Starting /dee2/code/volunteer_pipeline.sh ERR10610861 current disk space = 1548969213952 free memory = 1599952828 ERR10610861 SRAfilesize 58289e1dbf5cb17e8b6947caf0eb67fa ERR10610861.sra ERR10610861.sra file validated ERR10610861 is paired end ERR10610861 is conventional basespace ERR10610861 read1 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610861_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.17575 18.0 18.0 30.0 18.0 32.0 2 28.236 29.0 27.0 31.0 18.0 33.0 3 28.39025 31.0 27.0 33.0 18.0 33.0 4 29.5115 32.0 30.0 33.0 15.0 33.0 5 29.8995 32.0 30.0 33.0 15.0 33.0 6 31.804 36.0 29.0 38.0 16.0 38.0 7 32.91125 37.0 31.0 38.0 16.0 38.0 8 33.15075 37.0 31.0 38.0 16.0 38.0 9 33.52675 38.0 33.0 38.0 16.0 38.0 10-11 30.67875 35.0 23.0 38.0 16.0 38.0 12-13 33.2755 37.5 32.0 38.0 16.0 38.0 14-15 33.865125 38.0 33.5 38.0 16.0 38.0 16-17 33.88525 38.0 34.0 38.0 16.0 38.0 18-19 33.889375 38.0 34.0 38.0 16.0 38.0 20-21 33.723125 38.0 33.5 38.0 16.0 38.0 22-23 33.895125 38.0 33.5 38.0 16.0 38.0 24-25 33.972125000000005 38.0 34.0 38.0 16.0 38.0 26-27 33.90825 38.0 34.0 38.0 16.0 38.0 28-29 33.6575 38.0 33.5 38.0 16.0 38.0 30-31 33.172 38.0 31.5 38.0 16.0 38.0 32-33 33.6075 38.0 33.0 38.0 16.0 38.0 34-35 33.800875000000005 38.0 34.0 38.0 16.0 38.0 36-37 33.83925 38.0 33.5 38.0 16.0 38.0 38-39 33.765625 38.0 34.0 38.0 16.0 38.0 40-41 33.684875 38.0 33.5 38.0 16.0 38.0 42-43 33.941 38.0 34.0 38.0 16.0 38.0 44-45 33.80175 38.0 34.0 38.0 16.0 38.0 46-47 33.83425 38.0 34.0 38.0 16.0 38.0 48-49 33.761125 38.0 34.0 38.0 16.0 38.0 50-51 33.956125 38.0 34.0 38.0 16.0 38.0 52-53 33.965374999999995 38.0 33.5 38.0 20.0 38.0 54-55 34.07475 38.0 34.0 38.0 16.0 38.0 56-57 33.832 38.0 34.0 38.0 16.0 38.0 58-59 34.01925 38.0 34.0 38.0 20.0 38.0 60-61 34.113125 38.0 34.0 38.0 20.0 38.0 62-63 34.062 38.0 34.0 38.0 20.0 38.0 64-65 34.15175 38.0 34.0 38.0 16.0 38.0 66-67 34.151375 38.0 34.0 38.0 20.0 38.0 68-69 34.010875 38.0 34.0 38.0 16.0 38.0 70-71 34.017125 38.0 34.0 38.0 20.0 38.0 72-73 34.075125 38.0 34.0 38.0 16.0 38.0 74-75 34.047250000000005 38.0 34.0 38.0 16.0 38.0 76-77 34.036625 38.0 34.0 38.0 16.0 38.0 78-79 33.9895 38.0 34.0 38.0 16.0 38.0 80-81 33.938375 38.0 34.0 38.0 20.0 38.0 82-83 33.944125 38.0 34.0 38.0 16.0 38.0 84-85 33.915625000000006 38.0 34.0 38.0 19.5 38.0 86-87 33.92675 38.0 34.0 38.0 16.0 38.0 88-89 33.770624999999995 38.0 34.0 38.0 16.0 38.0 90-91 33.755250000000004 38.0 34.0 38.0 16.0 38.0 92-93 33.445375 38.0 33.0 38.0 15.0 38.0 94-95 33.596875 38.0 34.0 38.0 15.0 38.0 96-97 33.775 38.0 34.0 38.0 15.0 38.0 98-99 33.787499999999994 38.0 34.0 38.0 18.0 38.0 100-101 32.806125 37.0 31.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 3.0 18 26.0 19 35.0 20 49.0 21 55.0 22 58.0 23 66.0 24 68.0 25 75.0 26 81.0 27 92.0 28 111.0 29 114.0 30 145.0 31 167.0 32 168.0 33 204.0 34 253.0 35 394.0 36 728.0 37 1108.