Starting /dee2/code/volunteer_pipeline.sh ERR1744553 current disk space = 1548301807616 free memory = 1603379544 ERR1744553 SRAfilesize 3d6e5a3aaec50f3731484e020ce938a3 ERR1744553.sra ERR1744553.sra file validated ERR1744553 is paired end ERR1744553 is conventional basespace ERR1744553 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744553_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.18275 34.0 33.0 34.0 32.0 34.0 2 33.20125 34.0 33.0 34.0 32.0 34.0 3 33.26775 34.0 33.0 34.0 33.0 34.0 4 33.2365 34.0 33.0 34.0 32.0 34.0 5 33.23 34.0 33.0 34.0 32.0 34.0 6 36.81425 38.0 37.0 38.0 35.0 38.0 7 37.2175 38.0 38.0 38.0 36.0 38.0 8 37.3935 38.0 38.0 38.0 37.0 38.0 9 37.4665 38.0 38.0 38.0 37.0 38.0 10-11 37.393375 38.0 38.0 38.0 37.0 38.0 12-13 37.417500000000004 38.0 38.0 38.0 37.0 38.0 14-15 37.424875 38.0 38.0 38.0 37.5 38.0 16-17 37.411 38.0 38.0 38.0 37.5 38.0 18-19 37.43475 38.0 38.0 38.0 37.5 38.0 20-21 37.389624999999995 38.0 38.0 38.0 37.5 38.0 22-23 37.391125 38.0 38.0 38.0 37.0 38.0 24-25 37.384 38.0 38.0 38.0 37.0 38.0 26-27 37.353 38.0 38.0 38.0 37.0 38.0 28-29 37.243875 38.0 38.0 38.0 37.0 38.0 30-31 37.261375 38.0 38.0 38.0 37.0 38.0 32-33 37.21125 38.0 38.0 38.0 37.0 38.0 34-35 37.15625 38.0 38.0 38.0 37.0 38.0 36-37 37.239125 38.0 38.0 38.0 37.0 38.0 38-39 37.108125 38.0 38.0 38.0 36.0 38.0 40-41 37.084875 38.0 38.0 38.0 36.0 38.0 42-43 37.14075 38.0 38.0 38.0 36.0 38.0 44-45 37.0145 38.0 38.0 38.0 36.0 38.0 46-47 36.899125 38.0 38.0 38.0 35.5 38.0 48-49 36.809124999999995 38.0 38.0 38.0 35.0 38.0 50-51 36.709 38.0 38.0 38.0 34.5 38.0 52-53 36.49525 38.0 38.0 38.0 33.5 38.0 54-55 36.324749999999995 38.0 38.0 38.0 33.0 38.0 56-57 36.269499999999994 38.0 38.0 38.0 33.0 38.0 58-59 35.75512500000001 38.0 37.0 38.0 31.0 38.0 60-61 35.608875 38.0 37.0 38.0 30.5 38.0 62-63 35.76575 38.0 37.5 38.0 31.0 38.0 64-65 35.461625 38.0 37.0 38.0 29.5 38.0 66-67 35.415625 38.0 37.0 38.0 29.5 38.0 68-69 35.24325 38.0 37.0 38.0 29.0 38.0 70-71 35.024874999999994 38.0 36.5 38.0 29.0 38.0 72-73 34.768625 38.0 36.0 38.0 27.0 38.0 74-75 34.39125 38.0 35.0 38.0 25.5 38.0 76-77 34.21875 38.0 34.5 38.0 23.0 38.0 78-79 34.269625000000005 38.0 34.5 38.0 25.5 38.0 80-81 33.60725 38.0 33.5 38.0 20.5 38.0 82-83 33.446124999999995 38.0 33.0 38.0 21.5 38.0 84-85 33.492125 38.0 33.5 38.0 20.0 38.0 86-87 33.123000000000005 38.0 33.0 38.0 19.5 38.0 88-89 32.912375 38.0 33.0 38.0 14.5 38.0 90-91 32.411 37.5 32.0 38.0 14.0 38.0 92-93 32.092875 37.0 30.5 38.0 14.0 38.0 94-95 31.951124999999998 37.0 30.5 38.0 14.0 38.0 96-97 32.007374999999996 37.0 31.0 38.0 14.0 38.0 98-99 31.338875 37.0 29.5 38.0 13.5 38.0 100-101 30.6965 36.5 28.0 38.0 12.5 38.0 102-103 29.8155 36.0 25.5 38.0 11.5 38.0 104-105 28.959375 34.5 23.0 38.0 11.0 38.0 106-107 29.142 35.0 24.0 38.0 6.5 38.0 108-109 28.772750000000002 34.5 23.5 38.0 2.0 38.0 110-111 27.951999999999998 34.0 20.0 38.0 2.0 38.0 112-113 27.3425 33.5 17.5 38.0 2.0 38.0 114-115 26.504625 33.0 14.0 38.0 2.0 38.0 116-117 25.7015 32.5 14.0 38.0 2.0 38.0 118-119 24.92875 32.0 12.5 37.5 2.0 38.0 120-121 24.20675 31.5 6.5 38.0 2.0 38.0 122-123 22.397625 30.0 2.0 37.5 2.0 38.0 124-125 19.672625 20.0 2.0 37.0 2.0 38.0 126 8.17225 2.0 2.0 2.0 2.0 31.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 0.0 4 1.0 5 0.0 6 0.