Starting /dee2/code/volunteer_pipeline.sh ERR1744552 current disk space = 1548416606208 free memory = 1600329564 ERR1744552 SRAfilesize 695c2796aaf13b3b0fc0bb0727bbc6a7 ERR1744552.sra ERR1744552.sra file validated ERR1744552 is paired end ERR1744552 is conventional basespace ERR1744552 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744552_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.16725 34.0 33.0 34.0 32.0 34.0 2 33.24625 34.0 33.0 34.0 32.0 34.0 3 33.271 34.0 33.0 34.0 32.0 34.0 4 33.17125 34.0 33.0 34.0 32.0 34.0 5 33.15575 34.0 33.0 34.0 32.0 34.0 6 36.79875 38.0 37.0 38.0 35.0 38.0 7 37.23775 38.0 38.0 38.0 36.0 38.0 8 37.368 38.0 38.0 38.0 37.0 38.0 9 37.4 38.0 38.0 38.0 37.0 38.0 10-11 37.38675 38.0 38.0 38.0 37.0 38.0 12-13 37.3885 38.0 38.0 38.0 37.0 38.0 14-15 37.380624999999995 38.0 38.0 38.0 37.0 38.0 16-17 37.384375000000006 38.0 38.0 38.0 37.0 38.0 18-19 37.382 38.0 38.0 38.0 37.0 38.0 20-21 37.37675 38.0 38.0 38.0 37.0 38.0 22-23 37.34375 38.0 38.0 38.0 37.0 38.0 24-25 37.333875 38.0 38.0 38.0 37.0 38.0 26-27 37.28275 38.0 38.0 38.0 37.0 38.0 28-29 37.196375 38.0 38.0 38.0 36.5 38.0 30-31 37.184 38.0 38.0 38.0 36.5 38.0 32-33 37.164875 38.0 38.0 38.0 36.5 38.0 34-35 37.087375 38.0 38.0 38.0 36.5 38.0 36-37 37.169875000000005 38.0 38.0 38.0 36.5 38.0 38-39 37.067 38.0 38.0 38.0 36.0 38.0 40-41 37.00375 38.0 38.0 38.0 35.5 38.0 42-43 37.005125 38.0 38.0 38.0 36.0 38.0 44-45 36.941874999999996 38.0 38.0 38.0 36.0 38.0 46-47 36.856375 38.0 38.0 38.0 35.0 38.0 48-49 36.631125 38.0 38.0 38.0 34.5 38.0 50-51 36.548874999999995 38.0 38.0 38.0 33.5 38.0 52-53 36.285375 38.0 38.0 38.0 33.5 38.0 54-55 36.01275 38.0 37.0 38.0 31.5 38.0 56-57 35.928250000000006 38.0 37.0 38.0 31.5 38.0 58-59 35.474374999999995 38.0 37.0 38.0 30.0 38.0 60-61 35.444874999999996 38.0 37.0 38.0 29.0 38.0 62-63 35.457750000000004 38.0 37.0 38.0 29.5 38.0 64-65 34.988875 38.0 36.5 38.0 27.5 38.0 66-67 35.074625 38.0 36.5 38.0 28.5 38.0 68-69 34.924375 38.0 36.0 38.0 27.0 38.0 70-71 34.52675 38.0 35.5 38.0 25.5 38.0 72-73 33.980000000000004 38.0 34.0 38.0 22.0 38.0 74-75 33.70125 38.0 34.0 38.0 22.0 38.0 76-77 33.696749999999994 38.0 34.0 38.0 22.0 38.0 78-79 33.535375 38.0 33.5 38.0 21.0 38.0 80-81 32.881875 38.0 32.5 38.0 14.5 38.0 82-83 32.554249999999996 38.0 31.0 38.0 14.0 38.0 84-85 32.70925 38.0 32.0 38.0 14.5 38.0 86-87 32.332 38.0 31.0 38.0 14.0 38.0 88-89 31.991749999999996 37.5 30.5 38.0 14.0 38.0 90-91 31.4705 37.0 29.5 38.0 14.0 38.0 92-93 30.980249999999998 37.0 29.0 38.0 13.5 38.0 94-95 30.705750000000002 37.0 28.5 38.0 12.5 38.0 96-97 30.764375 37.0 29.0 38.0 12.0 38.0 98-99 29.809625 36.0 26.0 38.0 11.0 38.0 100-101 29.2545 35.0 24.0 38.0 11.0 38.0 102-103 28.235875 34.0 21.0 38.0 2.0 38.0 104-105 27.3345 33.0 16.5 38.0 2.0 38.0 106-107 27.4655 33.5 19.5 38.0 2.0 38.0 108-109 27.13525 33.5 17.0 38.0 2.0 38.0 110-111 26.204124999999998 33.0 14.0 38.0 2.0 38.0 112-113 25.589624999999998 33.0 13.5 38.0 2.0 38.0 114-115 24.604125 31.0 12.0 38.0 2.0 38.0 116-117 23.620375 29.5 11.0 37.0 2.0 38.0 118-119 22.582375 28.5 2.0 37.0 2.0 38.0 120-121 21.662999999999997 28.0 2.0 37.0 2.0 38.0 122-123 20.185875000000003 25.5 2.0 36.5 2.0 38.0 124-125 17.483625 11.0 2.0 36.0 2.0 38.0 126 7.50175 2.0 2.0 2.0 2.