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.829894313034725 14.997483643683946 11.373930548565676 49.798691494715655 2 23.7 17.375 37.75 21.175 3 25.4 18.099999999999998 24.4 32.1 4 25.974999999999998 27.150000000000002 20.075000000000003 26.8 5 27.450000000000003 30.25 24.8 17.5 6 20.305076269067268 35.68392098024506 23.755938984746187 20.255063765941486 7 15.607803901950975 22.086043021510758 42.446223111555774 19.85992996498249 8 19.7 21.125 31.15 28.025 9 20.45 19.950000000000003 34.225 25.374999999999996 10-11 23.6625 29.037499999999998 23.875 23.425 12-13 22.39869934967484 23.54927463731866 27.538769384692348 26.513256628314156 14-15 22.39869934967484 24.92496248124062 27.37618809404702 25.30015007503752 16-17 22.736368184092047 25.937968984492244 26.125562781390695 25.200100050025014 18-19 22.24862431215608 25.550275137568786 26.125562781390695 26.075537768884445 20-21 23.386693346673336 25.175087543771884 26.350675337668832 25.087543771885944 22-23 22.405601400350086 25.85646411602901 26.819204801200303 24.918729682420604 24-25 22.95573893473368 25.10627656914228 25.95648912228057 25.98149537384346 26-27 22.230557639409852 24.868717179294826 27.28182045511378 25.618904726181547 28-29 23.030757689422355 25.30632658164541 26.144036009002253 25.51887971992998 30-31 22.75 26.650000000000002 25.624999999999996 24.975 32-33 22.7625 25.412499999999998 26.575 25.25 34-35 22.662499999999998 25.3 26.625 25.412499999999998 36-37 22.9875 25.7 26.0375 25.275 38-39 23.45 25.687500000000004 25.587500000000002 25.275 40-41 22.9375 26.85 25.025 25.1875 42-43 22.1875 25.724999999999998 26.85 25.2375 44-45 22.6375 24.975 26.687499999999996 25.7 46-47 22.650000000000002 25.650000000000002 26.275 25.424999999999997 48-49 21.975 26.2625 25.8125 25.95 50-51 23.6125 25.162499999999998 26.0625 25.162499999999998 52-53 22.650000000000002 25.662499999999998 25.924999999999997 25.7625 54-55 22.1 26.424999999999997 25.724999999999998 25.75 56-57 22.725 24.875 27.0125 25.387500000000003 58-59 23.400000000000002 25.074999999999996 26.087500000000002 25.4375 60-61 22.9875 25.8625 25.937500000000004 25.2125 62-63 23.1 24.5375 25.924999999999997 26.437500000000004 64-65 23.225 25.1875 25.624999999999996 25.9625 66-67 22.575 25.937500000000004 26.5125 24.975 68-69 23.7625 25.1 26.1625 24.975 70-71 23.2625 26.275 25.7375 24.725 72-73 23.025000000000002 25.387500000000003 26.025 25.5625 74-75 23.8125 25.2875 25.7 25.2 76-77 23.6125 25.9625 26.075 24.349999999999998 78-79 23.35 25.5375 24.9875 26.125 80-81 22.525000000000002 24.725 26.7125 26.0375 82-83 23.799999999999997 24.712500000000002 25.374999999999996 26.1125 84-85 23.1125 25.3 26.174999999999997 25.412499999999998 86-87 22.8125 25.387500000000003 25.924999999999997 25.874999999999996 88-89 23.3125 25.5375 25.474999999999998 25.674999999999997 90-91 23.05 25.5625 25.2 26.187500000000004 92-93 24.515564445555693 24.69058632329041 25.403175396924617 25.390673834229275 94-95 23.875 25.174999999999997 25.324999999999996 25.624999999999996 96-97 23.775 25.45 25.825 24.95 98-99 23.625 24.837500000000002 25.887500000000003 25.650000000000002 100-101 23.799999999999997 26.275 24.6875 25.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.5 27 1.0 28 1.0 29 3.0 30 5.0 31 5.0 32 8.5 33 16.5 34 25.5 35 37.5 36 50.0 37 64.5 38 76.5 39 96.5 40 126.5 41 162.5 42 189.0 43 193.5 44 202.0 45 213.0 46 207.0 47 201.5 48 198.5 49 194.5 50 198.0 51 174.0 52 140.5 53 130.0 54 115.5 55 103.0 56 101.0 57 98.5 58 85.5 59 86.0 60 86.5 61 71.0 62 59.5 63 52.0 64 48.5 65 39.0 66 32.0 67 27.0 68 24.0 69 19.0 70 11.5 71 6.0 72 4.5 73 2.5 74 1.5 75 2.5 76 1.