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 4.0 13 9.0 14 6.0 15 12.0 16 14.0 17 13.0 18 27.0 19 8.0 20 21.0 21 26.0 22 19.0 23 26.0 24 47.0 25 49.0 26 59.0 27 78.0 28 86.0 29 96.0 30 130.0 31 164.0 32 213.0 33 346.0 34 498.0 35 721.0 36 903.0 37 417.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.69952464348261 8.431323492619464 9.782336752564422 49.0868151113335 2 24.025 11.375 32.225 32.375 3 23.95 16.45 20.95 38.65 4 26.75 23.825 19.975 29.45 5 28.175 27.375 22.400000000000002 22.05 6 22.95 30.675 25.15 21.224999999999998 7 17.549999999999997 22.25 40.025 20.175 8 20.674999999999997 23.474999999999998 29.349999999999998 26.5 9 19.225 22.075 34.300000000000004 24.4 10-11 22.275 29.625 24.175 23.925 12-13 21.8625 25.224999999999998 27.35 25.5625 14-15 22.0875 25.924999999999997 26.700000000000003 25.2875 16-17 23.375 25.8125 25.412499999999998 25.4 18-19 22.7375 25.7625 25.912499999999998 25.587500000000002 20-21 22.900000000000002 26.125 25.55 25.424999999999997 22-23 23.549999999999997 25.825 24.8125 25.8125 24-25 22.400000000000002 26.5625 25.087500000000002 25.95 26-27 22.075 26.137500000000003 26.0625 25.724999999999998 28-29 21.1125 26.3 26.400000000000002 26.187500000000004 30-31 22.825 26.1625 25.637500000000003 25.374999999999996 32-33 22.162499999999998 25.6125 25.887500000000003 26.337500000000002 34-35 23.5875 25.424999999999997 25.6125 25.374999999999996 36-37 22.7625 25.112499999999997 25.575 26.55 38-39 22.75 25.124999999999996 25.25 26.875 40-41 23.2125 25.55 26.325 24.9125 42-43 23.3625 25.937500000000004 24.825 25.874999999999996 44-45 23.075000000000003 25.7625 25.7125 25.45 46-47 23.5375 25.5125 26.0125 24.9375 48-49 23.0375 24.3 25.7625 26.900000000000002 50-51 22.412499999999998 25.4875 26.450000000000003 25.650000000000002 52-53 23.1125 25.424999999999997 24.887500000000003 26.575 54-55 22.275 25.2375 26.35 26.137500000000003 56-57 22.9375 25.874999999999996 25.362499999999997 25.825 58-59 23.85735811150176 25.816172777498746 25.288799598191865 25.037669512807636 60-61 22.474174855127234 26.40463592844545 25.585789871504154 25.535399344923153 62-63 22.248803827751196 25.346260387811636 26.25283303953664 26.152102744900528 64-65 23.23245008162753 25.831972874544768 25.141278412658547 25.794298631169156 66-67 23.301946013810422 25.83804143126177 24.607658505963588 26.252354048964214 68-69 23.1649069884364 25.465057817998993 25.691302161890395 25.678733031674206 70-71 23.976829114721067 25.50056667925954 25.42500944465432 25.097594761365066 72-73 22.891718139417623 25.677549476868776 25.362410185301904 26.068322198411696 74-75 23.579904064630146 25.20828073718758 25.70058066144913 25.511234536733145 76-77 22.97995714105635 26.2700113450145 25.715366191856802 25.034665322072357 78-79 23.705481182116696 25.511492801212427 25.271533215458447 25.511492801212427 80-81 23.025485743123898 25.599293464547063 25.801160736815543 25.5740600555135 82-83 23.617584078599318 24.57488348658521 25.481798715203425 26.325733719612042 84-85 23.62382445141066 24.76489028213166 25.768025078369906 25.843260188087775 86-87 24.285356068204614 24.761785356068206 25.539117352056167 25.41374122367101 88-89 23.18876911506643 26.259714214088742 25.532714966156934 25.018801704687892 90-91 23.622244488977955 25.513527054108216 25.275551102204407 25.58867735470942 92-93 24.13836320340895 25.228725404185987 25.040731921293396 25.59217947111167 94-95 23.89669007021063 25.890170511534606 24.4358074222668 25.77733199598796 96-97 23.779113448534936 