Starting /dee2/code/volunteer_pipeline.sh ERR10610860 current disk space = 1548939857920 free memory = 1599423692 ERR10610860 SRAfilesize a8b44c954c128980fdd09139a39797a3 ERR10610860.sra ERR10610860.sra file validated ERR10610860 is paired end ERR10610860 is conventional basespace ERR10610860 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610860_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.229 31.0 18.0 33.0 18.0 33.0 2 29.315 31.0 28.0 33.0 18.0 33.0 3 29.94425 33.0 29.0 33.0 18.0 33.0 4 30.229 33.0 31.0 33.0 15.0 33.0 5 30.321 33.0 31.0 33.0 15.0 34.0 6 31.9755 36.0 29.0 38.0 16.0 38.0 7 32.54625 36.0 29.0 38.0 16.0 38.0 8 33.5225 38.0 33.0 38.0 16.0 38.0 9 33.58175 38.0 33.0 38.0 16.0 38.0 10-11 30.879625 35.0 23.0 38.0 16.0 38.0 12-13 33.291250000000005 37.0 32.0 38.0 16.0 38.0 14-15 33.778625 38.0 33.5 38.0 16.0 38.0 16-17 33.926874999999995 38.0 34.0 38.0 16.0 38.0 18-19 33.94475 38.0 34.0 38.0 16.0 38.0 20-21 33.757875 38.0 33.5 38.0 16.0 38.0 22-23 33.753375 38.0 33.5 38.0 16.0 38.0 24-25 33.864875 38.0 34.0 38.0 16.0 38.0 26-27 33.8715 38.0 34.0 38.0 16.0 38.0 28-29 33.457750000000004 38.0 33.5 38.0 16.0 38.0 30-31 33.0245 37.5 30.5 38.0 16.0 38.0 32-33 33.4925 38.0 33.0 38.0 16.0 38.0 34-35 33.60725 38.0 33.0 38.0 16.0 38.0 36-37 33.77275 38.0 34.0 38.0 16.0 38.0 38-39 33.640125 38.0 33.5 38.0 16.0 38.0 40-41 33.65625 38.0 33.0 38.0 16.0 38.0 42-43 33.879999999999995 38.0 34.0 38.0 16.0 38.0 44-45 33.718 38.0 33.5 38.0 16.0 38.0 46-47 33.7545 38.0 33.0 38.0 16.0 38.0 48-49 33.531125 38.0 33.0 38.0 16.0 38.0 50-51 33.766000000000005 38.0 33.5 38.0 16.0 38.0 52-53 33.824 38.0 33.5 38.0 16.0 38.0 54-55 33.743875 38.0 33.5 38.0 16.0 38.0 56-57 33.884 38.0 34.0 38.0 16.0 38.0 58-59 33.8895 38.0 34.0 38.0 16.0 38.0 60-61 33.98075 38.0 34.0 38.0 20.0 38.0 62-63 34.117125 38.0 34.0 38.0 16.0 38.0 64-65 33.956374999999994 38.0 34.0 38.0 16.0 38.0 66-67 34.089375000000004 38.0 34.0 38.0 16.0 38.0 68-69 34.0145 38.0 34.0 38.0 16.0 38.0 70-71 33.973875 38.0 34.0 38.0 16.0 38.0 72-73 34.019875 38.0 34.0 38.0 20.0 38.0 74-75 33.960499999999996 38.0 34.0 38.0 16.0 38.0 76-77 34.0135 38.0 34.0 38.0 16.0 38.0 78-79 33.727375 38.0 34.0 38.0 16.0 38.0 80-81 33.866749999999996 38.0 34.0 38.0 16.0 38.0 82-83 33.812875000000005 38.0 34.0 38.0 16.0 38.0 84-85 33.8125 38.0 34.0 38.0 16.0 38.0 86-87 33.735749999999996 38.0 34.0 38.0 16.0 38.0 88-89 33.630250000000004 38.0 33.5 38.0 16.0 38.0 90-91 33.621625 38.0 33.5 38.0 16.0 38.0 92-93 33.465875 38.0 33.0 38.0 15.0 38.0 94-95 33.570499999999996 38.0 33.5 38.0 15.0 38.0 96-97 33.730625 38.0 34.0 38.0 15.0 38.0 98-99 33.640625 38.0 33.5 38.0 15.0 38.0 100-101 32.66875 37.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 24.0 19 36.0 20 65.0 21 51.0 22 63.0 23 72.0 24 68.0 25 75.0 26 72.0 27 95.0 28 107.0 29 115.0 30 123.0 31 160.0 32 160.0 33 222.0 34 280.0 35 398.0 36 675.0 37 1138.