Starting /dee2/code/volunteer_pipeline.sh ERR1744555 current disk space = 1548306317312 free memory = 1598158964 ERR1744555 SRAfilesize f05917156b7c1fe3dc8c46b9907faa98 ERR1744555.sra ERR1744555.sra file validated ERR1744555 is paired end ERR1744555 is conventional basespace ERR1744555 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744555_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.49525 18.0 18.0 25.0 18.0 32.0 2 29.78075 30.0 29.0 31.0 27.0 33.0 3 31.0635 31.0 31.0 33.0 29.0 33.0 4 29.95575 31.0 29.0 33.0 27.0 33.0 5 31.968 33.0 31.0 33.0 30.0 33.0 6 35.033 37.0 34.0 38.0 29.0 38.0 7 36.06025 38.0 36.0 38.0 33.0 38.0 8 36.721 38.0 37.0 38.0 34.0 38.0 9 37.071 38.0 38.0 38.0 36.0 38.0 10-11 37.23950000000001 38.0 38.0 38.0 36.0 38.0 12-13 37.347125 38.0 38.0 38.0 37.0 38.0 14-15 37.388374999999996 38.0 38.0 38.0 36.5 38.0 16-17 37.334 38.0 38.0 38.0 37.0 38.0 18-19 37.378 38.0 38.0 38.0 37.0 38.0 20-21 37.449625 38.0 38.0 38.0 37.0 38.0 22-23 37.44775 38.0 38.0 38.0 37.0 38.0 24-25 37.460375 38.0 38.0 38.0 37.0 38.0 26-27 37.39425 38.0 38.0 38.0 37.0 38.0 28-29 37.416624999999996 38.0 38.0 38.0 37.0 38.0 30-31 37.418875 38.0 38.0 38.0 37.0 38.0 32-33 37.42425 38.0 38.0 38.0 37.0 38.0 34-35 37.323 38.0 38.0 38.0 37.0 38.0 36-37 37.34125 38.0 38.0 38.0 37.0 38.0 38-39 37.28475 38.0 38.0 38.0 36.5 38.0 40-41 37.197500000000005 38.0 38.0 38.0 36.5 38.0 42-43 37.253125 38.0 38.0 38.0 36.5 38.0 44-45 37.194375 38.0 38.0 38.0 36.5 38.0 46-47 37.229875 38.0 38.0 38.0 37.0 38.0 48-49 37.14825 38.0 38.0 38.0 36.5 38.0 50-51 37.117374999999996 38.0 38.0 38.0 36.0 38.0 52-53 37.042375 38.0 38.0 38.0 36.0 38.0 54-55 36.983 38.0 38.0 38.0 36.0 38.0 56-57 36.91875 38.0 38.0 38.0 36.0 38.0 58-59 36.819375 38.0 38.0 38.0 35.0 38.0 60-61 36.748999999999995 38.0 38.0 38.0 35.0 38.0 62-63 36.7725 38.0 38.0 38.0 35.0 38.0 64-65 36.66 38.0 38.0 38.0 34.5 38.0 66-67 36.712875 38.0 38.0 38.0 34.5 38.0 68-69 36.676 38.0 38.0 38.0 34.5 38.0 70-71 36.523250000000004 38.0 38.0 38.0 34.0 38.0 72-73 36.572125 38.0 38.0 38.0 34.0 38.0 74-75 36.476 38.0 38.0 38.0 34.0 38.0 76-77 36.4225 38.0 38.0 38.0 34.0 38.0 78-79 36.123125 38.0 37.0 38.0 32.5 38.0 80-81 35.932625 38.0 37.0 38.0 32.0 38.0 82-83 35.957875 38.0 37.0 38.0 31.5 38.0 84-85 36.032250000000005 38.0 37.0 38.0 32.0 38.0 86-87 36.0225 38.0 37.0 38.0 32.5 38.0 88-89 35.770375 38.0 37.0 38.0 31.0 38.0 90-91 35.557375 38.0 37.0 38.0 30.0 38.0 92-93 35.385125 38.0 37.0 38.0 29.5 38.0 94-95 35.12475 38.0 36.0 38.0 29.0 38.0 96-97 34.940375 38.0 36.0 38.0 28.0 38.0 98-99 34.89275 38.0 36.0 38.0 27.5 38.0 100-101 34.9135 38.0 36.0 38.0 28.0 38.0 102-103 34.716499999999996 38.0 35.5 38.0 27.0 38.0 104-105 34.29175 38.0 34.0 38.0 25.0 38.0 106-107 34.29325 38.0 34.0 38.0 25.5 38.0 108-109 34.108125 38.0 34.0 38.0 24.0 38.0 110-111 33.967375000000004 38.0 34.0 38.0 24.0 38.0 112-113 34.0565 38.0 34.0 38.0 24.0 38.0 114-115 33.743 38.0 34.0 38.0 22.0 38.0 116-117 32.78425 38.0 33.0 38.0 16.0 38.0 118-119 32.75825 38.0 33.0 38.0 16.0 38.0 120-121 32.60575 38.0 33.0 38.0 14.0 38.0 122-123 31.69525 38.0 32.0 38.0 7.0 38.0 124-125 30.525875 38.0 31.0 38.0 2.0 38.0 126 17.60575 20.