Starting /dee2/code/volunteer_pipeline.sh ERR1744554 current disk space = 1548306776064 free memory = 1600402800 ERR1744554 SRAfilesize d5e2e2ed724e16d9d6e15880ca7da61b ERR1744554.sra ERR1744554.sra file validated ERR1744554 is paired end ERR1744554 is conventional basespace ERR1744554 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744554_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07675 34.0 33.0 34.0 32.0 34.0 2 33.226 34.0 33.0 34.0 32.0 34.0 3 33.282 34.0 33.0 34.0 32.0 34.0 4 33.123 34.0 33.0 34.0 32.0 34.0 5 33.163 34.0 33.0 34.0 32.0 34.0 6 36.79125 38.0 37.0 38.0 34.0 38.0 7 37.18925 38.0 38.0 38.0 36.0 38.0 8 37.39925 38.0 38.0 38.0 37.0 38.0 9 37.37075 38.0 38.0 38.0 37.0 38.0 10-11 37.361125 38.0 38.0 38.0 37.0 38.0 12-13 37.334625 38.0 38.0 38.0 37.0 38.0 14-15 37.373875 38.0 38.0 38.0 37.0 38.0 16-17 37.31125 38.0 38.0 38.0 37.0 38.0 18-19 37.32425 38.0 38.0 38.0 37.0 38.0 20-21 37.29675 38.0 38.0 38.0 37.0 38.0 22-23 37.28675 38.0 38.0 38.0 37.0 38.0 24-25 37.29375 38.0 38.0 38.0 37.0 38.0 26-27 37.190375 38.0 38.0 38.0 36.5 38.0 28-29 37.126625000000004 38.0 38.0 38.0 36.0 38.0 30-31 37.08725 38.0 38.0 38.0 36.0 38.0 32-33 37.071375 38.0 38.0 38.0 36.0 38.0 34-35 36.978375 38.0 38.0 38.0 36.0 38.0 36-37 37.013625000000005 38.0 38.0 38.0 36.0 38.0 38-39 36.96962499999999 38.0 38.0 38.0 36.0 38.0 40-41 36.876999999999995 38.0 38.0 38.0 35.0 38.0 42-43 36.814 38.0 38.0 38.0 35.0 38.0 44-45 36.768625 38.0 38.0 38.0 35.0 38.0 46-47 36.552625 38.0 38.0 38.0 34.0 38.0 48-49 36.49225 38.0 38.0 38.0 34.0 38.0 50-51 36.29375 38.0 38.0 38.0 32.5 38.0 52-53 35.990375 38.0 37.0 38.0 31.5 38.0 54-55 35.79125 38.0 37.0 38.0 31.0 38.0 56-57 35.755375 38.0 37.0 38.0 31.0 38.0 58-59 35.140875 38.0 36.5 38.0 28.0 38.0 60-61 35.077875 38.0 36.5 38.0 29.0 38.0 62-63 35.019999999999996 38.0 36.5 38.0 27.5 38.0 64-65 34.61825 38.0 36.0 38.0 25.5 38.0 66-67 34.55325 38.0 36.0 38.0 25.5 38.0 68-69 34.36225 38.0 35.5 38.0 23.0 38.0 70-71 34.11175 38.0 34.5 38.0 23.0 38.0 72-73 33.651875000000004 38.0 34.0 38.0 21.0 38.0 74-75 33.327375 38.0 33.5 38.0 18.0 38.0 76-77 33.081375 38.0 33.0 38.0 16.5 38.0 78-79 32.896 38.0 33.0 38.0 15.0 38.0 80-81 32.123 38.0 31.0 38.0 14.0 38.0 82-83 31.676875 37.5 30.5 38.0 14.0 38.0 84-85 31.880875 38.0 30.5 38.0 14.0 38.0 86-87 31.24875 37.0 29.0 38.0 14.0 38.0 88-89 31.013375 37.0 29.0 38.0 13.5 38.0 90-91 30.396250000000002 36.5 27.5 38.0 11.5 38.0 92-93 29.9125 36.0 26.5 38.0 11.0 38.0 94-95 29.5875 36.0 25.5 38.0 11.0 38.0 96-97 29.753625 36.0 26.0 38.0 6.5 38.0 98-99 28.935625 35.5 23.5 38.0 2.0 38.0 100-101 28.256375 34.5 21.0 38.0 2.0 38.0 102-103 27.052124999999997 33.0 14.0 38.0 2.0 38.0 104-105 26.322375 33.0 14.0 38.0 2.0 38.0 106-107 26.377499999999998 33.0 14.0 38.0 2.0 38.0 108-109 25.89375 33.0 13.5 38.0 2.0 38.0 110-111 24.95675 31.0 12.5 38.0 2.0 38.0 112-113 24.24375 30.5 11.5 38.0 2.0 38.0 114-115 23.394375 29.5 6.5 37.5 2.0 38.0 116-117 22.42725 28.0 2.0 37.0 2.0 38.0 118-119 21.73275 27.5 2.0 36.5 2.0 38.0 120-121 20.77325 26.5 2.0 37.0 2.0 38.0 122-123 19.483 22.5 2.0 36.0 2.0 38.0 124-125 16.746000000000002 7.0 2.0 35.5 2.0 38.0 126 7.52125 2.0 2.0 2.0 2.