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.817768803634525 8.606764260474508 19.3336698637052 41.24179707218577 2 24.875 13.200000000000001 35.825 26.1 3 22.975 18.3 21.975 36.75 4 26.525 25.724999999999998 22.400000000000002 25.35 5 25.874999999999996 29.2 24.925 20.0 6 20.325 33.7 24.575 21.4 7 15.9 21.425 42.975 19.7 8 21.9 21.575 29.425 27.1 9 19.975 20.125 34.2 25.7 10-11 22.475 28.525 24.6875 24.3125 12-13 22.2625 23.7 27.3875 26.650000000000002 14-15 22.3875 25.25 27.375 24.9875 16-17 23.35 24.474999999999998 26.424999999999997 25.75 18-19 22.825 25.35 26.2875 25.5375 20-21 23.5625 25.55 25.775 25.112499999999997 22-23 23.0125 26.3625 26.3 24.325 24-25 22.662499999999998 25.474999999999998 26.224999999999998 25.637500000000003 26-27 23.0625 25.324999999999996 26.0 25.6125 28-29 23.075000000000003 25.4 25.637500000000003 25.887500000000003 30-31 21.9375 26.125 25.837500000000002 26.1 32-33 22.6 25.124999999999996 25.9625 26.3125 34-35 23.1 25.724999999999998 25.7875 25.387500000000003 36-37 23.0875 25.137500000000003 26.3625 25.412499999999998 38-39 22.8125 25.5125 25.9875 25.687500000000004 40-41 23.2125 25.15 25.412499999999998 26.224999999999998 42-43 22.475 25.3125 26.474999999999998 25.7375 44-45 22.5 25.1875 26.0 26.3125 46-47 23.549999999999997 24.1625 26.1625 26.125 48-49 22.7125 25.087500000000002 26.2875 25.912499999999998 50-51 23.0625 25.25 26.737499999999997 24.95 52-53 22.8375 25.124999999999996 25.900000000000002 26.137500000000003 54-55 22.912499999999998 25.4 25.7875 25.900000000000002 56-57 22.7125 25.525 25.275 26.487500000000004 58-59 23.7875 24.625 25.5625 26.025 60-61 23.875 25.775 25.6125 24.7375 62-63 22.825 25.6125 25.2125 26.35 64-65 23.2625 24.9375 26.1125 25.687500000000004 66-67 22.775000000000002 26.0125 25.2875 25.924999999999997 68-69 23.474999999999998 25.974999999999998 25.5625 24.9875 70-71 22.2125 25.224999999999998 25.0375 27.525 72-73 23.225 24.675 26.55 25.55 74-75 23.1875 25.224999999999998 25.4625 26.125 76-77 23.150000000000002 24.95 26.3125 25.587500000000002 78-79 23.0125 24.825 25.7125 26.450000000000003 80-81 22.900000000000002 25.412499999999998 25.55 26.137500000000003 82-83 23.25 25.087500000000002 25.662499999999998 26.0 84-85 23.45 25.424999999999997 25.674999999999997 25.45 86-87 23.849999999999998 24.837500000000002 25.525 25.7875 88-89 23.549999999999997 25.374999999999996 24.825 26.25 90-91 24.425 25.074999999999996 24.587500000000002 25.912499999999998 92-93 24.0375 24.962500000000002 25.8125 25.1875 94-95 24.1125 25.337500000000002 25.074999999999996 25.474999999999998 96-97 23.125 25.525 25.637500000000003 25.7125 98-99 23.4375 24.6 26.0625 25.900000000000002 100-101 24.474999999999998 24.8125 24.1875 26.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.0 29 1.5 30 1.5 31 2.0 32 2.5 33 6.0 34 15.0 35 24.5 36 29.5 37 35.0 38 59.5 39 74.5 40 88.0 41 134.5 42 171.0 43 190.0 44 216.0 45 240.5 46 234.0 47 230.0 48 245.5 49 224.5 50 197.5 51 182.5 52 156.5 53 153.5 54 143.5 55 115.5 56 108.0 57 104.5 58 96.0 59 82.0 60 66.5 61 56.0 62 53.5 63 50.5 64 48.0 65 45.5 66 36.0 67 26.5 68 20.0 69 13.5 70 6.0 71 3.0 72 1.5 73 1.5 74 2.5 75 1.