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.025 7 0.05 8 0.0 9 0.0 10-11 0.0 12-13 0.05 14-15 0.05 16-17 0.05 18-19 0.05 20-21 0.05 22-23 0.025 24-25 0.025 26-27 0.025 28-29 0.025 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0125 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29471032745592 98.55000000000001 2 0.654911838790932 1.3 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.475 0.0 0.0 0.0 0.0 80-81 0.525 0.0 0.0 0.0 0.0 82-83 0.625 0.0 0.0 0.0 0.0 84-85 0.825 0.0 0.0 0.0 0.0 86-87 0.9624999999999999 0.0 0.0 0.0 0.0 88-89 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR10610861 read2 length is 101 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR10610861_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 101 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.75775 33.0 28.0 33.0 18.0 34.0 2 30.212 33.0 30.0 33.0 18.0 34.0 3 30.112 33.0 30.0 33.0 18.0 34.0 4 29.78 33.0 30.0 33.0 15.0 34.0 5 29.832 33.0 30.0 33.0 15.0 34.0 6 33.21175 38.0 31.0 38.0 16.0 38.0 7 33.18725 38.0 31.0 38.0 16.0 38.0 8 33.1405 38.0 31.0 38.0 16.0 38.0 9 33.342 38.0 33.0 38.0 16.0 38.0 10-11 33.16975 38.0 31.0 38.0 16.0 38.0 12-13 33.27075 38.0 32.0 38.0 16.0 38.0 14-15 33.285625 38.0 31.5 38.0 16.0 38.0 16-17 32.57225 37.5 29.5 38.0 16.0 38.0 18-19 33.011 38.0 30.0 38.0 16.0 38.0 20-21 33.031875 38.0 31.0 38.0 16.0 38.0 22-23 33.144 38.0 32.0 38.0 16.0 38.0 24-25 33.326 38.0 32.0 38.0 16.0 38.0 26-27 33.04875 38.0 31.0 38.0 16.0 38.0 28-29 32.735875 37.5 29.5 38.0 16.0 38.0 30-31 33.055625 38.0 31.0 38.0 16.0 38.0 32-33 33.25875 38.0 32.5 38.0 16.0 38.0 34-35 33.34225 38.0 33.0 38.0 16.0 38.0 36-37 33.128874999999994 38.0 32.0 38.0 16.0 38.0 38-39 33.30525 38.0 32.0 38.0 16.0 38.0 40-41 33.258250000000004 38.0 32.0 38.0 16.0 38.0 42-43 32.904875000000004 38.0 30.0 38.0 16.0 38.0 44-45 33.285624999999996 38.0 32.0 38.0 16.0 38.0 46-47 33.248 38.0 32.5 38.0 16.0 38.0 48-49 33.3875 38.0 33.0 38.0 16.0 38.0 50-51 33.129374999999996 38.0 32.0 38.0 16.0 38.0 52-53 33.07525 38.0 31.0 38.0 16.0 38.0 54-55 33.078875 38.0 31.0 38.0 16.0 38.0 56-57 32.98975 38.0 31.0 38.0 16.0 38.0 58-59 32.99925 38.0 31.0 38.0 16.0 38.0 60-61 33.101625 38.0 31.0 38.0 16.0 38.0 62-63 32.870125 37.5 30.5 38.0 16.0 38.0 64-65 33.062250000000006 38.0 31.0 38.0 16.0 38.0 66-67 33.1335 38.0 31.5 38.0 16.0 38.0 68-69 33.260999999999996 38.0 32.0 38.0 16.0 38.0 70-71 33.229749999999996 38.0 32.0 38.0 16.0 38.0 72-73 33.110625 38.0 32.0 38.0 16.0 38.0 74-75 33.027 38.0 31.0 38.0 16.0 38.0 76-77 32.88249999999999 38.0 31.0 38.0 16.0 38.0 78-79 32.839625 38.0 31.0 38.0 15.5 38.0 80-81 32.76175 37.0 30.0 38.0 15.0 38.0 82-83 32.885374999999996 37.0 31.0 38.0 15.0 38.0 84-85 32.920875 38.0 31.0 38.0 15.0 38.0 86-87 33.008875 38.0 31.0 38.0 15.0 38.0 88-89 32.75925 38.0 31.0 38.0 15.0 38.0 90-91 32.627375 37.0 31.0 38.0 15.0 38.0 92-93 32.528375 37.0 30.0 38.0 15.0 38.0 94-95 32.72525 37.5 31.0 38.0 15.0 38.0 96-97 32.53475 37.0 30.5 38.0 15.0 38.0 98-99 32.56 37.0 31.0 38.0 15.0 38.0 100-101 31.458 36.0 27.