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 2.0 12 6.0 13 6.0 14 9.0 15 19.0 16 27.0 17 31.0 18 42.0 19 43.0 20 38.0 21 38.0 22 41.0 23 57.0 24 71.0 25 70.0 26 82.0 27 95.0 28 124.0 29 130.0 30 145.0 31 209.0 32 290.0 33 361.0 34 451.0 35 609.0 36 723.0 37 279.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.517258629314654 6.3031515757878935 7.578789394697348 51.6008004002001 2 24.6 9.525 33.550000000000004 32.324999999999996 3 25.424999999999997 12.275 20.724999999999998 41.575 4 29.75 18.875 18.224999999999998 33.15 5 28.675 23.974999999999998 23.9 23.45 6 25.275 27.325 24.95 22.45 7 21.375 20.849999999999998 39.475 18.3 8 21.95 21.3 31.125000000000004 25.624999999999996 9 21.05 20.325 34.8 23.825 10-11 23.95 28.725 24.5125 22.8125 12-13 24.0625 23.0 26.9625 25.974999999999998 14-15 22.475 23.799999999999997 27.125 26.6 16-17 25.1 23.325000000000003 25.825 25.75 18-19 24.7875 23.5625 25.112499999999997 26.5375 20-21 25.025 23.9125 25.4 25.662499999999998 22-23 25.7875 24.337500000000002 24.8 25.074999999999996 24-25 23.9375 24.474999999999998 25.05 26.5375 26-27 25.2875 23.6375 25.174999999999997 25.900000000000002 28-29 25.087500000000002 23.3625 25.575 25.974999999999998 30-31 24.425 23.275000000000002 25.05 27.250000000000004 32-33 24.4875 23.400000000000002 26.2125 25.900000000000002 34-35 25.0125 24.125 24.9125 25.95 36-37 24.1625 23.8125 24.45 27.575 38-39 23.7125 25.0125 25.5375 25.7375 40-41 24.95 24.4875 24.8625 25.7 42-43 24.4 23.5875 25.5375 26.474999999999998 44-45 24.224999999999998 23.5625 26.150000000000002 26.0625 46-47 24.462500000000002 24.45 25.4625 25.624999999999996 48-49 23.9125 23.3375 25.412499999999998 27.3375 50-51 24.3875 23.575 26.137500000000003 25.900000000000002 52-53 23.962500000000002 25.324999999999996 23.8375 26.875 54-55 23.974999999999998 24.775 24.637500000000003 26.6125 56-57 24.3625 24.087500000000002 25.6125 25.937500000000004 58-59 23.801756587202007 24.140526976160604 25.53324968632371 26.524466750313675 60-61 24.685455460493205 23.905385002516354 24.748364368394565 26.660795168595875 62-63 24.37735849056604 23.89937106918239 25.710691823899374 26.0125786163522 64-65 23.44515642668677 23.935167734640032 25.99572810654605 26.62394773212715 66-67 24.670433145009415 23.414940364092907 25.411173885750156 26.50345260514752 68-69 24.805227444081428 24.302588590098015 24.491078160341793 26.401105805478764 70-71 24.647355163727962 24.093198992443323 25.730478589420652 25.52896725440806 72-73 25.14509210194297 23.2147363108756 24.930608125157708 26.709563462023723 74-75 24.270741255208993 22.805909837100643 26.543755524687462 26.379593383002902 76-77 24.498549262015896 24.662545729784284 24.448088810394854 26.390816197804973 78-79 24.63054187192118 23.342175066312997 25.236832133383857 26.790450928381965 80-81 23.264327190103508 24.95581923756627 25.39762686190356 26.38222671042666 82-83 24.222194231011464 23.819120796070035 26.3635218541378 25.5951631187807 84-85 24.375862501568186 23.7360431564421 25.668046669175766 26.22004767281395 86-87 24.655129169801857 23.99046902432907 25.5079006772009 25.84650112866817 88-89 25.3293187805796 23.39731526784594 24.714590390164346 26.558775561410116 90-91 25.206715108995237 24.46755199198196 23.477825106489604 26.8479077925332 92-93 24.849548645937812 24.32296890672016 25.062688064192578 25.764794383149447 94-95 