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77409638554217 99.375 2 0.1757028112449799 0.35000000000000003 3 0.0251004016064257 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0251004016064257 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 8 0.2 TruSeq Adapter, Index 8 (97% over 36bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610860 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610860_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.5785 33.0 27.0 33.0 18.0 34.0 2 29.9815 33.0 28.0 33.0 18.0 34.0 3 30.05825 33.0 30.0 33.0 18.0 34.0 4 29.66975 33.0 30.0 33.0 15.0 34.0 5 29.73025 33.0 30.0 33.0 15.0 34.0 6 33.167 37.0 31.0 38.0 16.0 38.0 7 33.369 38.0 32.0 38.0 16.0 38.0 8 32.99575 38.0 31.0 38.0 16.0 38.0 9 33.14375 38.0 31.0 38.0 16.0 38.0 10-11 33.094875 38.0 31.0 38.0 16.0 38.0 12-13 33.263999999999996 38.0 31.0 38.0 16.0 38.0 14-15 33.158125 38.0 31.0 38.0 16.0 38.0 16-17 32.49075 37.5 29.5 38.0 16.0 38.0 18-19 33.00575 37.5 30.0 38.0 16.0 38.0 20-21 33.107625 38.0 31.0 38.0 16.0 38.0 22-23 32.969 38.0 31.0 38.0 16.0 38.0 24-25 33.048 38.0 30.0 38.0 16.0 38.0 26-27 32.939 38.0 30.0 38.0 16.0 38.0 28-29 32.8155 37.0 30.0 38.0 16.0 38.0 30-31 32.93025 37.5 31.0 38.0 16.0 38.0 32-33 33.09375 38.0 31.0 38.0 16.0 38.0 34-35 33.274249999999995 38.0 33.0 38.0 16.0 38.0 36-37 32.784125 38.0 30.0 38.0 16.0 38.0 38-39 33.090500000000006 38.0 31.0 38.0 16.0 38.0 40-41 33.17175 38.0 32.0 38.0 16.0 38.0 42-43 32.894875 37.5 30.0 38.0 16.0 38.0 44-45 33.138875 38.0 31.0 38.0 16.0 38.0 46-47 32.993375 38.0 31.0 38.0 16.0 38.0 48-49 33.154125 38.0 31.5 38.0 16.0 38.0 50-51 33.05575 38.0 31.0 38.0 16.0 38.0 52-53 33.030875 37.5 31.0 38.0 16.0 38.0 54-55 32.950874999999996 37.5 31.0 38.0 16.0 38.0 56-57 32.93275 37.5 30.5 38.0 16.0 38.0 58-59 32.881 38.0 31.0 38.0 16.0 38.0 60-61 33.141875 38.0 31.0 38.0 16.0 38.0 62-63 32.93025 37.5 30.5 38.0 16.0 38.0 64-65 33.0655 38.0 31.0 38.0 16.0 38.0 66-67 32.9775 38.0 31.0 38.0 16.0 38.0 68-69 33.067625 37.5 31.5 38.0 16.0 38.0 70-71 33.02675 38.0 31.0 38.0 16.0 38.0 72-73 33.005125 38.0 31.0 38.0 16.0 38.0 74-75 33.041375 38.0 31.0 38.0 16.0 38.0 76-77 32.779125 38.0 30.5 38.0 16.0 38.0 78-79 32.847 37.0 31.0 38.0 16.0 38.0 80-81 32.5415 37.0 29.0 38.0 15.0 38.0 82-83 32.681749999999994 37.0 30.0 38.0 15.0 38.0 84-85 32.7615 37.0 31.0 38.0 15.0 38.0 86-87 32.72225 37.0 31.0 38.0 15.0 38.0 88-89 32.611000000000004 37.0 31.0 38.0 15.0 38.0 90-91 32.595 37.0 30.5 38.0 15.0 38.0 92-93 32.557125 37.0 30.0 38.0 15.0 38.0 94-95 32.559125 37.0 31.0 38.0 15.0 38.0 96-97 32.502250000000004 37.0 30.0 38.0 15.0 38.0 98-99 32.459875 37.0 30.0 38.0 15.0 38.0 100-101 31.170499999999997 36.0 26.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 10.0 18 42.0 19 69.0 20 68.0 21 71.0 22 88.0 23 80.0 24 87.0 25 82.0 26 93.0 27 106.0 28 122.0 29 141.0 30 130.0 31 153.0 32 194.0 33 194.0 34 264.0 35 356.0 36 555.0 37 1093.