Starting /dee2/code/volunteer_pipeline.sh ERR1744556 current disk space = 1548299796480 free memory = 1603605400 ERR1744556 SRAfilesize aaafc8b979fc5130d84db430a43d2086 ERR1744556.sra ERR1744556.sra file validated ERR1744556 is paired end ERR1744556 is conventional basespace ERR1744556 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744556_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.36775 34.0 33.0 34.0 33.0 34.0 2 33.3215 34.0 33.0 34.0 33.0 34.0 3 33.396 34.0 33.0 34.0 33.0 34.0 4 33.36825 34.0 34.0 34.0 33.0 34.0 5 33.401 34.0 34.0 34.0 33.0 34.0 6 36.80825 38.0 37.0 38.0 35.0 38.0 7 37.171 38.0 38.0 38.0 36.0 38.0 8 37.362 38.0 38.0 38.0 37.0 38.0 9 37.45475 38.0 38.0 38.0 37.0 38.0 10-11 37.45925 38.0 38.0 38.0 37.0 38.0 12-13 37.495374999999996 38.0 38.0 38.0 37.5 38.0 14-15 37.39925 38.0 38.0 38.0 37.0 38.0 16-17 37.452875000000006 38.0 38.0 38.0 37.0 38.0 18-19 37.396875 38.0 38.0 38.0 37.0 38.0 20-21 37.386750000000006 38.0 38.0 38.0 37.0 38.0 22-23 37.3695 38.0 38.0 38.0 37.0 38.0 24-25 37.329375 38.0 38.0 38.0 37.0 38.0 26-27 37.35275 38.0 38.0 38.0 37.0 38.0 28-29 37.358875 38.0 38.0 38.0 37.0 38.0 30-31 37.271375 38.0 38.0 38.0 37.0 38.0 32-33 37.012875 38.0 38.0 38.0 36.5 38.0 34-35 36.89375 38.0 38.0 38.0 36.0 38.0 36-37 36.944125 38.0 38.0 38.0 36.0 38.0 38-39 37.003 38.0 38.0 38.0 36.0 38.0 40-41 36.843999999999994 38.0 38.0 38.0 36.0 38.0 42-43 36.788250000000005 38.0 38.0 38.0 35.5 38.0 44-45 36.89475 38.0 38.0 38.0 35.5 38.0 46-47 36.83925 38.0 38.0 38.0 35.0 38.0 48-49 36.84425 38.0 38.0 38.0 35.0 38.0 50-51 36.79025 38.0 38.0 38.0 35.0 38.0 52-53 36.664625 38.0 38.0 38.0 34.5 38.0 54-55 36.589625 38.0 38.0 38.0 34.0 38.0 56-57 36.664249999999996 38.0 38.0 38.0 34.5 38.0 58-59 36.65375 38.0 38.0 38.0 34.0 38.0 60-61 36.55575 38.0 38.0 38.0 34.0 38.0 62-63 36.259249999999994 38.0 38.0 38.0 33.0 38.0 64-65 36.278125 38.0 37.5 38.0 33.5 38.0 66-67 36.162375 38.0 37.0 38.0 33.0 38.0 68-69 36.14275 38.0 37.0 38.0 33.0 38.0 70-71 36.03725 38.0 37.0 38.0 33.0 38.0 72-73 36.000375000000005 38.0 37.0 38.0 32.5 38.0 74-75 35.874125 38.0 37.0 38.0 31.0 38.0 76-77 35.598749999999995 38.0 37.0 38.0 31.0 38.0 78-79 35.529125 38.0 37.0 38.0 31.0 38.0 80-81 35.257999999999996 38.0 37.0 38.0 29.0 38.0 82-83 35.2205 38.0 36.0 38.0 29.0 38.0 84-85 34.80475 38.0 35.5 38.0 26.0 38.0 86-87 35.016125 38.0 36.0 38.0 27.5 38.0 88-89 35.034875 38.0 36.0 38.0 28.5 38.0 90-91 34.723625 38.0 35.5 38.0 27.0 38.0 92-93 34.38 38.0 34.5 38.0 25.5 38.0 94-95 34.33975 38.0 34.0 38.0 25.0 38.0 96-97 33.833875 38.0 33.5 38.0 22.5 38.0 98-99 34.120374999999996 38.0 34.0 38.0 