25.22579026593076 23.908680381334673 24.73657802308078 26.128951329653788 96-97 24.357849893497054 23.768951259240698 24.971808044104748 26.901390803157497 98-99 24.25003137944019 24.024099410066523 24.68934354211121 27.036525668382076 100-101 24.717691342534504 24.07779171894605 24.755332496863236 26.44918444165621 102-103 25.583437892095358 24.316185696361355 24.705144291091592 25.395232120451695 104-105 25.249841872232764 24.19987349778621 24.920936116382038 25.629348513598988 106-107 24.958928345760143 24.89574118539113 24.921016049538732 25.224314419309994 108-109 25.756616436621506 23.46460681271369 25.009497277447128 25.769279473217676 110-111 24.714249428498857 24.371348742697485 24.358648717297434 26.555753111506224 112-113 24.860476915271434 24.403855910705225 24.759005580923386 25.976661593099948 114-115 24.917491749174918 24.397055090124397 24.435135821274436 26.25031733942625 116-117 25.012696800406296 24.31437277805993 25.063484002031487 25.609446419502284 118-119 25.758922901054238 24.031500063508194 24.387145941826496 25.822431093611076 120-121 25.069921179760996 25.222476481057715 23.60793287566743 26.09966946351386 122-123 25.64233019587891 24.5103027219537 23.848893411345713 25.998473670821674 124-125 25.948483694962572 24.793807892399442 24.67960918665144 24.57809922598655 126 29.38785877571755 19.812039624079247 23.698247396494793 27.10185420370841 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.0 23 2.0 24 2.0 25 1.5 26 2.0 27 3.5 28 4.5 29 5.5 30 8.5 31 12.0 32 13.5 33 19.0 34 22.5 35 36.0 36 50.0 37 58.5 38 67.0 39 76.0 40 101.5 41 131.0 42 152.5 43 154.5 44 167.5 45 186.5 46 177.0 47 172.5 48 177.0 49 167.0 50 157.0 51 142.0 52 121.5 53 113.5 54 109.5 55 94.0 56 86.5 57 78.5 58 73.0 59 86.0 60 86.5 61 78.5 62 72.0 63 74.5 64 73.0 65 68.0 66 77.0 67 81.0 68 73.5 69 56.5 70 40.0 71 33.0 72 32.5 73 33.5 74 26.5 75 20.0 76 12.0 77 6.5 78 8.5 79 7.5 80 3.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.375 60-61 0.65 62-63 0.625 64-65 0.5125000000000001 66-67 0.43750000000000006 68-69 0.525 70-71 0.75 72-73 0.9249999999999999 74-75 1.0125 76-77 0.9125 78-79 1.0375 80-81 0.975 82-83 0.7625 84-85 0.36250000000000004 86-87 0.325 88-89 0.36250000000000004 90-91 0.22499999999999998 92-93 0.3 94-95 0.35000000000000003 96-97 0.2375 98-99 0.41250000000000003 100-101 0.375 102-103 0.375 104-105 1.1875 106-107 1.0875 108-109 1.2874999999999999 110-111 1.575 112-113 1.4500000000000002 114-115 1.525 116-117 1.55 118-119 1.5875 120-121 1.675 122-123 1.725 124-125 1.4874999999999998 126 1.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.2875 0.0 0.0 0.0 0.0 102-103 1.5625 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.25 0.0 0.0 0.0 0.0 108-109 2.5875000000000004 0.0 0.0 0.0 0.0 110-111 3.05 0.0 0.0 0.0 0.0 112-113 3.6875 0.0 0.0 0.0 0.0 114 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744554 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744554_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.357 33.0 33.0 34.0 32.0 34.0 2 32.63825 33.0 33.0 34.0 32.0 34.0 3 32.65 34.0 33.0 34.0 32.0 34.0 4 32.69875 34.0 33.0 34.0 32.0 34.0 5 32.4995 34.0 33.0 34.0 31.0 34.0 6 36.42275 38.0 38.0 38.0 35.0 38.0 7 36.35625 38.0 38.0 38.0 35.0 38.0 8 36.331 38.0 38.0 38.0 35.0 38.0 