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 3.0 17 8.0 18 37.0 19 58.0 20 65.0 21 87.0 22 65.0 23 75.0 24 68.0 25 97.0 26 121.0 27 104.0 28 115.0 29 144.0 30 147.0 31 162.0 32 190.0 33 177.0 34 241.0 35 334.0 36 507.0 37 1195.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.725 14.05 14.05 43.175000000000004 2 26.150000000000002 20.325 35.175 18.35 3 23.95 22.95 26.625 26.474999999999998 4 26.900000000000002 29.625 19.35 24.125 5 28.275 31.7 21.2 18.825 6 22.55 35.5 20.775 21.175 7 21.25 16.075 38.475 24.2 8 22.85 20.974999999999998 26.85 29.325000000000003 9 24.375 21.55 27.800000000000004 26.275 10-11 26.2625 28.1375 21.4875 24.1125 12-13 25.887500000000003 22.3125 25.337500000000002 26.4625 14-15 25.2875 25.837500000000002 24.462500000000002 24.4125 16-17 26.3 24.6875 24.575 24.4375 18-19 25.924999999999997 25.174999999999997 23.674999999999997 25.224999999999998 20-21 25.9875 25.35 24.9125 23.75 22-23 25.75 26.55 24.1625 23.5375 24-25 25.637500000000003 25.4625 24.4 24.5 26-27 25.650000000000002 25.7625 24.525 24.0625 28-29 25.6 26.0 24.4875 23.9125 30-31 26.1 25.412499999999998 24.325 24.1625 32-33 25.0375 25.7125 25.6 23.65 34-35 25.2875 25.674999999999997 24.775 24.2625 36-37 25.5625 24.575 25.8625 24.0 38-39 25.268817204301076 25.79394848712178 24.593648412103025 24.343585896474117 40-41 26.615826978372297 25.54069258657332 24.678084760595073 23.165395674459308 42-43 24.925 25.95 25.0 24.125 44-45 25.806451612903224 24.943735933983497 25.581395348837212 23.668417104276067 46-47 24.95 26.0375 24.8 24.212500000000002 48-49 25.174999999999997 25.275 25.35 24.2 50-51 25.2125 25.5375 25.624999999999996 23.625 52-53 25.474999999999998 25.5125 24.375 24.637500000000003 54-55 25.025 25.2375 25.25 24.4875 56-57 25.7 26.5 24.875 22.925 58-59 25.575 26.4625 24.5125 23.45 60-61 25.025 24.9375 26.525 23.5125 62-63 25.7875 24.65 25.575 23.9875 64-65 26.02825353169146 25.29066133266658 25.240655081885237 23.44043005375672 66-67 25.7625 24.9375 25.2625 24.0375 68-69 25.275 25.575 25.0375 24.1125 70-71 25.474999999999998 25.45 25.5125 23.5625 72-73 25.7625 25.85 25.087500000000002 23.3 74-75 25.5375 25.55 25.3125 23.599999999999998 76-77 24.675 26.75 25.112499999999997 23.4625 78-79 26.174999999999997 25.825 24.9 23.1 80-81 26.174999999999997 26.025 24.175 23.625 82-83 26.174999999999997 25.887500000000003 25.1 22.8375 84-85 25.587500000000002 26.0 25.474999999999998 22.9375 86-87 25.05 26.0125 25.900000000000002 23.0375 88-89 26.0625 25.5625 25.1875 23.1875 90-91 25.7625 25.374999999999996 25.6125 23.25 92-93 25.275 26.337500000000002 25.837500000000002 22.55 94-95 26.575 24.9375 25.162499999999998 23.325000000000003 96-97 25.55 25.887500000000003 25.4 23.1625 98-99 26.400000000000002 26.137500000000003 24.3625 23.1 100-101 26.487500000000004 25.837500000000002 24.725 22.