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 1.0 12 4.0 13 7.0 14 11.0 15 9.0 16 15.0 17 10.0 18 30.0 19 42.0 20 24.0 21 22.0 22 40.0 23 47.0 24 50.0 25 79.0 26 77.0 27 90.0 28 101.0 29 124.0 30 174.0 31 188.0 32 294.0 33 337.0 34 457.0 35 703.0 36 794.0 37 267.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.93993993993994 8.258258258258259 6.431431431431431 45.370370370370374 2 26.450000000000003 11.275 32.725 29.549999999999997 3 25.074999999999996 14.524999999999999 21.575 38.824999999999996 4 29.4 21.65 18.625 30.325000000000003 5 28.425 27.750000000000004 21.525 22.3 6 24.224999999999998 28.7 24.125 22.95 7 18.825 23.275000000000002 37.824999999999996 20.075000000000003 8 21.875 22.2 29.525000000000002 26.400000000000002 9 20.825 21.275 34.075 23.825 10-11 23.6125 28.9875 23.625 23.775 12-13 23.200000000000003 23.375 27.6125 25.8125 14-15 23.325000000000003 24.4375 26.737499999999997 25.5 16-17 24.8125 23.5625 25.825 25.8 18-19 23.775 24.762500000000003 25.362499999999997 26.1 20-21 22.975 24.962500000000002 25.374999999999996 26.687499999999996 22-23 24.525 25.0125 25.424999999999997 25.0375 24-25 24.087500000000002 23.7625 24.875 27.275 26-27 23.95 24.1125 25.55 26.387500000000003 28-29 24.8125 24.349999999999998 24.3875 26.450000000000003 30-31 24.025 23.9125 25.174999999999997 26.887499999999996 32-33 22.7 24.5125 26.224999999999998 26.5625 34-35 24.5375 25.087500000000002 24.9 25.474999999999998 36-37 24.462500000000002 23.8125 25.424999999999997 26.3 38-39 23.225 23.474999999999998 26.1125 27.187499999999996 40-41 23.7375 24.5 24.725 27.037499999999998 42-43 24.474999999999998 23.6375 25.25 26.637499999999996 44-45 23.0875 25.2125 25.5625 26.137500000000003 46-47 23.7 25.2 25.1875 25.912499999999998 48-49 23.674999999999997 23.875 25.8 26.650000000000002 50-51 23.0625 24.6 25.137500000000003 27.200000000000003 52-53 24.075 24.4125 24.725 26.787499999999998 54-55 24.4 24.5375 24.45 26.6125 56-57 24.175 23.65 25.650000000000002 26.525 58-59 24.47035226275542 23.81847812460825 25.673812210104046 26.03735740253228 60-61 24.252700326551118 25.332830946998243 24.252700326551118 26.161768399899522 62-63 23.920140632847815 23.69412355600201 25.552486187845304 26.833249623304873 64-65 24.45781622163721 23.831014165726465 25.222514729848317 26.488654882788015 66-67 24.49517120280948 24.88398344412392 24.771102470839082 25.849742882227517 68-69 24.614420062695924 24.476489028213166 24.70219435736677 26.20689655172414 70-71 23.902929712058345 24.795674588205706 25.273481705016977 26.027913994718975 72-73 25.472887767969738 23.972257250945773 24.12358133669609 26.431273644388398 74-75 23.968193865959865 25.369178341537296 25.06626277925028 25.59636501325255 76-77 23.98486759142497 23.87137452711223 25.39722572509458 26.746532156368225 78-79 23.674242424242426 24.431818181818183 25.126262626262623 26.767676767676768 80-81 23.485613326602724 25.18929833417466 25.164058556284708 26.161029782937913 82-83 24.457892082702976 23.978819969742815 25.201714573877965 26.36157337367625 84-85 24.370695053224797 24.571070757670633 24.74639949906074 26.311834690043835 86-87 24.129727022289003 24.567993989481593 25.544703230653642 25.757575757575758 88-89 24.94365138993238 24.092161282243925 24.380165289256198 26.584022038567497 90-91 24.3114672008012 24.399098647971957 24.749624436654983 26.53980971457186 92-93 24.530428249436515 24.242424242424242 25.29426496368645 25.93288254445279 94-95 23.969943644333124 24.658735128365684 