9 36.12725 38.0 38.0 38.0 35.0 38.0 10-11 35.781000000000006 38.0 38.0 38.0 33.5 38.0 12-13 35.432874999999996 38.0 38.0 38.0 32.5 38.0 14-15 35.419124999999994 38.0 38.0 38.0 32.5 38.0 16-17 35.427375 38.0 38.0 38.0 33.0 38.0 18-19 35.301375 38.0 38.0 38.0 31.0 38.0 20-21 35.197 38.0 38.0 38.0 29.0 38.0 22-23 35.3005 38.0 38.0 38.0 31.0 38.0 24-25 35.4155 38.0 38.0 38.0 31.5 38.0 26-27 35.379000000000005 38.0 38.0 38.0 32.0 38.0 28-29 35.838125 38.0 38.0 38.0 31.5 38.0 30-31 36.028875 38.0 38.0 38.0 31.0 38.0 32-33 36.342 38.0 38.0 38.0 34.0 38.0 34-35 36.251625000000004 38.0 38.0 38.0 34.0 38.0 36-37 36.227875 38.0 38.0 38.0 34.0 38.0 38-39 36.17125 38.0 38.0 38.0 34.0 38.0 40-41 36.2735 38.0 38.0 38.0 34.0 38.0 42-43 36.230125 38.0 38.0 38.0 34.0 38.0 44-45 36.2665 38.0 38.0 38.0 34.0 38.0 46-47 36.117625000000004 38.0 38.0 38.0 33.5 38.0 48-49 35.961375000000004 38.0 38.0 38.0 33.0 38.0 50-51 35.715875 38.0 38.0 38.0 33.0 38.0 52-53 35.393 38.0 38.0 38.0 31.0 38.0 54-55 35.3815 38.0 38.0 38.0 30.5 38.0 56-57 35.315 38.0 38.0 38.0 31.0 38.0 58-59 35.245999999999995 38.0 37.5 38.0 29.0 38.0 60-61 35.09625 38.0 37.0 38.0 29.0 38.0 62-63 35.0895 38.0 37.0 38.0 29.0 38.0 64-65 34.69325 38.0 37.0 38.0 27.0 38.0 66-67 34.758375 38.0 37.0 38.0 27.0 38.0 68-69 34.587875 38.0 37.0 38.0 26.5 38.0 70-71 34.28175 38.0 36.5 38.0 24.5 38.0 72-73 34.152625 38.0 36.0 38.0 25.0 38.0 74-75 34.160375 38.0 36.0 38.0 24.0 38.0 76-77 33.953125 38.0 36.0 38.0 22.0 38.0 78-79 33.764125 38.0 35.0 38.0 20.5 38.0 80-81 33.457499999999996 38.0 34.0 38.0 18.5 38.0 82-83 33.27675 38.0 34.0 38.0 15.0 38.0 84-85 33.298625 38.0 34.0 38.0 16.0 38.0 86-87 33.351124999999996 38.0 34.0 38.0 16.5 38.0 88-89 33.105374999999995 38.0 34.0 38.0 14.0 38.0 90-91 32.63175 38.0 33.5 38.0 14.0 38.0 92-93 32.067375 38.0 33.0 38.0 13.0 38.0 94-95 31.877875000000003 38.0 32.5 38.0 12.5 38.0 96-97 31.696125000000002 38.0 31.0 38.0 12.0 38.0 98-99 31.71225 38.0 31.5 38.0 11.0 38.0 100-101 31.51225 38.0 31.0 38.0 11.5 38.0 102-103 31.397875 38.0 30.5 38.0 11.5 38.0 104-105 31.223125 38.0 30.0 38.0 11.0 38.0 106-107 30.976625 38.0 29.5 38.0 11.0 38.0 108-109 30.485 37.0 29.0 38.0 6.5 38.0 110-111 29.9695 36.5 27.0 38.0 2.0 38.0 112-113 29.2575 36.0 25.0 38.0 2.0 38.0 114-115 28.81275 36.0 23.0 38.0 2.0 38.0 116-117 28.84325 36.0 24.0 38.0 2.0 38.0 118-119 28.282125 36.0 22.5 38.0 2.0 38.0 120-121 27.56125 35.0 20.0 38.0 2.0 38.0 122-123 26.95225 35.0 15.5 38.0 2.0 38.0 124-125 24.991999999999997 34.5 2.0 38.0 2.0 38.0 126 12.20425 2.0 2.0 26.0 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 29.0 3 4.0 4 2.0 5 1.0 6 3.0 7 13.0 8 17.0 9 32.0 10 16.0 11 4.0 12 6.0 13 7.0 14 10.0 15 19.0 16 11.0 17 21.0 18 24.0 19 16.0 20 26.0 21 22.0 22 23.0 23 28.0 24 30.0 25 50.0 26 50.0 27 52.0 28 82.0 29 76.0 30 96.0 31 113.0 32 149.0 33 187.0 34 278.0 35 389.0 36 888.0 37 1226.