25.66992236413724 24.73077886301027 25.820185324317556 98-99 23.124215809284816 26.27352572145546 25.04391468005019 25.558343789209538 100-101 24.124952954459918 26.006774557771923 25.341864257935015 24.526408229833148 102-103 23.86805468456039 25.147372381788536 24.294493916969774 26.690079016681302 104-105 23.96359959555106 26.011122345803845 24.987360970677454 25.037917087967642 106-107 23.715115544892033 24.750599823210003 25.31885339057962 26.21543124131835 108-109 23.801088194356574 25.471339997469318 24.484373022902695 26.243198785271417 110-111 23.333333333333332 26.29911280101394 25.221799746514574 25.145754119138147 112-113 24.214394323365436 25.342118601115054 23.87227572225038 26.57121135326913 114-115 24.759249873289406 25.291434363912824 24.12569690826153 25.82361885453624 116-117 23.164701407379233 25.86534804108026 24.369215164194244 26.600735387346262 118-119 24.517521584560694 25.203148806500764 24.377856780091417 25.901472828847133 120-121 24.513915364086923 25.581395348837212 23.916634896429027 25.98805439064684 122-123 23.67149758454106 26.137808288838038 24.77752351894228 25.413170607678616 124-125 24.600557950798883 26.45194014709612 23.484656353030687 25.46284554907431 126 27.68878718535469 22.247648105771674 23.366386981947624 26.697177726926007 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.0 23 1.0 24 1.0 25 2.5 26 3.5 27 4.5 28 6.0 29 10.0 30 14.5 31 18.5 32 20.5 33 26.0 34 35.5 35 48.5 36 72.0 37 89.5 38 103.0 39 108.5 40 122.0 41 148.0 42 161.5 43 168.5 44 175.0 45 190.5 46 195.0 47 181.0 48 177.0 49 170.5 50 159.5 51 138.5 52 113.5 53 113.0 54 103.5 55 90.5 56 94.5 57 87.0 58 82.5 59 79.0 60 64.0 61 62.5 62 64.0 63 57.0 64 51.0 65 49.5 66 52.5 67 50.0 68 39.5 69 36.0 70 33.0 71 25.5 72 25.5 73 20.5 74 14.5 75 12.0 76 8.5 77 7.0 78 3.5 79 2.5 80 1.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.44999999999999996 60-61 0.775 62-63 0.7250000000000001 64-65 0.46249999999999997 66-67 0.43750000000000006 68-69 0.5499999999999999 70-71 0.7374999999999999 72-73 0.8375 74-75 0.975 76-77 0.8375 78-79 1.0250000000000001 80-81 0.9249999999999999 82-83 0.7625 84-85 0.3125 86-87 0.3 88-89 0.27499999999999997 90-91 0.2 92-93 0.2625 94-95 0.3 96-97 0.17500000000000002 98-99 0.375 100-101 0.36250000000000004 102-103 0.3375 104-105 1.0999999999999999 106-107 1.0125 108-109 1.2125000000000001 110-111 1.375 112-113 1.35 114-115 1.35 116-117 1.4125 118-119 1.55 120-121 1.6375000000000002 122-123 1.675 124-125 1.425 126 1.675 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83248730964466 97.35000000000001 2 0.8883248730964468 1.7500000000000002 3 0.20304568527918782 0.6 4 0.07614213197969542 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0125 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.05 0.0 0.025 0.0 0.0 70-71 0.07500000000000001 0.0 0.025 0.0 0.0 72-73 0.1 0.0 0.025 0.0 0.0 74-75 0.1 0.0 0.025 0.0 0.0 76-77 0.1 0.0 0.025 0.0 0.0 78-79 0.1375 0.0 0.025 0.0 0.0 80-81 0.175 0.0 0.025 0.0 0.0 82-83 0.25 0.0 0.025 0.0 0.0 84-85 0.32499999999999996 0.0 0.025 0.0 0.0 86-87 0.375 0.0 0.025 0.0 0.0 88-89 0.4 0.0 0.025 0.0 0.0 90-91 0.55 0.0 0.025 0.0 0.0 92-93 0.6875 0.0 0.025 0.0 0.0 94-95 0.8875 0.0 0.025 0.0 0.0 96-97 1.0625 0.0 0.025 0.0 0.0 98-99 1.3875 0.0 0.025 0.0 0.0 100-101 1.725 0.0 0.025 0.0 0.0 102-103 2.0 0.0 0.025 0.0 0.0 104-105 2.55 0.0 0.025 0.0 0.0 106-107 2.9375 0.0 0.025 0.0 0.0 