Starting /dee2/code/volunteer_pipeline.sh ERR10610859 current disk space = 1548949966848 free memory = 1431440664 ERR10610859 SRAfilesize 182b3b0963015ca1228359b6a392ba45 ERR10610859.sra ERR10610859.sra file validated ERR10610859 is paired end ERR10610859 is conventional basespace ERR10610859 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610859_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.85675 32.0 28.0 33.0 18.0 33.0 2 30.5895 33.0 31.0 33.0 25.0 33.0 3 30.86625 33.0 31.0 33.0 25.0 34.0 4 30.9785 33.0 32.0 33.0 25.0 34.0 5 31.046 33.0 32.0 33.0 25.0 34.0 6 33.40675 37.0 33.0 38.0 16.0 38.0 7 33.80875 38.0 33.0 38.0 16.0 38.0 8 33.13825 38.0 31.0 38.0 16.0 38.0 9 33.5695 38.0 33.0 38.0 16.0 38.0 10-11 33.776624999999996 38.0 33.5 38.0 16.0 38.0 12-13 33.9 38.0 34.0 38.0 16.0 38.0 14-15 33.971625 38.0 34.0 38.0 16.0 38.0 16-17 33.98287500000001 38.0 34.0 38.0 16.0 38.0 18-19 34.091875 38.0 34.0 38.0 20.0 38.0 20-21 34.062124999999995 38.0 33.5 38.0 20.5 38.0 22-23 34.132125 38.0 34.0 38.0 16.0 38.0 24-25 33.641875 38.0 32.5 38.0 16.0 38.0 26-27 33.967125 38.0 34.0 38.0 16.0 38.0 28-29 34.191 38.0 34.0 38.0 20.5 38.0 30-31 34.190124999999995 38.0 34.0 38.0 20.5 38.0 32-33 34.2315 38.0 34.0 38.0 24.0 38.0 34-35 34.31975 38.0 34.0 38.0 24.5 38.0 36-37 34.0655 38.0 34.0 38.0 16.0 38.0 38-39 34.302 38.0 34.0 38.0 24.5 38.0 40-41 34.257374999999996 38.0 34.0 38.0 20.5 38.0 42-43 34.3245 38.0 34.0 38.0 20.5 38.0 44-45 34.576375 38.0 35.0 38.0 25.0 38.0 46-47 34.3555 38.0 34.5 38.0 20.5 38.0 48-49 34.275125 38.0 34.0 38.0 24.5 38.0 50-51 34.070125 38.0 34.0 38.0 16.0 38.0 52-53 34.0995 38.0 34.0 38.0 20.5 38.0 54-55 34.240125 38.0 34.0 38.0 24.5 38.0 56-57 34.178250000000006 38.0 34.0 38.0 24.0 38.0 58-59 34.093500000000006 38.0 34.0 38.0 20.0 38.0 60-61 34.015375 38.0 34.0 38.0 20.5 38.0 62-63 34.133250000000004 38.0 34.0 38.0 20.5 38.0 64-65 34.21787500000001 38.0 34.0 38.0 20.0 38.0 66-67 34.377250000000004 38.0 34.5 38.0 25.0 38.0 68-69 34.26775 38.0 34.0 38.0 20.5 38.0 70-71 34.216375 38.0 34.0 38.0 24.0 38.0 72-73 34.004875 38.0 34.0 38.0 16.0 38.0 74-75 34.214875 38.0 34.0 38.0 24.0 38.0 76-77 33.994749999999996 38.0 34.0 38.0 16.0 38.0 78-79 34.189875 38.0 34.0 38.0 20.5 38.0 80-81 34.085499999999996 38.0 34.0 38.0 19.5 38.0 82-83 33.910250000000005 38.0 34.0 38.0 18.5 38.0 84-85 34.2615 38.0 34.0 38.0 24.0 38.0 86-87 34.076 38.0 34.0 38.0 18.0 38.0 88-89 33.734375 38.0 34.0 38.0 15.0 38.0 90-91 33.947874999999996 38.0 34.0 38.0 15.0 38.0 92-93 33.857749999999996 38.0 34.0 38.0 18.0 38.0 94-95 33.765 38.0 34.0 38.0 15.0 38.0 96-97 33.8405 38.0 34.0 38.0 15.0 38.0 98-99 33.31975 38.0 33.0 38.0 15.0 38.0 100-101 32.689499999999995 37.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 4.0 19 26.0 20 34.0 21 45.0 22 55.0 23 43.0 24 72.0 25 59.0 26 83.0 27 104.0 28 90.0 29 131.0 30 136.0 31 159.0 32 179.0 33 216.0 34 286.0 35 355.0 36 584.0 37 1336.