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.802425467407783 15.38655886811521 13.971702880242548 41.83931278423446 2 28.975 20.575 29.675 20.775 3 23.103879849812266 24.60575719649562 26.23279098873592 26.057571964956196 4 25.6064016004001 29.257314328582147 19.254813703425857 25.881470367591895 5 27.6424805423048 30.102937484308313 20.612603565151897 21.641978408234998 6 22.157508229931626 34.26183844011142 20.562167637376554 23.018485692580402 7 21.782178217821784 18.075653719218078 34.2980451891343 25.844122873825842 8 23.47405900305188 21.770091556459818 24.38962360122075 30.366225839267546 9 23.098591549295776 21.69014084507042 28.52752880921895 26.68373879641485 10-11 25.309757356737222 27.026329375322668 21.3345379452762 26.32937532266391 12-13 24.960978147762745 22.06035379812695 25.6633714880333 27.315296566077002 14-15 24.707259953161593 24.889409315638826 24.91543065313557 25.487900078064012 16-17 25.452179570592065 24.86662329212752 23.890696161353286 25.790500975927134 18-19 25.390218522372525 24.97398543184183 23.998439125910508 25.63735691987513 20-21 24.612175726763134 25.57684786859601 23.843045235301787 25.96793116933907 22-23 24.8732284488363 24.76921076583019 25.15927707710311 25.198283708230402 24-25 25.65465387606948 24.669432201192638 23.606429867772878 26.069484054965 26-27 25.822389806267065 24.600182030945263 23.45598751787804 26.121440644909633 28-29 25.09868839933783 24.984082516235834 24.232777282567174 25.684451801859158 30-31 24.943339209267187 25.48476454293629 23.608662805338707 25.963233442457817 32-33 24.594900138173596 26.479085542017334 23.263409119457354 25.662605200351713 34-35 25.92964824120603 24.71105527638191 23.668341708542716 25.690954773869347 36-37 26.009024818250186 25.04387064427175 23.47706192028077 25.47004261719729 38-39 27.00601805416249 23.996990972918756 23.82146439317954 25.175526579739216 40-41 25.112951807228917 25.577309236947794 23.36847389558233 25.941265060240966 42-43 26.137500000000003 24.3125 23.325000000000003 26.224999999999998 44-45 27.343358395989974 25.087719298245613 23.170426065162907 24.398496240601503 46-47 26.450000000000003 24.337500000000002 24.0375 25.174999999999997 48-49 26.354337668897585 24.14446268468241 23.94241697183988 25.558782674580122 50-51 26.028793476876032 25.136960122308576 24.16868390877819 24.665562492037203 52-53 26.490150933742644 24.609874648247633 23.56101304681504 25.338961371194678 54-55 25.10811498346477 24.573899771050623 24.255914525566013 26.062070719918594 56-57 25.37485582468281 25.272331154684096 24.25990003844675 25.092912982186338 58-59 26.723033563925185 24.570842941327182 22.82859338970023 25.8775301050474 60-61 25.801487560913056 25.2885355219287 23.67273659912798 25.237240318030263 62-63 26.61103979460847 25.8408215661104 23.65853658536585 23.889602053915276 64-65 26.33808240277243 24.900526248235145 24.322936721858554 24.438454627133872 66-67 26.237942122186496 25.196141479099676 24.115755627009648 24.45016077170418 68-69 26.26639238878889 24.710722550784265 23.25790691694523 25.764978143481613 70-71 26.657190851531205 24.51221087995865 25.003230391523452 23.827367876986692 72-73 25.807697258334407 24.481915304414983 24.623503668425794 25.08688376882482 74-75 26.17579028527371 24.646620406065278 24.171164225134927 25.006425083526086 76-77 26.387474541751526 24.210794297352344 24.223523421588595 25.178207739307535 78-79 26.115370114364712 24.569561392484605 23.652130199824054 25.662938293326633 80-81 26.083688298672016 25.21924329741919 23.978952643447755 24.71811576046104 82-83 27.76104417670683 24.887048192771086 22.640562248995984 24.711345381526105 84-85 26.92937177388896 