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.475 11.924999999999999 31.95 33.650000000000006 2 30.725 18.825 28.1 22.35 3 25.1 23.75 27.625 23.525 4 26.650000000000002 26.924999999999997 20.599999999999998 25.825 5 29.349999999999998 30.45 21.4 18.8 6 22.35 36.6 19.35 21.7 7 22.3 17.599999999999998 36.525 23.575 8 25.825 21.575 24.825 27.775 9 24.8 21.099999999999998 27.425 26.674999999999997 10-11 26.5875 28.125 21.325 23.962500000000002 12-13 26.775 22.725 24.0625 26.437500000000004 14-15 24.9125 24.925 25.525 24.637500000000003 16-17 26.375 24.4 24.425 24.8 18-19 25.974999999999998 25.474999999999998 24.3 24.25 20-21 26.85 25.1 23.674999999999997 24.375 22-23 26.137500000000003 25.4375 24.3125 24.1125 24-25 24.587500000000002 25.575 24.6625 25.174999999999997 26-27 25.6125 26.0125 24.45 23.925 28-29 26.825 25.0625 23.775 24.337500000000002 30-31 25.112499999999997 25.7125 25.0 24.175 32-33 25.3125 25.724999999999998 24.337500000000002 24.625 34-35 25.724999999999998 25.6125 25.124999999999996 23.5375 36-37 26.387500000000003 24.9875 25.15 23.474999999999998 38-39 26.775 24.875 24.349999999999998 24.0 40-41 26.137500000000003 24.8125 24.7375 24.3125 42-43 25.4625 25.2625 25.937500000000004 23.3375 44-45 25.8125 26.424999999999997 24.2375 23.525 46-47 26.8 24.8125 25.087500000000002 23.3 48-49 24.462500000000002 25.7625 25.137500000000003 24.637500000000003 50-51 26.137500000000003 26.2125 23.7875 23.8625 52-53 25.7375 25.137500000000003 25.4375 23.6875 54-55 25.825 24.525 25.2375 24.4125 56-57 26.700000000000003 25.124999999999996 24.6625 23.5125 58-59 26.387500000000003 25.05 24.637500000000003 23.925 60-61 25.575 25.587500000000002 24.9875 23.849999999999998 62-63 25.7375 25.412499999999998 24.837500000000002 24.0125 64-65 25.50318789848731 25.028128516064506 24.478059757469683 24.990623827978496 66-67 26.1125 25.35 25.362499999999997 23.175 68-69 25.3125 25.912499999999998 25.0 23.775 70-71 26.724999999999998 25.2375 24.8625 23.175 72-73 25.912499999999998 25.7375 24.875 23.474999999999998 74-75 25.575 26.075 24.1875 24.1625 76-77 25.2875 25.7 25.25 23.7625 78-79 24.95 26.05 26.35 22.650000000000002 80-81 25.887500000000003 25.3125 24.462500000000002 24.337500000000002 82-83 26.875 25.7625 25.0625 22.3 84-85 25.224999999999998 25.874999999999996 25.0 23.9 86-87 26.950000000000003 24.75 25.2375 23.0625 88-89 25.924999999999997 25.337500000000002 24.975 23.7625 90-91 25.2375 26.200000000000003 25.7375 22.825 92-93 26.187500000000004 25.724999999999998 24.925 23.1625 94-95 26.5625 25.887500000000003 23.8625 23.6875 96-97 26.200000000000003 25.15 25.2375 23.4125 98-99 25.6125 27.4125 24.099999999999998 22.875 100-101 26.0125 26.275 24.275 23.4375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 0.0 28 0.5 29 0.5 30 0.0 31 0.0 32 1.0 33 4.0 34 7.0 35 9.0 36 15.0 37 26.0 38 40.5 39 60.5 40 86.0 41 114.5 42 150.0 43 188.5 44 217.0 45 234.0 46 243.5 47 240.5 48 224.5 49 212.0 50 205.5 51 189.5 52 159.5 53 146.0 54 139.0 55 123.0 56 110.5 57 107.5 58 102.5 59 93.0 60 87.0 61 79.5 62 71.0 63 58.5 64 53.0 65 51.5 66 40.0 67 30.0 68 27.0 69 18.5 70 13.0 71 10.0 72 5.5 73 3.0 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779717 spots for ERR10610860.sra Written 779717 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra Read 779707 spots for ERR10610860.sra Written 779707 spots for ERR10610860.sra SRR ids: ['ERR10610860.