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.6468797564688 11.364789446981227 10.95890410958904 52.02942668696093 2 19.775000000000002 18.4 39.65 22.175 3 19.950000000000003 20.974999999999998 25.6 33.475 4 22.85 29.65 21.5 26.0 5 23.9 33.6 24.875 17.625 6 16.675 36.449999999999996 27.425 19.45 7 14.353588397099276 21.655413853463365 43.785946486621654 20.205051262815704 8 19.11433575181386 23.042281711283465 31.77383037277958 26.069552164123095 9 16.833416708354175 22.486243121560783 37.09354677338669 23.58679339669835 10-11 21.273136568284144 31.715857928964482 23.84942471235618 23.1615807903952 12-13 20.725453408380236 25.303314571607256 27.892432770481552 26.07879924953096 14-15 20.408674940453807 26.639087376206593 29.183903723204214 23.76833396013539 16-17 20.82394189832206 27.27272727272727 27.585775106436262 24.3175557225144 18-19 20.24509190946605 27.83543828935851 26.73502563461298 25.184444166562457 20-21 20.527565945743216 28.01600200025003 26.665833229153645 24.79059882485311 22-23 20.890111263907986 27.953494186773348 27.54094261782723 23.615451931491435 24-25 19.79244811202801 26.59414853713428 29.132283070767688 24.48112028007002 26-27 21.06776694173543 27.306826706676667 27.319329832458116 24.306076519129782 28-29 20.6875 27.474999999999998 27.650000000000002 24.1875 30-31 20.4625 27.6125 27.400000000000002 24.525 32-33 20.8125 27.825 27.150000000000002 24.212500000000002 34-35 21.8625 27.0625 27.5125 23.5625 36-37 20.474999999999998 26.775 27.237499999999997 25.5125 38-39 20.627578447305915 27.61595199399925 27.065883235404424 24.69058632329041 40-41 20.45 28.262500000000003 26.525 24.762500000000003 42-43 20.9 26.924999999999997 27.55 24.625 44-45 21.275 26.987499999999997 26.724999999999998 25.0125 46-47 21.325 27.987499999999997 26.8125 23.875 48-49 20.9125 27.775 27.175 24.1375 50-51 20.724999999999998 27.8375 27.525 23.9125 52-53 21.75 27.750000000000004 26.55 23.95 54-55 20.7875 28.0875 26.637499999999996 24.4875 56-57 20.5625 28.349999999999998 27.35 23.7375 58-59 21.4 27.8125 26.8375 23.95 60-61 21.325 27.6375 26.437500000000004 24.6 62-63 20.8 26.825 27.500000000000004 24.875 64-65 20.7 27.4125 27.125 24.762500000000003 66-67 21.1875 27.875 26.0125 24.925 68-69 21.7 27.3625 26.487500000000004 24.45 70-71 21.3125 28.749999999999996 26.187500000000004 23.75 72-73 20.8125 27.712500000000002 26.525 24.95 74-75 21.349999999999998 27.450000000000003 27.1625 24.0375 76-77 21.075 27.8375 26.6 24.4875 78-79 21.7 27.3125 26.224999999999998 24.762500000000003 80-81 21.2875 28.1375 26.5125 24.0625 82-83 21.462500000000002 27.787499999999998 27.05 23.7 84-85 21.7 26.924999999999997 26.75 24.625 86-87 20.775 27.9125 26.825 24.4875 88-89 20.525 27.762500000000003 27.35 24.3625 90-91 21.349999999999998 27.3 26.5125 24.837500000000002 92-93 22.290286285785722 26.2782847855982 27.090886360795096 24.34054256782098 94-95 22.0 28.0625 25.9875 23.95 96-97 21.625 27.6125 25.7375 25.025 98-99 21.587500000000002 27.962500000000002 26.6625 23.7875 100-101 21.8875 28.487499999999997 25.275 24.349999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 2.5 26 2.5 27 3.0 28 4.5 29 5.5 30 9.0 31 12.0 32 12.5 33 23.0 34 37.5 35 50.0 36 67.5 37 94.0 38 130.5 39 154.5 40 191.0 41 224.0 42 223.0 43 221.5 44 236.5 45 260.0 46 257.0 47 230.0 48 205.5 49 197.5 50 187.5 51 162.5 52 137.0 53 123.5 54 104.5 55 80.0 56 70.0 57 55.5 58 52.0 59 44.5 60 32.0 61 26.5 62 18.5 63 15.5 64 12.5 65 9.0 66 4.0 67 3.0 68 3.