24.62545637668387 24.436610852322797 24.008560997104368 86-87 26.926977687626774 24.213995943204868 24.429513184584177 24.429513184584177 88-89 26.495836002562463 24.292120435618195 23.959000640614992 25.253042921204354 90-91 26.71047545419405 24.107718077567323 24.107718077567323 25.074088390671307 92-93 26.223142635257574 24.255759772197774 24.191043230649754 25.3300543618949 94-95 26.816586507214353 23.722864942155205 24.450799428051475 25.009749122578967 96-97 26.202450032237266 24.977433913604127 24.66795615731786 24.152159896840747 98-99 26.549586776859503 24.6900826446281 23.863636363636363 24.89669421487603 100-101 27.584881486226777 25.112107623318387 22.93401665598975 24.368994234465085 102-103 27.132080296637255 25.13745045390615 23.590333716915996 24.140135532540597 104-105 27.470279943755592 24.8114534066215 24.210660871788317 23.507605777834588 106-107 27.041465276011195 24.357669804121088 23.937929280081406 24.662935639786312 108-109 27.09603658536585 24.466463414634145 24.30132113821138 24.13617886178862 110-111 27.10054658700902 24.81250794457862 23.096478962755814 24.99046650565654 112-113 26.98110815265627 25.32014707746925 24.02687967541524 23.67186509445924 114-115 27.069096431283217 25.17084282460137 23.538344722854973 24.221716021260438 116-117 27.720894956389834 24.838832006067502 23.271394261155354 24.16887877638731 118-119 27.822120866590648 25.123527175978715 22.5769669327252 24.477385024705438 120-121 26.69021190716448 25.84510595358224 23.234106962663976 24.2305751765893 122-123 26.88738399799348 25.457737647353902 23.325808878856282 24.329069475796338 124-125 27.77568686488521 24.890227073140135 23.146405720737672 24.187680341236984 126 29.831191735953638 22.70093222474175 22.297808012093725 25.170068027210885 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 1.5 4 2.5 5 2.5 6 4.0 7 3.0 8 2.0 9 2.0 10 1.5 11 1.0 12 0.5 13 2.0 14 2.5 15 5.5 16 8.5 17 6.5 18 4.5 19 4.5 20 6.0 21 7.0 22 6.5 23 4.0 24 4.0 25 6.0 26 8.0 27 8.5 28 8.5 29 9.5 30 10.5 31 13.0 32 15.5 33 23.0 34 29.5 35 34.0 36 43.5 37 51.5 38 66.5 39 87.0 40 111.5 41 136.0 42 145.5 43 157.0 44 170.0 45 163.5 46 156.5 47 157.0 48 166.0 49 154.5 50 123.0 51 115.0 52 104.5 53 94.0 54 96.5 55 99.0 56 96.0 57 94.0 58 99.0 59 83.0 60 80.5 61 92.0 62 82.0 63 75.5 64 77.5 65 75.0 66 72.5 67 73.5 68 67.5 69 52.0 70 46.5 71 48.5 72 38.0 73 28.5 74 20.5 75 16.0 76 14.5 77 8.0 78 5.0 79 4.5 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.125 4 0.025 5 0.42500000000000004 6 1.275 7 1.525 8 1.7000000000000002 9 2.375 10-11 3.15 12-13 3.9 14-15 3.925 16-17 3.9375 18-19 3.9 20-21 4.1125 22-23 3.8625 24-25 3.5749999999999997 26-27 3.8625 28-29 1.8375 30-31 0.7250000000000001 32-33 0.4875 34-35 0.5 36-37 0.27499999999999997 38-39 0.3 40-41 0.4 42-43 0.0 44-45 0.25 46-47 0.0 48-49 1.0125 50-51 1.8875 52-53 2.275 54-55 1.725 56-57 2.4625 58-59 2.4250000000000003 60-61 2.5250000000000004 62-63 2.625 64-65 2.6125 66-67 2.8125 68-69 2.775 70-71 3.2625 72-73 2.8875 74-75 2.725 76-77 1.7999999999999998 78-79 0.5375 80-81 0.22499999999999998 82-83 0.4 84-85 0.7125 86-87 1.4000000000000001 88-89 2.4375 90-91 2.9875 92-93 3.4250000000000003 94-95 3.8375 96-97 3.0625 98-99 3.2 100-101 2.4375 102-103 2.2375 104-105 2.2125 106-107 1.725 108-109 