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 3.0 9 1.0 10 2.0 11 1.0 12 0.0 13 2.0 14 1.0 15 0.0 16 2.0 17 2.0 18 1.0 19 6.0 20 0.0 21 7.0 22 9.0 23 7.0 24 13.0 25 12.0 26 28.0 27 21.0 28 49.0 29 44.0 30 59.0 31 79.0 32 122.0 33 158.0 34 297.0 35 478.0 36 1149.0 37 1446.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.143571785892945 13.881940970485243 10.130065032516258 38.84442221110555 2 22.625 18.75 37.35 21.275 3 19.8 25.324999999999996 25.775 29.099999999999998 4 26.424999999999997 29.45 22.400000000000002 21.725 5 25.1 33.625 22.825 18.45 6 19.400000000000002 32.725 24.45 23.425 7 17.825 20.424999999999997 41.325 20.424999999999997 8 19.0 21.099999999999998 30.0 29.9 9 19.45 21.2 32.65 26.700000000000003 10-11 24.212500000000002 29.262500000000003 21.8625 24.6625 12-13 23.625 22.900000000000002 25.900000000000002 27.575 14-15 22.6125 25.124999999999996 26.5 25.7625 16-17 23.9125 25.45 25.2 25.4375 18-19 23.1625 24.975 25.7 26.1625 20-21 23.5 26.237500000000004 24.9125 25.35 22-23 23.4375 25.374999999999996 25.937500000000004 25.25 24-25 22.725 25.2875 26.125 25.8625 26-27 22.162499999999998 26.174999999999997 25.8125 25.85 28-29 22.8875 26.2125 25.3125 25.587500000000002 30-31 23.2875 25.837500000000002 25.074999999999996 25.8 32-33 22.5875 25.7625 26.0375 25.6125 34-35 23.6375 25.362499999999997 25.637500000000003 25.362499999999997 36-37 22.5625 26.400000000000002 25.124999999999996 25.912499999999998 38-39 23.3125 25.6125 25.674999999999997 25.4 40-41 23.6625 26.737499999999997 24.025 25.575 42-43 23.2625 25.912499999999998 25.324999999999996 25.5 44-45 23.525 25.7 25.087500000000002 25.687500000000004 46-47 22.5125 27.0125 25.724999999999998 24.75 48-49 23.5375 26.075 24.962500000000002 25.424999999999997 50-51 21.637500000000003 25.575 26.25 26.5375 52-53 23.5625 25.8625 25.087500000000002 25.4875 54-55 22.6375 25.137500000000003 25.687500000000004 26.5375 56-57 23.1875 26.25 24.925 25.637500000000003 58-59 22.975 25.9625 24.5625 26.5 60-61 23.8625 24.9 25.4 25.837500000000002 62-63 23.599999999999998 24.825 25.825 25.75 64-65 24.05 25.35 25.1 25.5 66-67 22.875 25.674999999999997 24.7875 26.6625 68-69 23.575 24.887500000000003 25.7625 25.775 70-71 24.125 25.2875 25.2375 25.35 72-73 23.225 25.5125 25.162499999999998 26.1 74-75 24.0375 25.674999999999997 25.525 24.762500000000003 76-77 23.175 25.637500000000003 25.687500000000004 25.5 78-79 24.2375 25.85 25.05 24.8625 80-81 24.05 25.25 25.95 24.75 82-83 23.75 25.624999999999996 25.9875 24.637500000000003 84-85 23.2875 25.2 25.362499999999997 26.150000000000002 86-87 22.6 26.575 25.4375 25.387500000000003 88-89 24.071526822558457 24.73427535325747 25.38451919469801 25.809678629486054 90-91 23.5 25.837500000000002 24.837500000000002 25.825 92-93 23.9 26.187500000000004 25.112499999999997 24.8 94-95 23.4375 26.3625 24.5375 25.662499999999998 96-97 23.825 26.487500000000004 23.9125 25.775 98-99 24.0 25.8 24.6125 25.587500000000002 100-101 24.4125 27.400000000000002 23.8125 24.375 102-103 24.1125 26.875 23.8125 25.2 104-105 22.875 26.825 24.2375 26.0625 106-107 