24.946775203506576 26.424546023794615 96-97 24.427480916030532 24.05205856588662 25.50369165310975 26.016768864973095 98-99 25.10648960160361 24.104234527687296 24.743172137308946 26.04610373340015 100-101 24.902918702242268 24.126268320180383 24.965551797569834 26.005261180007516 102-103 24.461422845691384 23.910320641282564 24.649298597194388 26.978957915831664 104-105 24.91778396154819 24.05767771312927 25.512269162661273 25.512269162661273 106-107 25.224201086270053 23.860047997979034 24.441076165214096 26.47467475053682 108-109 25.458918850487404 24.18027598430181 24.952525636156476 25.40827952905431 110-111 25.61595123190246 24.14274828549657 25.10795021590043 25.133350266700532 112-113 25.209231549581535 23.3578493532843 24.99365965001268 26.439259447121483 114-115 25.00634356762243 24.295863993910174 24.219741182441005 26.47805125602639 116-117 24.87000634115409 24.13443246670894 24.844641724793913 26.15091946734306 118-119 24.650571791613725 24.955527318932656 24.548919949174078 25.844980940279545 120-121 25.111252383979654 25.047679593134138 24.132231404958677 25.708836617927528 122-123 24.643765903307887 25.43256997455471 24.12213740458015 25.80152671755725 124-125 24.340436326737695 24.987316083206494 24.403855910705225 26.268391679350582 126 27.06061374587877 20.060867359878266 25.792543748414914 27.08597514582805 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 1.0 25 1.5 26 1.5 27 2.0 28 5.0 29 5.5 30 6.5 31 10.0 32 10.5 33 14.0 34 21.5 35 34.0 36 45.0 37 60.0 38 80.5 39 97.5 40 115.0 41 133.5 42 147.0 43 167.0 44 180.0 45 176.5 46 180.0 47 176.0 48 170.0 49 167.0 50 158.5 51 145.5 52 134.0 53 121.0 54 102.5 55 89.5 56 100.0 57 101.0 58 79.5 59 80.0 60 82.0 61 79.5 62 79.5 63 66.0 64 58.5 65 64.0 66 65.5 67 61.0 68 56.5 69 45.5 70 40.5 71 44.5 72 38.0 73 31.0 74 23.5 75 15.0 76 9.5 77 6.5 78 5.0 79 3.5 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.2875 60-61 0.475 62-63 0.44999999999999996 64-65 0.2875 66-67 0.3375 68-69 0.3125 70-71 0.5875 72-73 0.8750000000000001 74-75 0.9625 76-77 0.8750000000000001 78-79 1.0 80-81 0.95 82-83 0.8500000000000001 84-85 0.1875 86-87 0.17500000000000002 88-89 0.17500000000000002 90-91 0.15 92-93 0.17500000000000002 94-95 0.1875 96-97 0.11249999999999999 98-99 0.22499999999999998 100-101 0.21250000000000002 102-103 0.2 104-105 1.175 106-107 1.0375 108-109 1.2625000000000002 110-111 1.575 112-113 1.425 114-115 1.4749999999999999 116-117 1.4375 118-119 1.625 120-121 1.6875 122-123 1.7500000000000002 124-125 1.4500000000000002 126 1.425 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91028890015205 97.575 2 0.9376583882412569 1.8499999999999999 3 0.07602635580334516 0.22499999999999998 4 0.025342118601115054 0.1 5 0.05068423720223011 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGTTACTAGTAGTGTAGTACGGGTAGAGGCATCAGAGGCTGCTGCTTC 5 0.125 No Hit GGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.15 0.0 0.0 0.025 0.0 80-81 0.16249999999999998 0.0 0.0 0.025 0.0 82-83 0.2375 0.0 0.0 0.025 0.0 84-85 0.25 0.0 0.0 0.025 0.0 86-87 0.35 0.0 0.0 0.025 0.0 88-89 0.44999999999999996 0.0 0.0 0.025 0.0 90-91 0.5875 0.0 0.0 0.025 0.0 92-93 0.7625 0.0 0.0 0.025 0.0 94-95 0.875 0.0 0.0 0.025 0.0 96-97 1.0125 0.0 0.0 0.025 0.0 98-99 1.1625 0.0 0.0 0.025 0.0 100-101 1.3375 0.0 0.0 0.025 0.0 102-103 1.575 0.0 0.0 0.025 0.0 104-105 1.825 0.0 0.0 0.025 0.0 106-107 2.1875 0.0 0.0 