461437, 16749889], [16749890, 18038342], [18038343, 19326795], [19326796, 20615248], [20615249, 21903701], [21903702, 23192154], [23192155, 24480607], [24480608, 25769066]] ERR10610858 file size 6219245 ERR10610858 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610858 ERR10610858_1.fastq ERR10610858_2.fastq Input file: ERR10610858_1.fastq Paired file: ERR10610858_2.fastq trimmed: ERR10610858-trimmed-pair1.fastq, ERR10610858-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:30:22 2024 >> started Fri Dec 6 21:30:47 2024 >> done (25.125s) 25769066 read pairs processed; of these: 104 ( 0.00%) short read pairs filtered out after trimming by size control 2282 ( 0.01%) empty read pairs filtered out after trimming by size control 25766680 (99.99%) read pairs available; of these: 1051860 ( 4.08%) trimmed read pairs available after processing 24714820 (95.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 0 0.00% 20 2 0.00% 21 4 0.00% 22 1 0.00% 23 5 0.00% 24 2 0.00% 25 7 0.00% 26 5 0.00% 27 8 0.00% 28 6 0.00% 29 17 0.00% 30 17 0.00% 31 17 0.00% 32 22 0.00% 33 17 0.00% 34 36 0.00% 35 44 0.00% 36 48 0.00% 37 67 0.00% 38 66 0.00% 39 81 0.00% 40 93 0.00% 41 115 0.00% 42 114 0.00% 43 141 0.00% 44 170 0.00% 45 185 0.00% 46 165 0.00% 47 213 0.00% 48 274 0.00% 49 297 0.00% 50 375 0.00% 51 430 0.00% 52 506 0.00% 53 555 0.00% 54 544 0.00% 55 590 0.00% 56 698 0.00% 57 793 0.00% 58 918 0.00% 59 990 0.00% 60 1205 0.00% 61 1439 0.01% 62 1559 0.01% 63 1848 0.01% 64 1989 0.01% 65 2333 0.01% 66 2524 0.01% 67 2894 0.01% 68 3181 0.01% 69 3652 0.01% 70 4128 0.02% 71 4700 0.02% 72 5435 0.02% 73 6355 0.02% 74 6741 0.03% 75 7738 0.03% 76 9007 0.03% 77 9947 0.04% 78 11063 0.04% 79 12461 0.05% 80 13871 0.05% 81 15469 0.06% 82 17429 0.07% 83 19302 0.07% 84 21920 0.09% 85 24618 0.10% 86 27230 0.11% 87 29810 0.12% 88 33784 0.13% 89 37022 0.14% 90 40155 0.16% 91 44622 0.17% 92 48428 0.19% 93 52158 0.20% 94 56886 0.22% 95 62151 0.24% 96 67223 0.26% 97 74722 0.29% 98 79576 0.31% 99 85097 0.33% 100 91547 0.36% 101 24714820 95.92% 25766680 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=26 prefix-density=0.33 prefix-fanout=2.1 sequence=TTCAAATGTACA criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=11.95 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=2.8 sequence=GCCGGGAACGATTCCCTGCTCGACAAGGATGTCAACAATCTTCTTGCCATCAACAGTCGATTGGTAGAGGGTCTCCTCGAAGAGGATAGCACCAGAGATGTAATTTCCCAGGCCTGGTGGAGTGACAAGGAGGGTACGGTAAGCCTGGCGGTTAGCCTCAGTGTTCTCAAGGCCAATCGAGTCAAGTCTCTTTCCACAGGTAGCATTGGACTCATCCATGGCTAGGATGCCCCTTCCTGGTGATGCGATGGTTTTCGCGGTCTTGACAAGTTCATCAGCGTATGCGCTGGCACGGACAACCATGGAGACGGTCATCTGCTTGGGAGCGGCAGCCTGGCGGGTGGCGCCCCATTCGGACTTCTTGGGAAGGAAAGACGATTTGAGGATAGTAGCCGAGGCCATTGTTTCTGGCTCCAAAGGCAAGAGGATCAGGTGCTACCCTCTTCTTTGACACAAGCTTGCAATTGCA criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.66 fanout-score-rank=16 prefix-density=0.32 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=67.19 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.4 sequence=ACTGCTGCTGCGCGCCAAGGCAAACTCCTTGGCGCAGCTGGGGAAGTACACCAGCGACGGCGAGGCCGCCGCTGCCAAGGAAGGCATGTTCGTCAAGAACTACAGCTACTGATCCTAATCGCATCAAGCTTCAACGCCTGTGAGTGAAAGCCAGTGATGAGAGTGCTGCTGCTAGCTAGCGCCGGCATTGATGAGCTTGAGAGGGCACTGTAGCCAGTGTGTCAGTCGTTGTTAAATTACAGGTTGAGATCATCAGCGTACTCCGATGGGAGATGGACATCAGAAAGTATACTGTGTTTTACCACCCTAATTAAGTAAACAACTTTTGG ERR10610858 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:31:43 Started mapping on | Dec 06 21:31:43 Finished on | Dec 06 21:35:49 Mapping speed, Million of reads per hour | 377.07 Number of input reads | 25766680 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 23190847 Uniquely mapped reads % | 90.00% Average mapped length | 199.70 Number of splices: Total | 15555787 Number of splices: Annotated (sjdb) | 14591862 Number of splices: GT/AG | 15322729 Number of splices: GC/AG | 187073 Number of splices: AT/AC | 5748 Number of splices: Non-canonical | 40237 Mismatch rate per base, % | 0.89% Deletion rate per base | 0.02% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 537504 % of reads mapped to multiple loci | 2.09% Number of reads mapped to too many loci | 36979 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.67% % of reads unmapped: other | 1.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2038329 2038329 2038329 N_multimapping 537504 537504 537504 N_noFeature 795418 22563913 934704 N_ambiguous 572552 2411 87323 UnstrandedReadsAssigned:21822877 PositiveStrandReadsAssigned:624523 NegativeStrandReadsAssigned:22168820 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610858 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610858-trimmed-pair1.fastq ERR10610858-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,766,680 reads, 22,774,382 reads pseudoaligned [quant] estimated average fragment length: 167.633 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52973 ERR10610858.ke.tsv 35125 ERR10610858.se.tsv 88098 total ==> ERR10610858.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 769.533 0 0 PNS24247 1044 877.367 67.0369 5.16968 PNS24249 1928 1761.37 24.8758 0.955561 PNS24246 1044 877.367 67.0369 5.16968 PNS24248 1044 877.367 67.0369 5.16968 PNS24244 1471 1304.37 123.014 6.38094 PNS24243 293 133.687 0 0 KQK14069 1603 1436.37 2033.29 95.7777 KQK14071 474 308.857 52.3555 11.4693 ==> ERR10610858.se.tsv <== BRADI_1g14170v3 2330 BRADI_1g53295v3 1052 BRADI_1g59795v3 774 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 509 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 462 BRADI_1g48960v3 0 ERR10610858 completed mapping pipeline successfully