1.6 110-111 1.6625 112-113 1.4125 114-115 1.225 116-117 1.1125 118-119 1.3375 120-121 0.8999999999999999 122-123 0.325 124-125 0.36250000000000004 126 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31869795609387 98.4 2 0.5299015897047691 1.05 3 0.10093363613424174 0.3 4 0.0 0.0 5 0.05046681806712087 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT 5 0.125 No Hit GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.2125 0.0 0.0 0.0 0.0 102-103 1.5 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.225 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 3.125 0.0 0.0 0.0 0.0 112-113 3.8125 0.0 0.0 0.0 0.0 114 4.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955184 spots for ERR1744554.sra Written 955184 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra Read 955170 spots for ERR1744554.sra Written 955170 spots for ERR1744554.sra SRR ids: ['ERR1744554.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n23knfvu ERR1744554.sra spots: 19103414 blocks: [[1, 955170], [955171, 1910340], [1910341, 2865510], [2865511, 3820680], [3820681, 4775850], [4775851, 5731020], [5731021, 6686190], [6686191, 7641360], [7641361, 8596530], [8596531, 9551700], [9551701, 10506870], [10506871, 11462040], [11462041, 12417210], [12417211, 13372380], [13372381, 14327550], [14327551, 15282720], [15282721, 16237890], [16237891, 17193060], [17193061, 18148230], [18148231, 19103414]] ERR1744554 file size 5519035 ERR1744554 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744554 ERR1744554_1.fastq ERR1744554_2.fastq Input file: ERR1744554_1.fastq Paired file: ERR1744554_2.fastq trimmed: ERR1744554-trimmed-pair1.fastq, ERR1744554-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:38:30 2024 >> started Sat Dec 7 00:38:48 2024 >> done (18.514s) 19103414 read pairs processed; of these: 21221 ( 0.11%) short read pairs filtered out after trimming by size control 21822 ( 0.11%) empty read pairs filtered out after trimming by size control 19060371 (99.77%) read pairs available; of these: 16605604 (87.12%) trimmed read pairs available after processing 2454767 (12.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 17 0.00% 20 17 0.00% 21 28 0.00% 22 20 0.00% 23 28 0.00% 24 32 0.00% 25 42 0.00% 26 67 0.00% 27 61 0.00% 28 75 0.00% 29 89 0.00% 30 110 0.00% 31 118 0.00% 32 168 0.00% 33 171 0.00% 34 197 0.00% 35 253 0.00% 36 281 0.00% 37 322 0.00% 38 417 0.00% 39 516 0.00% 40 568 0.00% 41 684 0.00% 42 814 0.00% 43 920 0.00% 44 964 0.01% 45 1116 0.01% 46 1253 0.01% 47 1417 0.01% 48 1515 0.01% 49 1697 0.01% 50 1862 0.01% 51 2021 0.01% 52 2351 0.01% 53 2549 0.01% 54 2779 0.01% 55 3044 0.02% 56 3275 0.02% 57 3636 0.02% 58 4019 0.02% 59 4411 0.02% 60 4857 0.03% 61 5228 0.03% 62 5867 0.03% 63 6294 0.03% 64 6947 0.04% 65 7667 0.04% 66 8413 0.04% 67 9539 0.05% 68 10479 0.05% 69 12686 0.07% 70 12107 0.06% 71 12720 0.07% 72 13934 0.07% 73 15121 0.08% 74 16202 0.09% 75 17092 0.09% 76 18437 0.10% 77 19833 0.10% 78 20720 0.11% 79 21835 0.11% 80 23268 0.12% 81 24989 0.13% 82 26352 0.14% 83 28373 0.15% 84 30385 0.16% 85 32294 0.17% 86 35130 0.18% 87 38136 0.20% 88 39817 0.21% 89 43076 0.23% 90 49408 0.26% 91 55865 0.29% 92 51055 0.27% 93 53720 0.28% 94 58359 0.31% 95 62083 0.33% 96 65777 0.35% 97 71513 0.38% 98 75942 0.40% 99 80696 