108-109 3.5999999999999996 0.0 0.025 0.0 0.0 110-111 4.3625 0.0 0.025 0.0 0.0 112-113 5.0625 0.0 0.025 0.0 0.0 114 5.6 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744553 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744553_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49975 33.0 33.0 34.0 32.0 34.0 2 32.8385 34.0 33.0 34.0 32.0 34.0 3 32.88075 34.0 33.0 34.0 32.0 34.0 4 32.90925 34.0 33.0 34.0 32.0 34.0 5 32.783 34.0 33.0 34.0 31.0 34.0 6 36.65275 38.0 38.0 38.0 36.0 38.0 7 36.50625 38.0 38.0 38.0 36.0 38.0 8 36.592 38.0 38.0 38.0 36.0 38.0 9 36.212 38.0 38.0 38.0 35.0 38.0 10-11 35.8535 38.0 38.0 38.0 34.5 38.0 12-13 35.521375 38.0 38.0 38.0 33.0 38.0 14-15 35.501000000000005 38.0 38.0 38.0 33.5 38.0 16-17 35.54725 38.0 38.0 38.0 34.0 38.0 18-19 35.49875 38.0 38.0 38.0 33.5 38.0 20-21 35.477374999999995 38.0 38.0 38.0 33.5 38.0 22-23 35.507374999999996 38.0 38.0 38.0 33.5 38.0 24-25 35.5715 38.0 38.0 38.0 33.5 38.0 26-27 35.495125 38.0 38.0 38.0 33.5 38.0 28-29 35.961875 38.0 38.0 38.0 33.5 38.0 30-31 36.313 38.0 38.0 38.0 33.5 38.0 32-33 36.552625 38.0 38.0 38.0 36.0 38.0 34-35 36.634875 38.0 38.0 38.0 36.0 38.0 36-37 36.53275 38.0 38.0 38.0 35.5 38.0 38-39 36.49325 38.0 38.0 38.0 35.0 38.0 40-41 36.593 38.0 38.0 38.0 35.5 38.0 42-43 36.637125 38.0 38.0 38.0 36.0 38.0 44-45 36.639875 38.0 38.0 38.0 36.0 38.0 46-47 36.51625 38.0 38.0 38.0 35.5 38.0 48-49 36.383 38.0 38.0 38.0 35.0 38.0 50-51 36.03075 38.0 38.0 38.0 34.5 38.0 52-53 35.74725 38.0 38.0 38.0 34.0 38.0 54-55 35.763625000000005 38.0 38.0 38.0 33.5 38.0 56-57 35.705749999999995 38.0 38.0 38.0 33.5 38.0 58-59 35.6165 38.0 38.0 38.0 33.5 38.0 60-61 35.58725 38.0 38.0 38.0 33.5 38.0 62-63 35.512875 38.0 38.0 38.0 33.0 38.0 64-65 35.342 38.0 38.0 38.0 31.0 38.0 66-67 35.311375 38.0 38.0 38.0 31.0 38.0 68-69 35.177375 38.0 38.0 38.0 30.0 38.0 70-71 34.92725 38.0 37.5 38.0 30.0 38.0 72-73 34.870125 38.0 37.0 38.0 27.5 38.0 74-75 34.831875 38.0 37.0 38.0 28.0 38.0 76-77 34.76349999999999 38.0 37.0 38.0 27.0 38.0 78-79 34.773125 38.0 37.0 38.0 27.5 38.0 80-81 34.514624999999995 38.0 37.0 38.0 25.5 38.0 82-83 34.370625000000004 38.0 36.5 38.0 25.0 38.0 84-85 34.367125 38.0 36.5 38.0 25.5 38.0 86-87 34.421625 38.0 36.0 38.0 26.0 38.0 88-89 34.3935 38.0 36.0 38.0 25.5 38.0 90-91 34.007999999999996 38.0 36.0 38.0 22.5 38.0 92-93 33.429 38.0 34.5 38.0 16.0 38.0 94-95 33.195 38.0 34.0 38.0 14.0 38.0 96-97 33.138999999999996 38.0 34.0 38.0 14.0 38.0 98-99 33.244625 38.0 34.0 38.0 14.0 38.0 100-101 33.0145 38.0 34.0 38.0 14.0 38.0 102-103 32.9155 38.0 33.5 38.0 14.0 38.0 104-105 32.798625 38.0 33.0 38.0 14.0 38.0 106-107 32.824375 38.0 33.0 38.0 14.0 38.0 108-109 32.357875 38.0 33.0 38.0 13.5 38.0 110-111 31.919125 38.0 32.0 38.0 12.5 38.0 112-113 31.403750000000002 37.5 30.0 38.0 12.0 38.0 114-115 30.924999999999997 37.0 29.0 38.0 11.5 38.0 116-117 31.164749999999998 38.0 30.0 38.0 11.0 38.0 118-119 30.441125 37.0 28.5 38.0 2.0 38.0 120-121 29.927374999999998 37.0 27.5 38.0 2.0 38.0 122-123 29.433500000000002 36.5 27.5 38.0 2.0 38.0 124-125 27.293375 36.0 12.5 38.0 2.0 38.0 126 13.801 2.0 2.0 28.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 36.0 3 5.0 4 4.0 5 3.0 6 2.0 7 8.0 8 14.0 9 35.0 10 17.0 11 1.0 12 1.0 13 4.0 14 9.0 15 2.0 16 9.0 17 6.0 18 15.0 19 9.0 20 14.0 21 21.0 22 16.0 23 24.0 24 24.0 25 26.0 26 22.0 27 51.0 28 53.0 29 55.0 30 54.0 31 76.0 32 87.0 33 159.0 34 251.0 35 432.0 36 961.0 37 1494.