0.025 0.0 108-109 2.575 0.0 0.0 0.025 0.0 110-111 3.1 0.0 0.0 0.025 0.0 112-113 3.85 0.0 0.0 0.025 0.0 114 4.275 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744552 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744552_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4325 33.0 33.0 34.0 32.0 34.0 2 32.71775 34.0 33.0 34.0 32.0 34.0 3 32.76325 34.0 33.0 34.0 32.0 34.0 4 32.77525 34.0 33.0 34.0 32.0 34.0 5 32.62725 34.0 33.0 34.0 31.0 34.0 6 36.4595 38.0 38.0 38.0 35.0 38.0 7 36.4095 38.0 38.0 38.0 36.0 38.0 8 36.391 38.0 38.0 38.0 36.0 38.0 9 36.134 38.0 38.0 38.0 35.0 38.0 10-11 35.82075 38.0 38.0 38.0 34.0 38.0 12-13 35.644125 38.0 38.0 38.0 33.5 38.0 14-15 35.624375 38.0 38.0 38.0 33.5 38.0 16-17 35.645375 38.0 38.0 38.0 33.5 38.0 18-19 35.635000000000005 38.0 38.0 38.0 33.5 38.0 20-21 35.482 38.0 38.0 38.0 33.0 38.0 22-23 35.585750000000004 38.0 38.0 38.0 33.0 38.0 24-25 35.692625 38.0 38.0 38.0 34.0 38.0 26-27 35.63825 38.0 38.0 38.0 33.5 38.0 28-29 36.026375 38.0 38.0 38.0 33.5 38.0 30-31 36.28375 38.0 38.0 38.0 33.5 38.0 32-33 36.544 38.0 38.0 38.0 35.0 38.0 34-35 36.570625 38.0 38.0 38.0 35.0 38.0 36-37 36.517375 38.0 38.0 38.0 35.0 38.0 38-39 36.45975 38.0 38.0 38.0 35.0 38.0 40-41 36.46425 38.0 38.0 38.0 35.0 38.0 42-43 36.46025 38.0 38.0 38.0 35.0 38.0 44-45 36.4555 38.0 38.0 38.0 35.0 38.0 46-47 36.356624999999994 38.0 38.0 38.0 34.0 38.0 48-49 36.245625000000004 38.0 38.0 38.0 34.0 38.0 50-51 35.906875 38.0 38.0 38.0 34.0 38.0 52-53 35.748875 38.0 38.0 38.0 33.5 38.0 54-55 35.64512499999999 38.0 38.0 38.0 33.0 38.0 56-57 35.563375 38.0 38.0 38.0 33.0 38.0 58-59 35.51775 38.0 38.0 38.0 32.0 38.0 60-61 35.419124999999994 38.0 38.0 38.0 31.5 38.0 62-63 35.354875 38.0 38.0 38.0 31.0 38.0 64-65 35.164500000000004 38.0 37.0 38.0 30.0 38.0 66-67 35.107875 38.0 38.0 38.0 29.0 38.0 68-69 34.945125000000004 38.0 37.5 38.0 28.5 38.0 70-71 34.804625 38.0 37.0 38.0 29.0 38.0 72-73 34.564375 38.0 37.0 38.0 25.5 38.0 74-75 34.55825 38.0 37.0 38.0 27.0 38.0 76-77 34.466750000000005 38.0 37.0 38.0 25.0 38.0 78-79 34.385625000000005 38.0 36.5 38.0 25.5 38.0 80-81 34.208 38.0 36.0 38.0 24.0 38.0 82-83 33.947375 38.0 35.5 38.0 22.0 38.0 84-85 33.944375 38.0 35.5 38.0 22.5 38.0 86-87 33.876000000000005 38.0 35.5 38.0 22.0 38.0 88-89 33.779875000000004 38.0 35.5 38.0 22.0 38.0 90-91 33.28325 38.0 34.5 38.0 17.0 38.0 92-93 32.858875 38.0 33.5 38.0 14.0 38.0 94-95 32.789125 38.0 33.5 38.0 14.0 38.0 96-97 32.486625000000004 38.0 33.0 38.0 14.0 38.0 98-99 32.619 38.0 33.0 38.0 14.0 38.0 100-101 32.308125000000004 38.0 33.0 38.0 14.0 38.0 102-103 32.424875 38.0 33.0 38.0 13.5 38.0 104-105 32.280375 38.0 33.0 38.0 13.0 38.0 106-107 32.06225 38.0 32.0 38.0 13.0 38.0 108-109 31.555 38.0 31.0 38.0 12.0 38.0 110-111 31.098374999999997 37.5 30.0 38.0 11.0 38.0 112-113 30.41575 37.0 28.0 38.0 11.0 38.0 114-115 29.951625 36.5 27.0 38.0 2.0 38.0 116-117 30.150375 37.0 28.0 38.0 2.0 38.0 118-119 29.788125 36.5 27.5 38.0 2.0 38.0 120-121 29.264 36.0 26.0 38.0 2.0 38.0 122-123 28.299125 36.0 23.0 38.0 2.0 38.0 124-125 26.406125 35.5 7.5 38.0 2.0 38.0 126 12.5385 2.0 2.0 26.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 5.0 4 1.0 5 1.0 6 2.0 7 9.0 8 17.0 9 31.0 10 9.0 11 5.0 12 5.0 13 2.0 14 4.0 15 14.0 16 14.0 17 19.0 18 15.0 19 12.0 20 21.0 21 26.0 22 21.0 23 22.0 24 30.0 25 28.0 26 33.0 27 28.0 28 48.0 29 69.0 30 71.0 31 91.0 32 129.0 33 170.0 34 269.0 35 452.0 36 963.0 37 1328.