0.42% 100 87107 0.46% 101 93598 0.49% 102 99960 0.52% 103 107682 0.56% 104 116279 0.61% 105 124153 0.65% 106 133913 0.70% 107 142194 0.75% 108 152505 0.80% 109 164251 0.86% 110 177668 0.93% 111 190916 1.00% 112 209644 1.10% 113 229555 1.20% 114 252178 1.32% 115 275430 1.45% 116 304893 1.60% 117 343403 1.80% 118 393555 2.06% 119 456659 2.40% 120 543759 2.85% 121 669115 3.51% 122 857847 4.50% 123 1204120 6.32% 124 2073692 10.88% 125 5965375 31.30% 126 2454767 12.88% 19060371 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.41 fanout-score-rank=31 prefix-density=0.28 prefix-fanout=2.1 sequence=CCAGTCTCCCTGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=265.97 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=29.9 sequence=CTTCTTCTTGTC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=33 prefix-density=0.50 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=334.76 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=11.6 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTT ERR1744554 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:39:28 Started mapping on | Dec 07 00:39:28 Finished on | Dec 07 00:41:09 Mapping speed, Million of reads per hour | 679.38 Number of input reads | 19060371 Average input read length | 238 UNIQUE READS: Uniquely mapped reads number | 18086579 Uniquely mapped reads % | 94.89% Average mapped length | 238.38 Number of splices: Total | 15296628 Number of splices: Annotated (sjdb) | 14125235 Number of splices: GT/AG | 15063440 Number of splices: GC/AG | 184213 Number of splices: AT/AC | 6723 Number of splices: Non-canonical | 42252 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.81 Insertion rate per base | 0.02% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430228 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 37297 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.77% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 554504 554504 554504 N_multimapping 430228 430228 430228 N_noFeature 919684 17618570 1062515 N_ambiguous 388346 2894 62957 UnstrandedReadsAssigned:16778549 PositiveStrandReadsAssigned:465115 NegativeStrandReadsAssigned:16961107 Dataset is classified negative stranded MeadianReadLen=123 20thPercentileLength=109 echo kmer=105 ERR1744554 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744554-trimmed-pair1.fastq ERR1744554-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,060,371 reads, 17,082,707 reads pseudoaligned [quant] estimated average fragment length: 213.652 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,245 rounds 52973 ERR1744554.ke.tsv 35125 ERR1744554.se.tsv 88098 total ==> ERR1744554.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 723.888 0 0 PNS24247 1044 831.348 79.8387 8.41779 PNS24249 1928 1715.35 206.707 10.5626 PNS24246 1044 831.348 79.8387 8.41779 PNS24248 1044 831.348 79.8387 8.41779 PNS24244 1471 1258.35 60.777 4.23356 PNS24243 293 113.36 0 0 KQK14069 1603 1390.35 7753.08 488.785 KQK14071 474 270.077 308.437 100.103 ==> ERR1744554.se.tsv <== BRADI_1g14170v3 9455 BRADI_1g53295v3 1187 BRADI_1g59795v3 223 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 540 BRADI_1g74790v3 281 BRADI_1g09890v3 0 BRADI_1g77505v3 268 BRADI_1g48960v3 0 ERR1744554 completed mapping pipeline successfully