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 1.0 29 0.5 30 1.0 31 1.0 32 7.5 33 13.5 34 14.0 35 22.5 36 35.5 37 46.0 38 65.0 39 90.5 40 110.0 41 132.0 42 165.5 43 188.0 44 192.0 45 203.0 46 212.5 47 212.5 48 212.5 49 188.5 50 169.0 51 169.5 52 146.0 53 134.5 54 126.0 55 108.5 56 105.5 57 106.0 58 109.5 59 104.5 60 92.5 61 87.5 62 85.0 63 74.0 64 64.0 65 52.0 66 38.5 67 36.5 68 27.5 69 16.0 70 13.0 71 8.5 72 4.0 73 1.5 74 1.5 75 0.5 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.025 40-41 0.0125 42-43 0.0 44-45 0.025 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0125 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 101 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.4524886877828055 0.8999999999999999 3 0.050276520864756154 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.21250000000000002 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.3375 0.0 0.0 0.0 0.0 78-79 0.44999999999999996 0.0 0.0 0.0 0.0 80-81 0.5 0.0 0.0 0.0 0.0 82-83 0.6 0.0 0.0 0.0 0.0 84-85 0.8375 0.0 0.0 0.0 0.0 86-87 1.0125000000000002 0.0 0.0 0.0 0.0 88-89 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612364 spots for ERR10610861.sra Written 612364 spots for ERR10610861.sra Read 612381 spots for ERR10610861.sra Written 612381 spots for ERR10610861.sra SRR ids: ['ERR10610861.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yoo5jz79 ERR10610861.sra spots: 12247297 blocks: [[1, 612364], [612365, 1224728], [1224729, 1837092], [1837093, 2449456], [2449457, 3061820], [3061821, 3674184], [3674185, 4286548], [4286549, 4898912], [4898913, 5511276], [5511277, 6123640], [6123641, 6736004], [6736005, 7348368], [7348369, 7960732], [7960733, 8573096], [8573097, 9185460], [9185461, 9797824], [9797825, 10410188], [10410189, 11022552], [11022553, 11634916], [11634917, 12247297]] ERR10610861 file size 2944441 ERR10610861 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR10610861 ERR10610861_1.fastq ERR10610861_2.fastq Input file: ERR10610861_1.fastq Paired file: ERR10610861_2.fastq trimmed: ERR10610861-trimmed-pair1.fastq, ERR10610861-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Dec 6 21:30:25 2024 >> started Fri Dec 6 21:30:38 2024 >> done (13.407s) 12247297 read pairs processed; of these: 42 ( 0.00%) short read pairs filtered out after trimming by size control 759 ( 0.01%) empty read pairs filtered out after trimming by size control 12246496 (99.99%) read pairs available; of these: 460607 ( 3.76%) trimmed read pairs available after processing 11785889 (96.24%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 0 0.00% 20 1 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 3 0.00% 28 6 0.00% 29 3 0.00% 30 6 0.00% 31 4 0.00% 32 13 0.00% 33 12 0.00% 34 15 0.00% 35 18 0.00% 36 19 0.00% 37 20 0.00% 38 23 0.00% 39 91 0.00% 40 33 0.00% 41 48 0.00% 42 38 0.00% 43 50 0.00% 44 53 0.00% 45 77 0.00% 46 83 0.00% 47 76 0.00% 48 107 0.00% 49 136 0.00% 50 149 0.00% 51 181 0.00% 52 188 0.00% 53 221 0.00% 54 227 0.00% 55 266 0.00% 56 297 0.00% 57 350 0.00% 58 381 0.00% 59 484 0.00% 60 514 0.00% 61 576 0.00% 62 675 0.01% 63 765 0.01% 64 866 0.01% 65 925 0.01% 66 1069 0.01% 67 1180 0.01% 68 1405 0.01% 69 1553 0.01% 70 1706 0.01% 71 1969 0.02% 72 2177 0.02% 73 2594 0.02% 74 2973 0.02% 75 3233 0.03% 76 3780 0.03% 77 4262 0.03% 78 4768 0.04% 79 5502 0.04% 80 6019 0.05% 81 6565 0.05% 82 7649 0.06% 83 8490 0.07% 84 9466 0.08% 85 10806 0.09% 86 