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.48798988621998 18.4070796460177 12.212389380530974 34.89254108723136 2 29.575000000000003 22.325 29.25 18.85 3 24.07314629258517 25.0 26.753507014028056 24.173346693386772 4 26.163081540770385 30.29014507253627 19.559779889944974 23.986993496748372 5 27.62000502638854 30.987685348077402 20.532797185222417 20.859512440311637 6 23.168567807351078 34.29657794676806 19.94930291508238 22.585551330798477 7 23.008399083736318 17.994400610842455 35.09798931025706 23.899210995164164 8 23.61642438153532 22.902320836521294 24.560061208875286 28.921193573068095 9 22.75525910723448 22.216521292970754 27.19343252950231 27.834787070292457 10-11 24.925624110723064 28.883714913982665 21.187427240977883 25.00323373431639 12-13 25.96778383995843 23.29176409457002 23.759418030657315 26.98103403481424 14-15 25.33801352054082 25.052002080083202 24.492979719188767 25.117004680187204 16-17 26.738593526582612 24.78876901078903 23.5928766411023 24.879760821526062 18-19 25.821962313190383 25.717998700454842 23.300844704353477 25.1591942820013 20-21 26.14983713355049 25.342019543973944 23.270358306188925 25.237785016286647 22-23 26.875162211263948 24.733973527121723 23.708798338956658 24.68206592265767 24-25 25.832361704884054 25.14574426739215 24.070475450187846 24.95141857753595 26-27 26.19758535635467 25.275866545501753 23.64014020511489 24.88640789302869 28-29 26.804386636062226 24.560061208875286 23.782198418770722 24.853353736291762 30-31 26.869247257596772 24.71315092674316 23.02357836338419 25.394023452275878 32-33 25.833228524713874 26.00930700540812 24.00955854609483 24.14790592378317 34-35 27.091984396627662 24.94022901723921 23.631559078897695 24.336227507235435 36-37 25.94079277471149 24.498243853487207 24.234821876567988 25.32614149523332 38-39 25.31693234592695 25.128655704782226 24.312790259821764 25.241621689469063 40-41 26.030150753768844 24.673366834170853 23.944723618090453 25.351758793969847 42-43 25.724999999999998 25.1875 24.75 24.337500000000002 44-45 25.316614420062695 25.16614420062696 24.087774294670847 25.4294670846395 46-47 26.625 24.85 23.8375 24.6875 48-49 26.359039190897597 24.968394437420987 23.81795195954488 24.854614412136534 50-51 26.243765187364115 24.977618621307073 24.261414503133395 24.51720168819542 52-53 27.704350057744133 24.509174900551777 23.893237520852047 23.893237520852047 54-55 26.206280316568805 25.708450344651517 23.742660199131986 24.34260913964769 56-57 25.89974293059126 26.439588688946014 23.020565552699228 24.640102827763496 58-59 26.177943253305948 25.163692386699193 23.597380921812814 25.06098343818205 60-61 26.655522695126656 24.64960781792465 24.37958081522438 24.315288671724318 62-63 26.71903167653876 24.54287921710018 23.989183620911668 24.748905485449395 64-65 27.413127413127413 25.135135135135133 23.436293436293436 24.015444015444015 66-67 26.504002065582238 24.490059385489285 24.309320939839917 24.696617609088563 68-69 26.74058793192367 25.8380608561114 23.99432697266632 23.427024239298607 70-71 27.07282369680507 24.809209675333076 23.95550381580649 24.16246281205536 72-73 26.255973137026995 24.87407981402557 24.189590597959448 24.68035645098799 74-75 27.289141088470465 23.96182615424297 24.9290688676812 23.819963889605365 76-77 26.924057084607544 23.91692150866463 