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.025 8 0.075 9 0.05 10-11 0.05 12-13 0.0625 14-15 0.2875 16-17 0.17500000000000002 18-19 0.0375 20-21 0.0125 22-23 0.0125 24-25 0.025 26-27 0.025 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0125 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29488793754722 98.575 2 0.6799294887937547 1.35 3 0.02518257365902795 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.325 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4375 0.0 0.0 0.0 0.0 82-83 0.5375000000000001 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.9249999999999999 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610859 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610859_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.66825 32.0 27.0 33.0 18.0 33.0 2 30.021 32.0 30.0 33.0 18.0 34.0 3 26.81425 31.0 18.0 33.0 18.0 33.0 4 28.78025 32.0 27.0 33.0 15.0 33.0 5 29.61775 32.0 28.0 33.0 15.0 34.0 6 27.14625 29.0 16.0 37.0 15.0 38.0 7 31.05725 34.0 28.0 38.0 16.0 38.0 8 32.451 36.0 29.0 38.0 16.0 38.0 9 32.9875 37.0 31.0 38.0 16.0 38.0 10-11 33.56225 37.5 33.0 38.0 16.0 38.0 12-13 33.768875 38.0 33.0 38.0 16.0 38.0 14-15 33.906 38.0 33.5 38.0 16.0 38.0 16-17 33.88825 38.0 33.5 38.0 16.0 38.0 18-19 33.71225 38.0 33.0 38.0 16.0 38.0 20-21 33.771125 38.0 33.5 38.0 16.0 38.0 22-23 33.811 38.0 33.5 38.0 16.0 38.0 24-25 33.302875 38.0 33.0 38.0 16.0 38.0 26-27 33.387249999999995 38.0 32.0 38.0 16.0 38.0 28-29 31.8455 36.5 24.5 38.0 16.0 38.0 30-31 33.31425 37.5 31.0 38.0 20.0 38.0 32-33 33.756375000000006 38.0 33.5 38.0 16.0 38.0 34-35 33.66675 38.0 33.0 38.0 16.0 38.0 36-37 33.37875 38.0 32.5 38.0 16.0 38.0 38-39 33.598749999999995 38.0 33.0 38.0 16.0 38.0 40-41 33.921 38.0 34.0 38.0 16.0 38.0 42-43 33.617625000000004 38.0 33.5 38.0 16.0 38.0 44-45 33.970375000000004 38.0 34.0 38.0 16.0 38.0 46-47 33.869625 38.0 34.0 38.0 16.0 38.0 48-49 33.984 38.0 34.0 38.0 20.0 38.0 50-51 34.157624999999996 38.0 34.0 38.0 16.0 38.0 52-53 34.291375 38.0 34.5 38.0 24.0 38.0 54-55 34.074749999999995 38.0 34.0 38.0 16.0 38.0 56-57 33.856625 38.0 33.5 38.0 16.0 38.0 58-59 33.952125 38.0 34.0 38.0 16.0 38.0 60-61 33.987875 38.0 34.0 38.0 16.0 38.0 62-63 34.023250000000004 38.0 34.0 38.0 20.0 38.0 64-65 33.914625 38.0 34.0 38.0 16.0 38.0 66-67 33.73725 38.0 33.5 38.0 16.0 38.0 68-69 33.951750000000004 38.0 34.0 38.0 16.0 38.0 70-71 33.876625000000004 38.0 34.0 38.0 16.0 38.0 72-73 33.899375 38.0 34.0 38.0 16.0 38.0 74-75 33.640125 38.0 33.0 38.0 16.0 38.0 76-77 33.76175 38.0 34.0 38.0 16.0 38.0 78-79 33.58125 38.0 33.5 38.0 16.0 38.0 80-81 33.307874999999996 38.0 33.0 38.0 16.0 38.0 82-83 33.227875 38.0 32.0 38.0 16.0 38.0 84-85 33.587375 38.0 33.5 38.0 15.5 38.0 86-87 33.40837500000001 38.0 33.0 38.0 16.0 38.0 88-89 33.4315 38.0 33.0 38.0 15.0 38.0 90-91 33.428375 38.0 33.0 38.0 15.0 38.0 92-93 33.327 38.0 33.0 38.0 15.0 38.0 94-95 33.421625 38.0 33.5 38.0 15.0 38.0 96-97 33.38275 38.0 33.5 38.0 15.0 38.0 98-99 33.298249999999996 38.0 33.0 38.0 15.0 38.0 100-101 31.399875 36.0 28.0 37.5 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 4.0 17 10.0 18 26.0 19 31.0 20 40.0 21 49.0 22 58.0 23 69.0 24 75.0 25 78.0 26 89.0 27 105.0 28 115.0 29 129.0 30 129.0 31 174.0 32 196.0 33 244.0 34 285.0 35 372.0 36 720.0 37 1002.