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wsacpr68 ERR10610860.sra spots: 15594150 blocks: [[1, 779707], [779708, 1559414], [1559415, 2339121], [2339122, 3118828], [3118829, 3898535], [3898536, 4678242], [4678243, 5457949], [5457950, 6237656], [6237657, 7017363], [7017364, 7797070], [7797071, 8576777], [8576778, 9356484], [9356485, 10136191], [10136192, 10915898], [10915899, 11695605], [11695606, 12475312], [12475313, 13255019], [13255020, 14034726], [14034727, 14814433], [14814434, 15594150]] ERR10610860 file size 3755007 ERR10610860 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610860 ERR10610860_1.fastq ERR10610860_2.fastq Input file: ERR10610860_1.fastq Paired file: ERR10610860_2.fastq trimmed: ERR10610860-trimmed-pair1.fastq, ERR10610860-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:30:12 2024 >> started Fri Dec 6 21:30:26 2024 >> done (13.924s) 15594150 read pairs processed; of these: 40 ( 0.00%) short read pairs filtered out after trimming by size control 36478 ( 0.23%) empty read pairs filtered out after trimming by size control 15557632 (99.77%) read pairs available; of these: 509774 ( 3.28%) trimmed read pairs available after processing 15047858 (96.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 1 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 1 0.00% 32 1 0.00% 33 0 0.00% 34 2 0.00% 35 1 0.00% 36 4 0.00% 37 6 0.00% 38 2 0.00% 39 1 0.00% 40 4 0.00% 41 4 0.00% 42 5 0.00% 43 7 0.00% 44 3 0.00% 45 9 0.00% 46 9 0.00% 47 14 0.00% 48 13 0.00% 49 21 0.00% 50 24 0.00% 51 33 0.00% 52 53 0.00% 53 48 0.00% 54 72 0.00% 55 52 0.00% 56 85 0.00% 57 81 0.00% 58 117 0.00% 59 133 0.00% 60 165 0.00% 61 211 0.00% 62 302 0.00% 63 343 0.00% 64 450 0.00% 65 467 0.00% 66 508 0.00% 67 618 0.00% 68 720 0.00% 69 848 0.01% 70 981 0.01% 71 1223 0.01% 72 1439 0.01% 73 1785 0.01% 74 2135 0.01% 75 2622 0.02% 76 2860 0.02% 77 3403 0.02% 78 3638 0.02% 79 4362 0.03% 80 4807 0.03% 81 5672 0.04% 82 6778 0.04% 83 8160 0.05% 84 9567 0.06% 85 11136 0.07% 86 12457 0.08% 87 13807 0.09% 88 15169 0.10% 89 16429 0.11% 90 18273 0.12% 91 20722 0.13% 92 23012 0.15% 93 26662 0.17% 94 30600 0.20% 95 34827 0.22% 96 38584 0.25% 97 41802 0.27% 98 44744 0.29% 99 46569 0.30% 100 50104 0.32% 101 15047858 96.72% 15557632 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.54 fanout-score-rank=32 prefix-density=0.18 prefix-fanout=2.5 sequence=TGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCT criterion=fanout-score sequence-density=0.08 sequence-density-rank=7 fanout-score=253.07 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=30.0 