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.666160849772382 16.9195751138088 14.795144157814871 38.61911987860395 2 30.45 22.45 28.499999999999996 18.6 3 24.374374374374376 26.151151151151154 25.75075075075075 23.723723723723726 4 25.512756378189096 30.540270135067534 20.83541770885443 23.111555777888945 5 27.345709984947312 31.936778725539387 20.672353236327147 20.045158053186153 6 23.855299772324816 35.01138375917025 20.743738932456363 20.38957753604857 7 22.284263959390863 17.96954314720812 35.380710659898476 24.36548223350254 8 24.592668024439917 23.19246435845214 23.65071283095723 28.564154786150713 9 24.044136515268157 23.248652809853734 27.226071336925838 25.481139337952268 10-11 26.559668651307273 28.48822158943826 20.78695314522392 24.165156614030547 12-13 26.78315295344895 22.92345807797627 24.50123875342287 25.79215021515191 14-15 25.573813249869588 25.260824204486177 25.13041210224309 24.034950443401147 16-17 26.943140323422014 25.938967136150236 23.552425665101723 23.56546687532603 18-19 25.984354628422423 26.0625814863103 24.14602346805737 23.807040417209908 20-21 26.472508815462977 25.53219276479039 24.970615123416483 23.024683296330156 22-23 26.589369463262113 24.960917144346016 23.931735278791034 24.517978113600833 24-25 25.776276471352478 25.022736130960116 25.633363648174612 23.567623749512798 26-27 25.798045602605864 25.094462540716613 24.74267100977199 24.364820846905538 28-29 25.685849176980984 25.5582493301008 24.473650631619243 24.282250861298966 30-31 25.072372561359344 26.14222781623663 24.984266834487098 23.801132787916927 32-33 25.806856712294362 25.3045334672862 25.505462765289465 23.383147055129978 34-35 25.587237784197963 25.28576811958297 24.368797889712347 24.758196206506717 36-37 25.980207941876486 24.965551797569834 25.353876988600778 23.700363271952902 38-39 25.614343029087262 25.70210631895687 25.488966900702103 23.19458375125376 40-41 26.482758620689655 24.76489028213166 25.01567398119122 23.73667711598746 42-43 24.925 25.4375 25.387500000000003 24.25 44-45 25.457278877474316 26.23402655975946 24.429967426710096 23.878727136056128 46-47 25.775 26.0 25.0125 23.2125 48-49 25.7694248234107 26.07214934409687 24.508072653884966 23.650353178607467 50-51 26.303014818599895 24.655084312723556 25.523760858456825 23.518140010219724 52-53 25.77372543983562 25.529729035572107 25.195839219211507 23.500706305380763 54-55 25.658983827836497 25.977333503119826 24.092703425442505 24.27097924360117 56-57 25.989717223650388 25.34704370179949 25.565552699228792 23.097686375321334 58-59 25.68383202773854 25.619622447669194 25.68383202773854 23.01271349685373 60-61 26.861257554326862 25.009643821525007 24.45673138742446 23.672367236723673 62-63 25.962652929813263 26.349001931745008 24.249839021249194 23.43850611719253 64-65 26.237942122186496 25.234726688102892 25.491961414791 23.035369774919616 66-67 26.393188854489164 25.554695562435505 25.01289989680083 23.03921568627451 68-69 25.71833526607396 25.47352145342095 25.099858265687413 23.70828501481768 70-71 25.608808290155437 25.129533678756477 25.569948186528496 23.691709844559586 72-73 25.258131130614352 25.438822922044395 26.006711409395972 23.296334537945278 74-75 25.12245424078371 26.024748646558393 25.264243361691157 23.588553750966746 76-77 26.03715958259099 25.311784168999747 24.77729702214304 23.873759226266227 78-79 