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.15 14.875 15.2 44.775 2 27.474999999999998 21.625 35.65 15.25 3 19.375 24.0 33.975 22.650000000000002 4 25.25 31.275 22.05 21.425 5 28.299999999999997 33.275 21.575 16.85 6 19.075 34.8 25.650000000000002 20.474999999999998 7 19.7 17.4 41.075 21.825 8 22.525000000000002 21.575 29.875 26.025 9 22.95 21.475 31.275 24.3 10-11 25.4 28.787499999999998 23.0 22.8125 12-13 25.162499999999998 23.6125 26.724999999999998 24.5 14-15 24.775 25.4375 26.974999999999998 22.8125 16-17 24.587500000000002 25.85 26.7625 22.8 18-19 25.2 26.437500000000004 25.525 22.8375 20-21 25.724999999999998 26.2875 26.7125 21.275 22-23 25.074999999999996 26.187500000000004 26.687499999999996 22.05 24-25 23.9375 25.8625 27.6 22.6 26-27 24.3875 26.200000000000003 27.0125 22.400000000000002 28-29 24.5625 26.4625 28.199999999999996 20.775 30-31 23.8875 27.025 26.7625 22.325 32-33 24.637500000000003 27.437499999999996 27.025 20.9 34-35 24.775 26.474999999999998 26.787499999999998 21.9625 36-37 24.467017807875596 26.899924755455228 27.113117632304988 21.51993980436418 38-39 25.703916906519837 26.254536353397572 25.86659992491553 22.17494681516706 40-41 24.81541734451258 27.118007758728567 26.967838818671 21.09873607808785 42-43 24.4145051624276 26.769075799546716 27.73860488541929 21.077814152606397 44-45 23.81131131131131 27.32732732732733 26.651651651651655 22.20970970970971 46-47 24.92473657802308 26.8314099347717 26.881585549422983 21.362267937782235 48-49 24.474737368684345 26.575787893946973 27.41370685342671 21.53576788394197 50-51 24.425 27.425 27.3 20.849999999999998 52-53 25.0625 26.5125 27.4125 21.0125 54-55 24.4875 26.450000000000003 26.85 22.2125 56-57 24.349999999999998 26.525 27.9125 21.212500000000002 58-59 25.112499999999997 26.2625 27.175 21.45 60-61 23.8375 27.4125 27.0 21.75 62-63 24.3625 26.825 27.425 21.3875 64-65 24.5 26.237500000000004 27.175 22.0875 66-67 24.15 27.212500000000002 27.3375 21.3 68-69 25.275 26.900000000000002 26.950000000000003 20.875 70-71 24.575 26.8125 27.1125 21.5 72-73 23.7625 27.1625 27.375 21.7 74-75 24.975 26.575 27.675 20.775 76-77 25.0375 27.1125 26.424999999999997 21.425 78-79 24.275 26.674999999999997 27.6625 21.3875 80-81 24.8625 26.974999999999998 27.237499999999997 20.925 82-83 24.625 26.4625 27.474999999999998 21.4375 84-85 24.675 26.625 27.1 21.6 86-87 25.674999999999997 26.75 27.800000000000004 19.775000000000002 88-89 24.637500000000003 26.737499999999997 27.212500000000002 21.4125 90-91 24.75 27.224999999999998 26.687499999999996 21.337500000000002 92-93 24.3125 28.000000000000004 27.400000000000002 20.2875 94-95 25.2375 26.8375 27.05 20.875 96-97 25.4875 26.437500000000004 27.525 20.549999999999997 98-99 26.0625 26.937499999999996 25.937500000000004 21.0625 100-101 26.087500000000002 26.974999999999998 27.375 19.5625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 2.0 26 1.0 27 0.0 28 2.5 29 3.5 30 4.5 31 7.5 32 14.5 33 21.0 34 26.0 35 44.5 36 66.5 37 91.5 38 111.5 39 124.5 40 159.5 41 189.5 42 201.5 43 227.0 44 236.0 45 241.5 46 242.5 47 227.0 48 213.0 49 201.0 50 194.0 51 179.5 52 158.0 53 141.0 54 127.0 55 105.0 56 88.0 57 70.5 58 52.0 59 53.5 60 53.5 61 36.5 62 26.0 63 17.5 64 11.5 65 9.5 66 4.0 67 2.5 68 3.0 69 2.0 70 2.