11715 0.10% 87 12901 0.11% 88 14603 0.12% 89 16131 0.13% 90 17386 0.14% 91 19573 0.16% 92 21487 0.18% 93 22683 0.19% 94 25341 0.21% 95 27369 0.22% 96 29638 0.24% 97 32809 0.27% 98 35524 0.29% 99 37516 0.31% 100 40756 0.33% 101 11785889 96.24% 12246496 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=20 prefix-density=0.32 prefix-fanout=2.8 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=29.36 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=4.7 sequence=TGATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCACCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGTTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=34 prefix-density=0.32 prefix-fanout=2.0 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=49.18 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.9 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGC ERR10610861 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 06 21:31:14 Started mapping on | Dec 06 21:31:14 Finished on | Dec 06 21:34:26 Mapping speed, Million of reads per hour | 229.62 Number of input reads | 12246496 Average input read length | 201 UNIQUE READS: Uniquely mapped reads number | 11012673 Uniquely mapped reads % | 89.93% Average mapped length | 199.78 Number of splices: Total | 7283836 Number of splices: Annotated (sjdb) | 6818697 Number of splices: GT/AG | 7161467 Number of splices: GC/AG | 90694 Number of splices: AT/AC | 2863 Number of splices: Non-canonical | 28812 Mismatch rate per base, % | 0.92% Deletion rate per base | 0.02% Deletion average length | 2.14 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 227614 % of reads mapped to multiple loci | 1.86% Number of reads mapped to too many loci | 13046 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.17% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1006209 1006209 1006209 N_multimapping 227614 227614 227614 N_noFeature 379489 10696471 447355 N_ambiguous 287993 1213 40071 UnstrandedReadsAssigned:10345191 PositiveStrandReadsAssigned:314989 NegativeStrandReadsAssigned:10525247 Dataset is classified negative stranded MeadianReadLen=101 20thPercentileLength=101 echo kmer=97 ERR10610861 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR10610861-trimmed-pair1.fastq ERR10610861-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,246,496 reads, 10,741,431 reads pseudoaligned [quant] estimated average fragment length: 169.148 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52973 ERR10610861.ke.tsv 35125 ERR10610861.se.tsv 88098 total ==> ERR10610861.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 768.061 0 0 PNS24247 1044 875.852 32.6162 5.08823 PNS24249 1928 1759.85 25.257 1.96096 PNS24246 1044 875.852 32.6162 5.08823 PNS24248 1044 875.852 32.6162 5.08823 PNS24244 1471 1302.85 51.8945 5.44241 PNS24243 293 131.735 0 0 KQK14069 1603 1434.85 1090.69 103.862 KQK14071 474 307.172 45.1246 20.0723 ==> ERR10610861.se.tsv <== BRADI_1g14170v3 1268 BRADI_1g53295v3 133 BRADI_1g59795v3 338 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 207 BRADI_1g74790v3 59 BRADI_1g09890v3 0 BRADI_1g77505v3 190 BRADI_1g48960v3 1 ERR10610861 completed mapping pipeline successfully