26.266817553124604 25.047152018106374 25.42436816295737 23.261662265811644 80-81 25.789473684210527 25.839598997493734 24.949874686716793 23.42105263157895 82-83 26.26363978427192 25.511099962373006 24.996864417408755 23.22839583594632 84-85 25.34005037783375 25.70528967254408 25.894206549118387 23.06045340050378 86-87 26.177811550151976 24.94934143870314 25.848530901722388 23.024316109422493 88-89 26.733436055469955 25.680534155110422 24.935798664612225 22.650231124807398 90-91 25.100116264048573 25.733109417387933 25.642681824053742 23.524092494509755 92-93 26.475548060708263 25.72318069788559 25.372940718640553 22.4283305227656 94-95 25.875765073577288 25.289751269696577 26.396666232582366 22.43781742414377 96-97 25.006464959917245 26.35117662270494 25.57538143263512 23.066976984742695 98-99 24.96764172922599 25.39477090344292 25.783070152731035 23.85451721460005 100-101 27.724935732647815 24.53727506426735 25.33419023136247 22.403598971722367 102-103 26.1477301872275 26.019492177481407 25.493716337522443 22.33906129776866 104-105 26.355595436482503 26.0479425714652 24.355851813870018 23.240610178182283 106-107 25.64657918206141 26.003312523888393 24.538157727098994 23.811950566951204 108-109 26.462360122075278 24.94913530010173 25.737538148524923 22.850966429298065 110-111 26.43239113827349 25.350140056022408 25.146422205245734 23.071046600458363 112-113 26.770556189028255 25.16153553781832 24.90814645888762 23.159761814265806 114-115 27.612789081258686 26.285858713509413 23.745734866675093 22.355617338556804 116-117 27.158001009591114 25.870772337203434 24.35638566380616 22.614840989399294 118-119 26.832046576382734 25.275281609922796 24.743703328692572 23.148968485001898 120-121 28.301172909572454 25.75356287047547 23.25640055492496 22.688863665027114 122-123 27.44926083688299 27.035830618892508 23.552994237033325 21.96191430719118 124-125 28.698595787362084 26.54212637913741 23.28234704112337 21.47693079237713 126 31.046658259773015 22.950819672131146 23.026481715006305 22.976040353089534 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 2.0 6 4.5 7 3.5 8 2.5 9 2.0 10 1.5 11 3.0 12 4.0 13 3.5 14 5.5 15 4.5 16 5.0 17 7.0 18 6.0 19 5.5 20 7.0 21 8.0 22 8.0 23 6.0 24 6.5 25 10.5 26 8.0 27 7.5 28 11.0 29 9.0 30 13.0 31 21.0 32 19.5 33 21.0 34 39.5 35 55.0 36 58.5 37 65.5 38 79.0 39 99.0 40 123.5 41 148.5 42 143.5 43 155.5 44 171.5 45 167.0 46 183.0 47 178.0 48 164.0 49 149.0 50 137.5 51 144.5 52 139.0 53 122.5 54 106.0 55 103.5 56 106.0 57 92.5 58 82.5 59 75.5 60 76.0 61 75.0 62 61.5 63 53.0 64 51.5 65 52.0 66 45.5 67 47.5 68 46.0 69 36.0 70 32.5 71 24.0 72 19.0 73 17.5 74 15.0 75 14.5 76 10.0 77 5.0 78 3.5 79 1.5 80 0.5 81 1.5 82 1.0 83 1.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.15 2 0.0 3 0.1 4 0.05 5 0.35000000000000003 6 1.175 7 1.5 8 1.7999999999999998 9 2.5749999999999997 10-11 3.4250000000000003 12-13 4.1375 14-15 4.15 16-17 4.15 18-19 4.125 20-21 4.2875000000000005 22-23 4.05 24-25 3.7875 26-27 4.0625 28-29 2.0375 30-31 0.6875 32-33 0.46249999999999997 34-35 0.4875 36-37 0.21250000000000002 38-39 0.3 40-41 0.3125 42-43 0.0 44-45 0.22499999999999998 46-47 0.0 48-49 0.8999999999999999 50-51 2.15 52-53 2.6625 54-55 1.8375 56-57 2.75 58-59 2.6625 60-61 2.7875 62-63 2.9375 64-65 2.8125 66-67 3.1 68-69 2.9875 70-71 3.5000000000000004 72-73 3.15 74-75 3.025 76-77 1.775 78-79 0.5875 80-81 0.25 82-83 0.3375 84-85 0.75 