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.325 38-39 0.11249999999999999 40-41 0.11249999999999999 42-43 0.7250000000000001 44-45 0.1 46-47 0.35000000000000003 48-49 0.05 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0125 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0875 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1125 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.2 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.2375 0.0 0.0 0.0 0.0 74-75 0.2875 0.0 0.0 0.0 0.0 76-77 0.375 0.0 0.0 0.0 0.0 78-79 0.42500000000000004 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6375 0.0 0.0 0.0 0.0 84-85 0.8 0.0 0.0 0.0 0.0 86-87 1.025 0.0 0.0 0.0 0.0 88-89 1.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213655 spots for ERR10610859.sra Written 213655 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra Read 213637 spots for ERR10610859.sra Written 213637 spots for ERR10610859.sra SRR ids: ['ERR10610859.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lgpp0lrx ERR10610859.sra spots: 4272758 blocks: [[1, 213637], [213638, 427274], [427275, 640911], [640912, 854548], [854549, 1068185], [1068186, 1281822], [1281823, 1495459], [1495460, 1709096], [1709097, 1922733], [1922734, 2136370], [2136371, 2350007], [2350008, 2563644], [2563645, 2777281], [2777282, 2990918], [2990919, 3204555], [3204556, 3418192], [3418193, 3631829], [3631830, 3845466], [3845467, 4059103], [4059104, 4272758]] ERR10610859 file size 1024294 ERR10610859 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610859 ERR10610859_1.fastq ERR10610859_2.fastq Input file: ERR10610859_1.fastq Paired file: ERR10610859_2.fastq trimmed: ERR10610859-trimmed-pair1.fastq, ERR10610859-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:26:49 2024 >> started Fri Dec 6 21:26:53 2024 >> done (4.322s) 4272758 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 202 ( 0.00%) empty read pairs filtered out after trimming by size control 4272484 (99.99%) read pairs available; of these: 197082 ( 4.61%) trimmed read pairs available after processing 4075402 (95.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 3 0.00% 29 8 0.00% 30 4 0.00% 31 4 0.00% 32 6 0.00% 33 11 0.00% 34 8 0.00% 35 16 0.00% 36 12 0.00% 37 19 0.00% 38 19 0.00% 39 35 0.00% 40 27 0.00% 41 29 0.00% 42 40 0.00% 43 59 0.00% 44 55 0.00% 45 55 0.00% 46 67 0.00% 47 69 0.00% 48 77 0.00% 49 104 0.00% 50 90 0.00% 51 117 0.00% 52 150 0.00% 53 173 0.00% 54 151 0.00% 55 180 0.00% 56 189 0.00% 57 214 0.01% 58 245 0.01% 59 314 0.01% 60 302 0.01% 61 335 0.01% 62 358 0.01% 63 499 0.01% 64 503 0.01% 65 546 0.01% 66 639 0.01% 67 687 0.02% 68 678 0.02% 69 772 0.02% 70 916 0.02% 71 980 0.02% 72 1163 0.03% 73 1229 0.03% 74 1473 0.03% 75 1642 0.04% 76 1814 0.04% 77 2018 0.05% 78 2301 0.05% 79 2566 0.06% 80 2663 0.06% 81 3094 0.07% 82 3554 0.08% 83 3801 0.09% 84 4213 0.10% 85 4748 0.11% 86 5360 0.13% 87 5579 0.13% 88 6516 0.15% 89 6786 0.16% 90 7375 0.17% 91 8252 0.19% 92 8686 0.20% 93 9587 0.22% 94 10209 0.24% 95 11359 0.27% 96 11914 0.28% 97 13170 0.31% 98 14606 0.34% 99 15424 0.36% 100 16202 0.38% 101 4075402 95.39% 4272484 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=6.52 fanout-score-rank=19 prefix-density=0.22 prefix-fanout=4.7 sequence=ACATGCATGCATATATCGATCGTCCGATGGATGGACCGATATATACTACAGCTAGCTGCTAATTCTCATTTAGCTCCCGGGGGCGAAGTTGGTAGCAAAGGCCCATGCATTGTTGTTGACTGGGTCGGCGACGTGGTCGAAGAGGTTCTCGACGGGTCCCTTGCCCGTGACGATGGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=166.29 