24.159021406727827 25.0 78-79 27.19717955175019 24.955930496096702 23.835305968269957 24.011583983883153 80-81 26.71765295887663 25.18806419257773 24.611334002006018 23.48294884653962 82-83 27.544609198291027 24.114099019854233 23.67429002261875 24.66700175923599 84-85 26.961897552359325 25.447893010345695 23.807721423164267 23.78248801413071 86-87 26.590476190476192 24.761904761904763 23.72063492063492 24.926984126984127 88-89 26.524585954551288 24.213634612915648 24.406213891385285 24.855565541147772 90-91 25.882352941176475 25.106658047834518 24.330963154492565 24.680025856496446 92-93 26.312378483473754 25.56059624108879 23.14970836033701 24.977316915100452 94-95 27.14767713470023 24.993511549441994 23.150791590968076 24.708019724889695 96-97 26.927056389032593 25.284531815830313 23.64200724262804 24.146404552509054 98-99 26.47971051951409 24.69630395451021 24.399069527009562 24.42491599896614 100-101 27.971219324168057 25.26018244892715 23.718360529358858 23.050237697545935 102-103 26.707676534666152 24.91349480968858 23.60630526720492 24.772523388440344 104-105 27.194668717160063 24.836601307189543 23.875432525951556 24.093297449698834 106-107 26.827401454267125 24.913892078071182 23.71475953565506 24.543946932006634 108-109 26.963284038755734 25.165731769505356 23.3299337072922 24.54105048444671 110-111 26.419186120678656 25.628268911851 24.250542160989923 23.70200280648042 112-113 27.025654051308102 26.02235204470409 22.618745237490476 24.333248666497333 114-115 26.877770740975297 25.31982267257758 23.394553514882837 24.407853071564283 116-117 27.559154751360243 26.053397444008603 22.624319878527142 23.763127926104012 118-119 27.918781725888326 25.253807106598984 23.236040609137056 23.591370558375637 120-121 25.96008084891359 26.14957049014654 23.799898938858007 24.09044972208186 122-123 27.448518332496235 25.35158211953792 23.066298342541437 24.13360120542441 124-125 27.835699032784827 25.80077879663359 22.99962316291923 23.363899007662354 126 28.88386123680241 23.604826546003014 22.54901960784314 24.962292609351433 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.5 3 3.0 4 4.5 5 4.0 6 3.0 7 3.0 8 2.5 9 2.0 10 1.5 11 3.5 12 3.5 13 5.0 14 6.0 15 4.5 16 4.0 17 4.5 18 5.5 19 4.5 20 4.5 21 5.5 22 5.5 23 5.0 24 7.5 25 9.0 26 7.0 27 9.5 28 9.0 29 5.0 30 7.5 31 11.0 32 12.0 33 16.0 34 25.0 35 41.5 36 49.5 37 51.0 38 62.0 39 82.5 40 94.0 41 108.0 42 134.0 43 147.5 44 168.5 45 178.0 46 168.5 47 166.5 48 165.0 49 165.5 50 145.5 51 138.0 52 136.0 53 112.0 54 107.5 55 114.0 56 111.0 57 98.0 58 86.0 59 75.0 60 75.0 61 82.0 62 79.0 63 74.5 64 75.5 65 70.5 66 64.0 67 62.5 68 62.5 69 53.5 70 41.0 71 33.0 72 30.0 73 27.0 74 19.0 75 14.5 76 11.0 77 5.5 78 2.5 79 3.0 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.2 4 0.05 5 0.525 6 1.375 7 1.775 8 1.975 9 2.55 10-11 3.3625000000000003 12-13 3.775 14-15 3.85 16-17 3.8375 18-19 3.8125 20-21 4.0625 22-23 3.675 24-25 3.5125 26-27 3.7125 28-29 1.975 30-31 0.8625 32-33 0.6125 34-35 0.6625 36-37 0.35000000000000003 38-39 0.41250000000000003 40-41 0.5 42-43 0.0 44-45 0.3125 46-47 0.0 48-49 1.125 50-51 2.2624999999999997 52-53 2.5875 54-55 2.075 56-57 2.75 58-59 2.6374999999999997 60-61 2.7875 62-63 2.9250000000000003 64-65 2.875 66-67 3.175 68-69 3.05 70-71 3.3625000000000003 72-73 3.2125 74-75 3.075 76-77 1.9 78-79 0.7250000000000001 80-81 0.3 82-83 0.525 84-85 0.9249999999999999 