24.559209703638864 26.647492809803673 23.921470551456796 24.871826935100664 108-109 24.5375 25.8 24.4 25.2625 110-111 23.9375 27.0125 23.8125 25.2375 112-113 24.418313735301474 26.619964973730298 23.329997498123593 25.631723792844635 114-115 24.243560890222557 26.39409852463116 23.455863965991497 25.906476619154787 116-117 24.771789421032885 26.39739902463424 24.246592472177067 24.58421908215581 118-119 23.9 26.575 23.2125 26.3125 120-121 24.375 26.5375 23.4125 25.674999999999997 122-123 23.7 26.400000000000002 24.9 25.0 124-125 23.674999999999997 26.437500000000004 23.2125 26.674999999999997 126 25.0 24.25 25.174999999999997 25.575 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.0 26 3.0 27 4.5 28 5.0 29 9.0 30 13.0 31 16.0 32 21.0 33 27.5 34 35.5 35 48.5 36 58.0 37 73.5 38 95.0 39 108.5 40 132.5 41 156.5 42 174.0 43 188.0 44 195.5 45 199.0 46 184.5 47 178.5 48 177.0 49 162.5 50 160.0 51 150.5 52 128.0 53 105.0 54 90.5 55 85.0 56 78.5 57 69.5 58 70.5 59 77.5 60 74.0 61 71.5 62 69.0 63 58.0 64 54.0 65 55.5 66 49.5 67 49.5 68 45.5 69 37.0 70 34.0 71 31.0 72 24.0 73 17.0 74 15.0 75 9.0 76 5.0 77 4.0 78 3.0 79 2.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0375 108-109 0.0 110-111 0.0 112-113 0.075 114-115 0.025 116-117 0.0375 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64841788046208 99.2 2 0.2762430939226519 0.5499999999999999 3 0.05022601707684581 0.15 4 0.025113008538422906 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.775 0.0 0.0 0.0 0.0 78-79 1.025 0.0 0.0 0.0 0.0 80-81 1.375 0.0 0.0 0.0 0.0 82-83 1.725 0.0 0.0 0.0 0.0 84-85 2.0875 0.0 0.0 0.0 0.0 86-87 2.5999999999999996 0.0 0.0 0.0 0.0 88-89 3.0625 0.0 0.0 0.0 0.0 90-91 3.6625 0.0 0.0 0.0 0.0 92-93 4.3375 0.0 0.0 0.0 0.0 94-95 4.8125 0.0 0.0 0.0 0.0 96-97 5.6 0.0 0.0 0.0 0.0 98-99 6.375 0.0 0.0 0.0 0.0 100-101 7.1125 0.0 0.0 0.0 0.0 102-103 7.8 0.0 0.0 0.0 0.0 104-105 8.649999999999999 0.0 0.0 0.0 0.0 106-107 9.675 0.0 0.0 0.0 0.0 108-109 10.6125 0.0 0.0 0.0 0.0 110-111 11.5 0.0 0.0 0.0 0.0 112-113 12.6375 0.0 0.0 0.0 0.0 114 13.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744555 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744555_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.94775 34.0 33.0 34.0 33.0 34.0 2 33.1495 34.0 33.0 34.0 33.0 34.0 3 33.155 34.0 33.0 34.0 33.0 34.0 4 33.21425 34.0 33.0 34.0 33.0 34.0 5 33.228 34.0 33.0 34.0 33.0 34.0 6 37.229 38.0 38.0 38.0 37.0 38.0 7 37.1925 38.0 38.0 38.0 38.0 38.0 8 36.979 38.0 38.0 38.0 37.0 38.0 9 37.1925 38.0 38.0 38.0 38.0 38.0 10-11 37.2715 38.0 38.0 38.0 37.5 38.0 12-13 37.308375 38.0 38.0 38.0 38.0 38.0 14-15 37.350375 38.0 38.0 38.0 38.0 38.0 16-17 37.28875 38.0 38.0 38.0 38.0 38.0 18-19 37.239125 38.0 38.0 38.0 37.5 38.0 20-21 37.2615 38.0 38.0 38.0 37.5 38.0 22-23 37.245999999999995 38.0 38.0 38.0 37.0 38.0 24-25 37.2645 38.0 38.0 38.0 37.5 38.0 26-27 37.268625 38.0 38.0 38.0 37.0 38.0 28-29 37.144625 38.0 38.0 38.0 37.0 38.0 30-31 37.097625 38.0 38.0 38.0 37.0 38.0 32-33 37.176500000000004 38.0 38.0 38.0 37.0 38.0 34-35 37.153000000000006 38.0 38.0 38.0 37.0 38.0 36-37 36.68075 38.0 38.0 38.0 37.0 38.0 