86-87 1.3 88-89 2.65 90-91 3.2375000000000003 92-93 3.6374999999999997 94-95 4.0125 96-97 3.325 98-99 3.4250000000000003 100-101 2.75 102-103 2.5250000000000004 104-105 2.4875000000000003 106-107 1.8875 108-109 1.7000000000000002 110-111 1.825 112-113 1.3375 114-115 1.0875 116-117 0.95 118-119 1.2375 120-121 0.8875 122-123 0.22499999999999998 124-125 0.3 126 0.8750000000000001 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5787619526925012 1.15 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.07500000000000001 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.6749999999999998 0.0 0.0 0.0 0.0 102-103 2.0 0.0 0.0 0.0 0.0 104-105 2.5625 0.0 0.0 0.0 0.0 106-107 2.9625 0.0 0.0 0.0 0.0 108-109 3.5999999999999996 0.0 0.0 0.0 0.0 110-111 4.4125 0.0 0.0 0.0 0.0 112-113 5.2 0.0 0.0 0.0 0.0 114 5.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981678 spots for ERR1744553.sra Written 981678 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra Read 981666 spots for ERR1744553.sra Written 981666 spots for ERR1744553.sra SRR ids: ['ERR1744553.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7c7fhl2q ERR1744553.sra spots: 19633332 blocks: [[1, 981666], [981667, 1963332], [1963333, 2944998], [2944999, 3926664], [3926665, 4908330], [4908331, 5889996], [5889997, 6871662], [6871663, 7853328], [7853329, 8834994], [8834995, 9816660], [9816661, 10798326], [10798327, 11779992], [11779993, 12761658], [12761659, 13743324], [13743325, 14724990], [14724991, 15706656], [15706657, 16688322], [16688323, 17669988], [17669989, 18651654], [18651655, 19633332]] ERR1744553 file size 5672732 ERR1744553 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744553 ERR1744553_1.fastq ERR1744553_2.fastq Input file: ERR1744553_1.fastq Paired file: ERR1744553_2.fastq trimmed: ERR1744553-trimmed-pair1.fastq, ERR1744553-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:39:21 2024 >> started Sat Dec 7 00:39:38 2024 >> done (17.573s) 19633332 read pairs processed; of these: 13995 ( 0.07%) short read pairs filtered out after trimming by size control 24102 ( 0.12%) empty read pairs filtered out after trimming by size control 19595235 (99.81%) read pairs available; of these: 16725336 (85.35%) trimmed read pairs available after processing 2869899 (14.65%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 8 0.00% 21 7 0.00% 22 4 0.00% 23 12 0.00% 24 16 0.00% 25 29 0.00% 26 21 0.00% 27 24 0.00% 28 27 0.00% 29 36 0.00% 30 49 0.00% 31 52 0.00% 32 75 0.00% 33 59 0.00% 34 80 0.00% 35 118 0.00% 36 112 0.00% 37 127 0.00% 38 171 0.00% 39 190 0.00% 40 217 0.00% 41 276 0.00% 42 332 0.00% 43 348 0.00% 44 373 0.00% 45 449 0.00% 46 517 0.00% 47 510 0.00% 48 629 0.00% 49 692 0.00% 50 750 0.00% 51 828 0.00% 52 952 0.00% 53 1086 0.01% 54 1183 0.01% 55 1353 0.01% 56 1405 0.01% 57 1545 0.01% 58 1758 0.01% 59 1940 0.01% 60 2210 0.01% 61 2366 0.01% 62 2594 0.01% 63 2962 0.02% 64 3258 0.02% 65 3491 0.02% 66 4007 0.02% 67 4481 0.02% 68 4785 0.02% 69 5566 0.03% 70 5902 0.03% 71 6605 0.03% 72 7685 0.04% 73 8431 0.04% 74 9076 0.05% 75 9876 0.05% 76 10708 0.05% 77 11541 0.06% 78 12339 0.06% 79 13208 0.07% 80 14379 0.07% 81 15923 0.08% 82 17486 0.09% 83 18634 0.10% 84 20620 0.11% 85 22780 0.12% 86 24596 0.13% 87 26888 0.14% 88 29432 0.15% 89 31759 0.16% 90 38012 0.19% 91 45622 0.23% 92 39905 0.20% 93 42262 0.22% 94 47121 0.24% 95 50792 0.26% 96 54436 0.28% 97 58879 0.30% 98 63244 0.32% 