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=15.2 sequence=CTTCTTCTCCGGCGCCATGCCGAGAACCACCACCTGGGCCTGGGTGCTGGTGTTGGTGCTGCCCTGCTCTGCCAGGTCTGGGTACATCTTCCCGCAAGTGCAGTTTGAGCCACAGTTGCAGCTTGATCCACAGCTGCAAGACATATTCCAAATCTTTTAACCTCAAGCTGATGAAATCAAGGAGAAGAAGAAG criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=28 prefix-density=0.21 prefix-fanout=2.4 sequence=CCTAAGCAAGTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=52.53 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.1 sequence=AAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCACTCATCCGTGACGGTCGTATGGAGAAGTTCTACTGGGCCCCCACCCGCGAAGACCGTATCGGTGTCTGCAGGGGTATCTTCCAAACTGACAACATCAGCGACGAGTCCGTCATCAAGATCGTAGACACCTTCCCAGGCCAATCCATCGACTTTTTCGGAGCGCTGCGTGCCCGGGTGTACGACGATGAGGTGCGCAAGTGGGTCAGCTCAACCGGAATAGAGAACATCGGCAAGAAGCTGGTGAACTCGAAGGATGGACCGGTGTCCTTTGAGCAGCCAAAGATGACAATCGAGAAGCTCCTGGAGTACGGCCACATGCTCGTCCAAGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACAAGTACATGAGCGAGGCTGCTCTGGGAGATGCTAACTCAGATGCCATGAAGACTGGTTCCTTCTACGGTTAGAACACTCTTC ERR10610859 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:27:43 Started mapping on | Dec 06 21:27:43 Finished on | Dec 06 21:28:22 Mapping speed, Million of reads per hour | 394.38 Number of input reads | 4272484 Average input read length | 193 UNIQUE READS: Uniquely mapped reads number | 3703828 Uniquely mapped reads % | 86.69% Average mapped length | 191.96 Number of splices: Total | 2322885 Number of splices: Annotated (sjdb) | 2174304 Number of splices: GT/AG | 2282340 Number of splices: GC/AG | 28824 Number of splices: AT/AC | 1050 Number of splices: Non-canonical | 10671 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.02% Deletion average length | 2.10 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 77809 % of reads mapped to multiple loci | 1.82% Number of reads mapped to too many loci | 7161 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.66% % of reads unmapped: other | 0.66% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 490847 490847 490847 N_multimapping 77809 77809 77809 N_noFeature 162601 3595643 186847 N_ambiguous 100045 450 16543 UnstrandedReadsAssigned:3441182 PositiveStrandReadsAssigned:107735 NegativeStrandReadsAssigned:3500438 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610859 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610859-trimmed-pair1.fastq ERR10610859-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,272,484 reads, 3,816,021 reads pseudoaligned [quant] estimated average fragment length: 160.202 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,157 rounds 52973 ERR10610859.ke.tsv 35125 ERR10610859.se.tsv 88098 total ==> ERR10610859.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 776.94 0 0 PNS24247 1044 884.798 10.4087 4.87306 PNS24249 1928 1768.8 3.14959 0.737607 PNS24246 1044 884.798 10.4087 4.87306 PNS24248 1044 884.798 10.4087 4.87306 PNS24244 1471 1311.8 37.6243 11.881 PNS24243 293 141.698 0 0 KQK14069 1603 1443.8 266.114 76.3504 KQK14071 474 316.284 9.39106 12.2995 ==> ERR10610859.se.tsv <== BRADI_1g14170v3 328 BRADI_1g53295v3 196 BRADI_1g59795v3 214 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 75 BRADI_1g74790v3 9 BRADI_1g09890v3 0 BRADI_1g77505v3 104 BRADI_1g48960v3 0 ERR10610859 completed mapping pipeline successfully