38-39 36.757374999999996 38.0 38.0 38.0 37.0 38.0 40-41 36.625875 38.0 38.0 38.0 37.0 38.0 42-43 36.586 38.0 38.0 38.0 37.0 38.0 44-45 36.554249999999996 38.0 38.0 38.0 37.0 38.0 46-47 36.697625 38.0 38.0 38.0 36.5 38.0 48-49 36.8535 38.0 38.0 38.0 36.0 38.0 50-51 36.620999999999995 38.0 38.0 38.0 36.5 38.0 52-53 36.4785 38.0 38.0 38.0 36.0 38.0 54-55 36.552375 38.0 38.0 38.0 36.0 38.0 56-57 36.677375 38.0 38.0 38.0 36.0 38.0 58-59 36.8335 38.0 38.0 38.0 36.0 38.0 60-61 36.915125 38.0 38.0 38.0 36.0 38.0 62-63 36.911375 38.0 38.0 38.0 36.0 38.0 64-65 36.809375 38.0 38.0 38.0 36.0 38.0 66-67 36.836749999999995 38.0 38.0 38.0 36.0 38.0 68-69 36.752250000000004 38.0 38.0 38.0 36.0 38.0 70-71 36.725875 38.0 38.0 38.0 36.0 38.0 72-73 36.719875 38.0 38.0 38.0 35.0 38.0 74-75 36.706625 38.0 38.0 38.0 35.5 38.0 76-77 36.582499999999996 38.0 38.0 38.0 35.0 38.0 78-79 36.675 38.0 38.0 38.0 35.0 38.0 80-81 36.566874999999996 38.0 38.0 38.0 35.0 38.0 82-83 36.419624999999996 38.0 38.0 38.0 34.5 38.0 84-85 36.389 38.0 38.0 38.0 34.0 38.0 86-87 36.38675 38.0 38.0 38.0 33.5 38.0 88-89 36.249625 38.0 38.0 38.0 33.0 38.0 90-91 36.28 38.0 38.0 38.0 33.5 38.0 92-93 36.111625000000004 38.0 38.0 38.0 33.0 38.0 94-95 35.94125 38.0 38.0 38.0 33.0 38.0 96-97 35.634874999999994 38.0 38.0 38.0 31.0 38.0 98-99 35.652249999999995 38.0 38.0 38.0 31.0 38.0 100-101 35.473 38.0 37.0 38.0 30.5 38.0 102-103 35.452375 38.0 37.5 38.0 30.0 38.0 104-105 35.21025 38.0 37.0 38.0 29.0 38.0 106-107 35.013625000000005 38.0 37.0 38.0 28.0 38.0 108-109 34.84675 38.0 36.0 38.0 28.0 38.0 110-111 34.95525 38.0 36.5 38.0 28.0 38.0 112-113 34.73375 38.0 36.0 38.0 27.5 38.0 114-115 34.635374999999996 38.0 36.0 38.0 27.0 38.0 116-117 34.5325 38.0 36.0 38.0 26.0 38.0 118-119 34.012875 38.0 35.0 38.0 24.0 38.0 120-121 34.175375 38.0 36.0 38.0 26.0 38.0 122-123 33.445499999999996 38.0 34.5 38.0 19.5 38.0 124-125 32.5495 38.0 33.5 38.0 7.5 38.0 126 21.367 28.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 3.0 4 3.0 5 3.0 6 1.0 7 0.0 8 1.0 9 2.0 10 2.0 11 2.0 12 2.0 13 6.0 14 0.0 15 4.0 16 4.0 17 4.0 18 5.0 19 8.0 20 4.0 21 5.0 22 11.0 23 10.0 24 10.0 25 11.0 26 20.0 27 20.0 28 16.0 29 34.0 30 37.0 31 53.0 32 75.0 33 116.0 34 166.0 35 255.0 36 605.0 37 2496.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.42138364779874 19.52201257861635 8.855345911949685 32.20125786163522 2 28.575 22.875 32.75 15.8 3 22.6 25.55 28.675 23.175 4 27.6 31.5 19.1 21.8 5 27.075 34.275 18.525 20.125 6 19.934804413239718 35.60682046138415 21.213640922768302 23.244734202607823 7 21.433962264150942 16.57861635220126 39.57232704402516 22.41509433962264 8 22.59043764229699 19.655957500632432 27.09334682519605 30.660258031874527 9 22.895199798944457 21.186227695400856 27.117366172405127 28.801206333249564 10-11 26.012285320295852 27.842547323555223 21.022940955246334 25.122226400902598 12-13 26.131532883220803 21.61790447611903 24.55613903475869 27.694423605901473 14-15 24.5311327831958 25.081270317579396 25.44386096524131 24.943735933983497 16-17 25.42224446390592 25.409733516827227 23.94595270862004 25.222069310646816 18-19 25.331332833208304 