86-87 1.5625 88-89 2.6374999999999997 90-91 3.3125 92-93 3.5624999999999996 94-95 3.675 96-97 3.35 98-99 3.2750000000000004 100-101 2.7125 102-103 2.4625 104-105 2.4625 106-107 2.0125 108-109 1.95 110-111 2.0125 112-113 1.575 114-115 1.3125 116-117 1.2125000000000001 118-119 1.5 120-121 1.05 122-123 0.44999999999999996 124-125 0.4875 126 0.5499999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36932391523713 98.475 2 0.5297679112008072 1.05 3 0.050454086781029264 0.15 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025227043390514632 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.8875 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.1625 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.6124999999999998 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.7375 0.0 0.0 0.0 0.0 110-111 3.325 0.0 0.0 0.0 0.0 112-113 4.0125 0.0 0.0 0.0 0.0 114 4.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893288 spots for ERR1744552.sra Written 893288 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra Read 893283 spots for ERR1744552.sra Written 893283 spots for ERR1744552.sra SRR ids: ['ERR1744552.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p21u512x ERR1744552.sra spots: 17865665 blocks: [[1, 893283], [893284, 1786566], [1786567, 2679849], [2679850, 3573132], [3573133, 4466415], [4466416, 5359698], [5359699, 6252981], [6252982, 7146264], [7146265, 8039547], [8039548, 8932830], [8932831, 9826113], [9826114, 10719396], [10719397, 11612679], [11612680, 12505962], [12505963, 13399245], [13399246, 14292528], [14292529, 15185811], [15185812, 16079094], [16079095, 16972377], [16972378, 17865665]] ERR1744552 file size 5160040 ERR1744552 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744552 ERR1744552_1.fastq ERR1744552_2.fastq Input file: ERR1744552_1.fastq Paired file: ERR1744552_2.fastq trimmed: ERR1744552-trimmed-pair1.fastq, ERR1744552-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:24:16 2024 >> started Sat Dec 7 00:24:33 2024 >> done (17.463s) 17865665 read pairs processed; of these: 17744 ( 0.10%) short read pairs filtered out after trimming by size control 24148 ( 0.14%) empty read pairs filtered out after trimming by size control 17823773 (99.77%) read pairs available; of these: 15437212 (86.61%) trimmed read pairs available after processing 2386561 (13.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 12 0.00% 20 10 0.00% 21 15 0.00% 22 11 0.00% 23 18 0.00% 24 19 0.00% 25 20 0.00% 26 30 0.00% 27 44 0.00% 28 56 0.00% 29 40 0.00% 30 45 0.00% 31 65 0.00% 32 79 0.00% 33 99 0.00% 34 108 0.00% 35 130 0.00% 36 176 0.00% 37 175 0.00% 38 228 0.00% 39 275 0.00% 40 329 0.00% 41 379 0.00% 42 444 0.00% 43 478 0.00% 44 502 0.00% 45 566 0.00% 46 649 0.00% 47 725 0.00% 48 852 0.00% 49 912 0.01% 50 1032 0.01% 51 1166 0.01% 52 1216 0.01% 53 1366 0.01% 54 1558 0.01% 55 1723 0.01% 56 1882 0.01% 57 2019 0.01% 58 2273 0.01% 59 2500 0.01% 60 2784 0.02% 61 2964 0.02% 62 3206 0.02% 63 3637 0.02% 64 4044 0.02% 65 4310 0.02% 66 4749 0.03% 67 5593 0.03% 68 5902 0.03% 69 6901 0.04% 70 7192 0.04% 71 7930 0.04% 72 8968 0.05% 73 9561 0.05% 74 10553 0.06% 75 11146 0.06% 76 12058 0.07% 77 12971 0.07% 78 13373 0.08% 79 14761 0.08% 80 15535 0.09% 81 16897 0.09% 82 18079 0.10% 83 19867 0.11% 84 21751 0.12% 85 23369 0.13% 86 25598 0.14% 87 27792 0.16% 88 29875 0.17% 89 32299 0.18% 90 38254 0.21% 91 44544 