99 68312 0.35% 100 73938 0.38% 101 79969 0.41% 102 87050 0.44% 103 94431 0.48% 104 102522 0.52% 105 109819 0.56% 106 118816 0.61% 107 126799 0.65% 108 135731 0.69% 109 147006 0.75% 110 159301 0.81% 111 171192 0.87% 112 188015 0.96% 113 205964 1.05% 114 227540 1.16% 115 250093 1.28% 116 277356 1.42% 117 312134 1.59% 118 358153 1.83% 119 417233 2.13% 120 502665 2.57% 121 628808 3.21% 122 826307 4.22% 123 1199929 6.12% 124 2171095 11.08% 125 6872928 35.07% 126 2869899 14.65% 19595235 reads passed initial QC criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=16 prefix-density=0.40 prefix-fanout=3.1 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=16.43 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.4 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.48 prefix-fanout=2.0 sequence=GTCCGCATCATCGGCTTCGACAACACCCGGCAGGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=28 fanout-score=166.46 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=16.7 sequence=AAGAAGAAGGTGCAGACCGAGTGCGCCTCCATGCCTTTCGATGACCAATGCGCCGTCTTGGAAAAGGAGGCCGTGAACGTGTCCCTCGAGAACCTCAAGACCTACCCGTTCGTCAAGGAAGGCGTCGCCAACGGAACCCTCAAGCTCGTGGGCGGC ERR1744553 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:40:19 Started mapping on | Dec 07 00:40:19 Finished on | Dec 07 00:41:40 Mapping speed, Million of reads per hour | 870.90 Number of input reads | 19595235 Average input read length | 241 UNIQUE READS: Uniquely mapped reads number | 18584797 Uniquely mapped reads % | 94.84% Average mapped length | 240.87 Number of splices: Total | 14179951 Number of splices: Annotated (sjdb) | 13156016 Number of splices: GT/AG | 13969521 Number of splices: GC/AG | 165653 Number of splices: AT/AC | 5575 Number of splices: Non-canonical | 39202 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.52 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 506280 % of reads mapped to multiple loci | 2.58% Number of reads mapped to too many loci | 43626 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.48% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 511516 511516 511516 N_multimapping 506280 506280 506280 N_noFeature 894327 17986859 1017887 N_ambiguous 532870 2275 59363 UnstrandedReadsAssigned:17157600 PositiveStrandReadsAssigned:595663 NegativeStrandReadsAssigned:17507547 Dataset is classified negative stranded MeadianReadLen=124 20thPercentileLength=114 echo kmer=109 ERR1744553 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744553-trimmed-pair1.fastq ERR1744553-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,595,235 reads, 17,601,531 reads pseudoaligned [quant] estimated average fragment length: 175.219 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52973 ERR1744553.ke.tsv 35125 ERR1744553.se.tsv 88098 total ==> ERR1744553.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 762.033 0 0 PNS24247 1044 869.781 64.2151 5.65645 PNS24249 1928 1753.78 86.2282 3.76696 PNS24246 1044 869.781 64.2151 5.65645 PNS24248 1044 869.781 64.2151 5.65645 PNS24244 1471 1296.78 283.127 16.7275 PNS24243 293 125.645 1 0.609776 KQK14069 1603 1428.78 2649.67 142.083 KQK14071 474 301.429 72.0475 18.3126 ==> ERR1744553.se.tsv <== BRADI_1g14170v3 3241 BRADI_1g53295v3 787 BRADI_1g59795v3 215 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 643 BRADI_1g74790v3 246 BRADI_1g09890v3 0 BRADI_1g77505v3 507 BRADI_1g48960v3 0 ERR1744553 completed mapping pipeline successfully