25.84396099024756 23.905976494123532 24.918729682420604 20-21 25.275 25.074999999999996 25.387500000000003 24.2625 22-23 24.940587867417136 25.265791119449656 25.7661038148843 24.027517198248905 24-25 25.91573946743343 25.353169146143266 23.75296912114014 24.978122265283158 26-27 24.809112529728377 25.322318187507825 25.547627988484166 24.320941294279635 28-29 24.90277255049555 25.191318529670053 25.46731903148915 24.438589888345252 30-31 24.761665830406425 25.301053687907675 25.35122930255896 24.586051179126944 32-33 25.55485893416928 25.454545454545453 24.990595611285265 24.0 34-35 25.793501442729895 25.944047170994857 24.55149918454397 23.710952201731274 36-37 25.25406504065041 25.215955284552845 24.415650406504067 25.114329268292686 38-39 25.730550284629985 26.12270714737508 24.60468058191018 23.542061986084757 40-41 25.454545454545453 24.717101080737443 24.780673871582962 25.047679593134138 42-43 24.697644812221515 25.665181413112663 25.52514322087842 24.1120305537874 44-45 25.81795035009548 25.60152768936983 24.863144493952895 23.717377466581794 46-47 25.934815563415864 24.911571500757958 24.658918645780698 24.494694290045476 48-49 25.920804525455686 24.965430546825896 24.26147077309868 24.852294154619734 50-51 25.684931506849317 25.266362252663622 24.69558599695586 24.3531202435312 52-53 26.401217347197566 25.082424549835153 23.01547045396906 25.500887648998226 54-55 25.992414664981034 24.968394437420987 25.195954487989887 23.84323640960809 56-57 25.1411366202484 24.99059089198344 25.10350018818216 24.764772299586 58-59 26.086412022542266 25.610519724483403 23.74452097683156 24.558547276142768 60-61 26.724999999999998 25.337500000000002 24.349999999999998 23.5875 62-63 26.10708031023267 25.344008006004504 24.618463847885916 23.930447835876908 64-65 25.93010146561443 25.316297131404237 24.91544532130778 23.838156081673556 66-67 24.87468671679198 24.598997493734338 25.71428571428571 24.81203007518797 68-69 25.818181818181817 24.38871473354232 25.880877742946705 23.912225705329153 70-71 24.90911370189294 25.159834524257242 25.03447411307509 24.896577660774728 72-73 25.613113113113112 24.44944944944945 26.063563563563562 23.873873873873876 74-75 25.594493116395494 24.84355444305382 24.993742177722154 24.568210262828536 76-77 25.798772083698786 25.81130184187445 24.29520110261872 24.09472497180804 78-79 25.966712551620574 24.702790639469402 25.391064948066578 23.93943186084345 80-81 25.22826766729206 25.428392745465917 26.241400875547217 23.101938711694807 82-83 26.19732399649869 25.259472302113295 25.472052019507313 23.071151681880707 84-85 26.184819307240215 24.78429411029136 25.472052019507313 23.558834562961113 86-87 25.85 26.1 24.5625 23.4875 88-89 26.3 25.05 24.9875 23.6625 90-91 26.28485682130799 25.28448168063024 24.096536201075402 24.334125296986368 92-93 26.1125 26.5125 24.4 22.975 94-95 27.05 24.675 25.124999999999996 23.150000000000002 96-97 26.827127992979815 25.849316785759058 24.18202331703648 23.141531904224646 98-99 26.125 25.7375 25.25 22.8875 100-101 27.325 25.4875 24.25 22.9375 102-103 27.267041901188243 25.728580362726706 24.352720450281424 