0.25% 92 39545 0.22% 93 41761 0.23% 94 45381 0.25% 95 48903 0.27% 96 52434 0.29% 97 55914 0.31% 98 60656 0.34% 99 65433 0.37% 100 70519 0.40% 101 75654 0.42% 102 82981 0.47% 103 88706 0.50% 104 96553 0.54% 105 103789 0.58% 106 113012 0.63% 107 120712 0.68% 108 129272 0.73% 109 138665 0.78% 110 151786 0.85% 111 165739 0.93% 112 182820 1.03% 113 200703 1.13% 114 223863 1.26% 115 246234 1.38% 116 272765 1.53% 117 310140 1.74% 118 357803 2.01% 119 417307 2.34% 120 504578 2.83% 121 628113 3.52% 122 815107 4.57% 123 1161963 6.52% 124 2020888 11.34% 125 5856813 32.86% 126 2386561 13.39% 17823773 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=21 prefix-density=0.45 prefix-fanout=2.8 sequence=GCAGGTGCAGCTGGTGC criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=203.10 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=14.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=28 prefix-density=0.51 prefix-fanout=2.1 sequence=ATGTCGAGCGGC criterion=fanout-score sequence-density=0.17 sequence-density-rank=16 fanout-score=52.06 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=11.0 sequence=GAAGAAGAAGAAACAACTCCGGCCATGGCGGGCATCATCCACAAGATCGAGGAGAAGCTCCACATGGGCGGTGGCAGCGACCACAAGGACGAGCACAAGAA ERR1744552 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:25:14 Started mapping on | Dec 07 00:25:16 Finished on | Dec 07 00:26:42 Mapping speed, Million of reads per hour | 746.11 Number of input reads | 17823773 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 16961770 Uniquely mapped reads % | 95.16% Average mapped length | 240.02 Number of splices: Total | 14460646 Number of splices: Annotated (sjdb) | 13508161 Number of splices: GT/AG | 14252284 Number of splices: GC/AG | 166882 Number of splices: AT/AC | 5594 Number of splices: Non-canonical | 35886 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415304 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 31696 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.58% % of reads unmapped: other | 0.75% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 456531 456531 456531 N_multimapping 415304 415304 415304 N_noFeature 720461 16520456 827482 N_ambiguous 384443 2526 50331 UnstrandedReadsAssigned:15856866 PositiveStrandReadsAssigned:438788 NegativeStrandReadsAssigned:16083957 Dataset is classified negative stranded MeadianReadLen=123 20thPercentileLength=112 echo kmer=107 ERR1744552 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744552-trimmed-pair1.fastq ERR1744552-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,823,773 reads, 16,182,669 reads pseudoaligned [quant] estimated average fragment length: 190.889 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 ERR1744552.ke.tsv 35125 ERR1744552.se.tsv 88098 total ==> ERR1744552.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 746.425 0 0 PNS24247 1044 854.111 57.1153 5.42813 PNS24249 1928 1738.11 161.938 7.5628 PNS24246 1044 854.111 57.1153 5.42813 PNS24248 1044 854.111 57.1153 5.42813 PNS24244 1471 1281.11 68.7166 4.35399 PNS24243 293 117.172 0 0 KQK14069 1603 1413.11 1716.03 98.5734 KQK14071 474 286.915 32.1126 9.08522 ==> ERR1744552.se.tsv <== BRADI_1g14170v3 1901 BRADI_1g53295v3 582 BRADI_1g59795v3 161 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 473 BRADI_1g74790v3 467 BRADI_1g09890v3 0 BRADI_1g77505v3 429 BRADI_1g48960v3 0 ERR1744552 completed mapping pipeline successfully