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=30 prefix-density=0.17 prefix-fanout=2.1 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.06 sequence-density-rank=20 fanout-score=76.60 fanout-score-rank=1 prefix-density=0.26 prefix-fanout=16.2 sequence=CAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCACTCATCCGTGACGGTCGTATGGAGAAGTTCTACTGGGCCCCCACCCGCGAAGACCGTATCGGTGTCTGCAGGGGTATCTTCCAAACTGACAACATCAGCGACGAGTCCGTCATCAAGATCGTAGACACCTTCCCAGGCCAATCCATCGACTTTTTCGGAGCGCTGCGTGCCCGGGTGTACGACGATGAGGTGCGCAAGTGGGTCAGCTCAACCGGAATAGAGAACATCGGCAAGAAGCTGGTGAACTCGAAGGATGGACCGGTGTCCTTTGAGCAGCCAAAGATGACAATCGAGAAGCTCCTGGAGTACGGCCACATGCTCGTCCAAGAGCAGGACAATGTCAAGCGTGTGCAGCTTGCTGACAAGTACATGAGCGAGGCTGCTCTGGGAGATGCTAACTCAGATGCCATGAAGACTGGTTCCTTCTACGGTTAGAACACTCTT ERR10610860 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:31:14 Started mapping on | Dec 06 21:31:14 Finished on | Dec 06 21:34:32 Mapping speed, Million of reads per hour | 282.87 Number of input reads | 15557632 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 13978054 Uniquely mapped reads % | 89.85% Average mapped length | 199.86 Number of splices: Total | 9837817 Number of splices: Annotated (sjdb) | 9271004 Number of splices: GT/AG | 9687840 Number of splices: GC/AG | 118704 Number of splices: AT/AC | 5143 Number of splices: Non-canonical | 26130 Mismatch rate per base, % | 0.96% Deletion rate per base | 0.02% Deletion average length | 2.11 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280902 % of reads mapped to multiple loci | 1.81% Number of reads mapped to too many loci | 11567 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.70% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1298676 1298676 1298676 N_multimapping 280902 280902 280902 N_noFeature 396274 13614978 481325 N_ambiguous 318923 1660 41287 UnstrandedReadsAssigned:13262857 PositiveStrandReadsAssigned:361416 NegativeStrandReadsAssigned:13455442 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610860 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610860-trimmed-pair1.fastq ERR10610860-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,557,632 reads, 13,811,868 reads pseudoaligned [quant] estimated average fragment length: 165.109 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,170 rounds 52973 ERR10610860.ke.tsv 35125 ERR10610860.se.tsv 88098 total ==> ERR10610860.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 772.051 2.62459 0.376949 PNS24247 1044 879.891 56.3222 7.09771 PNS24249 1928 1763.89 25.0316 1.57356 PNS24246 1044 879.891 56.3222 7.09771 PNS24248 1044 879.891 56.3222 7.09771 PNS24244 1471 1306.89 66.3772 5.6318 PNS24243 293 135.492 0 0 KQK14069 1603 1438.89 153.028 11.7926 KQK14071 474 311.388 5.74014 2.04403 ==> ERR10610860.se.tsv <== BRADI_1g14170v3 169 BRADI_1g53295v3 231 BRADI_1g59795v3 254 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 927 BRADI_1g74790v3 148 BRADI_1g09890v3 0 BRADI_1g77505v3 219 BRADI_1g48960v3 0 ERR10610860 completed mapping pipeline successfully