22.65165728580363 104-105 26.854636591478698 26.704260651629074 24.160401002506266 22.280701754385966 106-107 27.616424636955433 25.56334501752629 24.098647971957938 22.721582373560338 108-109 27.750657153586182 25.62273125547628 24.03304543747653 22.59356615346101 110-111 27.700000000000003 27.3625 23.799999999999997 21.1375 112-113 28.8375 26.337500000000002 23.1375 21.6875 114-115 27.800000000000004 25.650000000000002 24.462500000000002 22.0875 116-117 27.125 26.700000000000003 24.6 21.575 118-119 28.53747028650069 25.534842987614166 24.09608407356437 21.831602652320782 120-121 27.775 26.2875 24.2375 21.7 122-123 28.525 26.2875 24.6125 20.575 124-125 28.625 25.9875 24.075 21.3125 126 28.349999999999998 25.8 23.974999999999998 21.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.5 18 1.5 19 1.0 20 0.5 21 1.5 22 1.0 23 2.0 24 3.5 25 4.5 26 4.5 27 5.0 28 7.5 29 8.5 30 9.5 31 12.5 32 22.0 33 26.0 34 30.5 35 46.0 36 47.5 37 60.5 38 87.5 39 103.5 40 120.0 41 132.0 42 145.0 43 157.0 44 178.0 45 190.5 46 180.0 47 188.5 48 180.5 49 169.5 50 162.0 51 139.5 52 125.0 53 115.5 54 102.0 55 92.5 56 90.0 57 87.0 58 86.0 59 83.5 60 74.0 61 68.5 62 74.0 63 67.5 64 64.5 65 56.0 66 49.0 67 52.0 68 55.5 69 49.5 70 38.5 71 34.0 72 30.0 73 26.0 74 18.5 75 12.0 76 9.0 77 4.5 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.3 7 0.625 8 1.175 9 0.525 10-11 0.2875 12-13 0.025 14-15 0.025 16-17 0.08750000000000001 18-19 0.025 20-21 0.0 22-23 0.0625 24-25 0.0125 26-27 0.13749999999999998 28-29 0.36250000000000004 30-31 0.35000000000000003 32-33 0.3125 34-35 0.36250000000000004 36-37 1.6 38-39 1.1875 40-41 1.6875 42-43 1.8124999999999998 44-45 1.8124999999999998 46-47 1.05 48-49 0.5625 50-51 1.4500000000000002 52-53 1.425 54-55 1.125 56-57 0.36250000000000004 58-59 0.1875 60-61 0.0 62-63 0.075 64-65 0.21250000000000002 66-67 0.25 68-69 0.3125 70-71 0.2875 72-73 0.1 74-75 0.125 76-77 0.2375 78-79 0.11249999999999999 80-81 0.0625 82-83 0.0375 84-85 0.0375 86-87 0.0 88-89 0.0 90-91 0.0375 92-93 0.0 94-95 0.0 96-97 0.2875 98-99 0.0 100-101 0.0 102-103 0.0625 104-105 0.25 106-107 0.15 108-109 0.13749999999999998 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.08750000000000001 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.95 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24204143506822 98.2 2 0.5558362809499747 1.0999999999999999 3 0.1010611419909045 0.3 4 0.1010611419909045 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.037500000000000006 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1375 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.32499999999999996 0.0 0.0 0.0 0.0 72-73 0.475 0.0 0.0 0.0 0.0 74-75 0.675 0.0 0.0 0.0 0.0 76-77 0.8 0.0 0.0 0.0 0.0 78-79 1.0499999999999998 0.0 0.0 0.0 0.0 80-81 1.425 0.0 0.0 0.0 0.0 82-83 1.8 0.0 0.0 0.0 0.0 84-85 2.15 0.0 0.0 0.0 0.0 86-87 2.6 0.0 0.0 0.0 0.0 88-89 3.0625 0.0 0.0 0.0 0.0 90-91 3.675 0.0 0.0 0.0 0.0 92-93 4.3125 0.0 0.0 0.0 0.0 94-95 4.7875 0.0 0.0 0.0 0.0 96-97 5.55 0.0 0.0 0.0 0.0 98-99 6.2625 0.0 0.0 0.0 0.0 100-101 7.0625 0.0 0.0 0.0 0.0 102-103 7.75 0.0 0.0 0.0 0.0 104-105 8.575 0.0 0.0 0.0 0.0 106-107 9.5625 0.0 0.0 0.0 0.0 108-109 10.525 0.0 0.0 0.0 0.0 110-111 11.350000000000001 0.0 0.0 0.0 0.0 112-113 12.462499999999999 0.0 0.0 0.0 0.0 114 13.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980954 spots for ERR1744555.sra Written 980954 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra Read 980943 spots for ERR1744555.sra Written 980943 spots for ERR1744555.sra SRR ids: ['ERR1744555.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_oynmj1up ERR1744555.sra spots: 19618871 blocks: [[1, 980943], [980944, 1961886], [1961887, 2942829], [2942830, 3923772], [3923773, 4904715], [4904716, 5885658], [5885659, 6866601], [6866602, 7847544], [7847545, 8828487], [8828488, 9809430], [9809431, 10790373], [10790374, 11771316], [11771317, 12752259], [12752260, 13733202], [13733203, 14714145], [14714146, 15695088], [15695089, 16676031], [16676032, 17656974], [17656975, 18637917], [18637918, 19618871]] ERR1744555 file size 5668538 ERR1744555 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744555 ERR1744555_1.fastq ERR1744555_2.fastq Input file: ERR1744555_1.fastq Paired file: ERR1744555_2.fastq trimmed: ERR1744555-trimmed-pair1.fastq, ERR1744555-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:38:47 2024 >> started Sat Dec 7 00:39:07 2024 >> done (20.528s) 19618871 read pairs processed; of these: 23950 ( 0.12%) short read pairs filtered out after trimming by size control 23042 ( 0.12%) empty read pairs filtered out after trimming by size control 19571879 (99.76%) read pairs available; of these: 12562505 (64.19%) trimmed read pairs available after processing 7009374 (35.81%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 142 0.00% 19 87 0.00% 20 101 0.00% 21 118 0.00% 22 104 0.00% 23 105 0.00% 24 113 0.00% 25 110 0.00% 26 84 0.00% 27 84 0.00% 28 95 0.00% 29 95 0.00% 30 99 0.00% 31 106 0.00% 32 139 0.00% 33 124 0.00% 34 138 0.00% 35 131 0.00% 36 164 0.00% 37 187 0.00% 38 229 0.00% 39 242 0.00% 40 249 0.00% 41 337 0.00% 42 319 0.00% 43 407 0.00% 44 500 0.00% 45 464 0.00% 46 567 0.00% 47 670 0.00% 48 781 0.00% 49 893 0.00% 50 993 0.01% 51 1197 0.01% 52 1232 0.01% 53 1615 0.01% 54 1741 0.01% 55 1919 0.01% 56 2155 0.01% 57 2383 0.01% 58 2685 0.01% 59 3157 0.02% 60 3420 0.02% 61 3834 0.02% 62 4540 0.02% 63 5267 0.03% 64 5909 0.03% 65 6471 0.03% 66 7486 0.04% 67 8212 0.04% 68 9042 0.05% 69 10352 0.05% 70 11824 0.06% 71 12766 0.07% 72 15886 0.08% 73 18040 0.09% 74 20415 0.10% 75 22971 0.12% 76 26735 0.14% 77 27619 0.14% 78 28392 0.15% 79 30724 0.16% 80 33048 0.17% 81 35754 0.18% 82 39027 0.20% 83 41985 0.21% 84 45611 0.23% 85 47869 0.24% 86 50667 0.26% 87 54424 0.28% 88 57407 0.29% 89 59491 0.30% 90 63254 0.32% 91 66892 0.34% 92 69583 0.36% 93 72743 0.37% 94 76001 0.39% 95 78762 0.40% 96 82986 0.42% 97 85829 0.44% 98 87702 0.45% 99 90858 0.46% 100 93797 0.48% 101 94507 0.48% 102 97679 0.50% 103 100453 0.51% 104 104443 0.53% 105 107688 0.55% 106 112133 0.57% 107 114915 0.59% 108 117798 0.60% 109 122437 0.63% 110 124856 0.64% 111 127812 0.65% 112 133372 0.68% 113 136115 0.70% 114 143330 0.73% 115 151370 0.77% 116 159300 0.81% 117 169816 0.87% 118 183242 0.94% 119 202157 1.03% 120 229755 1.17% 121 272317 1.39% 122 352965 1.80% 123 530527 2.71% 124 1056194 5.40% 125 5976668 30.54% 126 7009374 35.81% 19571879 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=10 prefix-density=0.43 prefix-fanout=3.1 sequence=GTGGCGTCGGTGCACCCGAACATGGG criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=104.64 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=13.6 sequence=CCGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGAAGGAGGAGAAGGCATCCTGGAGACCACGGTCGTCGGTAGCCCAGGCGAGGCCGCCCACGAAGCAACGGTACTCAACTTCCGCCATTCCTCCCACTAAACCCTAACGAACCGGAACC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.36 fanout-score-rank=21 prefix-density=0.75 prefix-fanout=1.5 sequence=CCTTTCCAGGGCCTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.17 sequence-density-rank=17 fanout-score=53.99 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=14.7 sequence=CAAGAAGAAGGT ERR1744555 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:39:49 Started mapping on | Dec 07 00:39:49 Finished on | Dec 07 00:41:27 Mapping speed, Million of reads per hour | 718.97 Number of input reads | 19571879 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 18788530 Uniquely mapped reads % | 96.00% Average mapped length | 239.97 Number of splices: Total | 14898140 Number of splices: Annotated (sjdb) | 13813606 Number of splices: GT/AG | 14666603 Number of splices: GC/AG | 178758 Number of splices: AT/AC | 6054 Number of splices: Non-canonical | 46725 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.59 Insertion rate per base | 0.03% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299108 % of reads mapped to multiple loci | 1.53% Number of reads mapped to too many loci | 23849 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.00% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 503735 503735 503735 N_multimapping 299108 299108 299108 N_noFeature 955646 18138592 1200813 N_ambiguous 470779 3020 66461 UnstrandedReadsAssigned:17362105 PositiveStrandReadsAssigned:646918 NegativeStrandReadsAssigned:17521256 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=117 echo kmer=113 ERR1744555 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744555-trimmed-pair1.fastq ERR1744555-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,571,879 reads, 17,629,174 reads pseudoaligned [quant] estimated average fragment length: 205.102 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52973 ERR1744555.ke.tsv 35125 ERR1744555.se.tsv 88098 total ==> ERR1744555.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.263 0 0 PNS24247 1044 839.898 64.0374 6.11641 PNS24249 1928 1723.9 95.4025 4.43954 PNS24246 1044 839.898 64.0374 6.11641 PNS24248 1044 839.898 64.0374 6.11641 PNS24244 1471 1266.9 66.4852 4.20991 PNS24243 293 126.744 0 0 KQK14069 1603 1398.9 4390.43 251.774 KQK14071 474 280.392 203.323 58.1714 ==> ERR1744555.se.tsv <== BRADI_1g14170v3 5623 BRADI_1g53295v3 855 BRADI_1g59795v3 266 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 473 BRADI_1g74790v3 233 BRADI_1g09890v3 1 BRADI_1g77505v3 365 BRADI_1g48960v3 0 ERR1744555 completed mapping pipeline successfully