24.0 38.0 100-101 33.901125 38.0 33.5 38.0 23.0 38.0 102-103 33.70525 38.0 33.0 38.0 22.5 38.0 104-105 33.696625 38.0 33.5 38.0 21.5 38.0 106-107 32.94 38.0 32.5 38.0 16.0 38.0 108-109 32.973 38.0 33.0 38.0 16.5 38.0 110-111 32.800250000000005 38.0 33.0 38.0 18.0 38.0 112-113 32.5145 38.0 32.0 38.0 14.0 38.0 114-115 32.43075 38.0 32.5 38.0 14.0 38.0 116-117 32.016625 38.0 32.0 38.0 13.5 38.0 118-119 31.660874999999997 38.0 31.0 38.0 13.0 38.0 120-121 30.823124999999997 37.0 29.0 38.0 11.0 38.0 122-123 30.24475 37.0 28.0 38.0 2.0 38.0 124-125 28.732999999999997 36.5 27.0 38.0 2.0 38.0 126 17.4785 20.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 4.0 12 2.0 13 2.0 14 3.0 15 6.0 16 6.0 17 7.0 18 5.0 19 6.0 20 6.0 21 10.0 22 10.0 23 16.0 24 22.0 25 22.0 26 27.0 27 36.0 28 51.0 29 64.0 30 61.0 31 121.0 32 121.0 33 182.0 34 291.0 35 463.0 36 1030.0 37 1423.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.25 6.275 8.275 47.199999999999996 2 25.224999999999998 9.25 34.925 30.599999999999998 3 23.974999999999998 12.049999999999999 20.95 43.025000000000006 4 29.299999999999997 18.85 21.0 30.85 5 30.175 23.724999999999998 23.599999999999998 22.5 6 24.075 29.9 22.925 23.1 7 20.5070281124498 20.983935742971887 39.1566265060241 19.352409638554217 8 22.95 21.775 29.5 25.775 9 21.375 19.7 34.25 24.675 10-11 23.849999999999998 28.212500000000002 24.224999999999998 23.7125 12-13 24.3125 21.987499999999997 27.1125 26.5875 14-15 23.65 23.925 26.424999999999997 26.0 16-17 25.5125 23.1375 25.275 26.075 18-19 24.1625 24.25 25.4875 26.1 20-21 24.1875 24.025 26.375 25.412499999999998 22-23 25.575 23.3125 25.2375 25.874999999999996 24-25 24.625 24.4875 24.2875 26.6 26-27 23.775 23.875 26.0125 26.337500000000002 28-29 24.975 23.575 25.45 26.0 30-31 24.802606842962778 22.997869407193882 25.59217947111167 26.60734427873167 32-33 24.06194913120121 23.533115084361622 26.73130193905817 25.673633845378994 34-35 24.700542176270332 24.107930904047407 25.16706594376497 26.024460975917286 36-37 24.69788519637462 23.955186304128905 24.87411883182276 26.472809667673715 38-39 24.7997997997998 24.61211211211211 24.637137137137138 25.95095095095095 40-41 24.877804236119815 24.13836320340895 24.62714625892969 26.356686301541547 42-43 24.949773982923155 23.191863385233553 24.886991461577097 26.971371170266195 44-45 24.73710565848773 22.99699549323986 26.00150225338007 26.264396594892336 46-47 24.925 23.6375 25.4 26.0375 48-49 24.45 23.5 25.15 26.900000000000002 50-51 24.075 23.125 25.4875 27.3125 52-53 24.9 24.4875 24.45 26.1625 54-55 24.27160185069401 23.50881580592722 25.934725522070778 26.28485682130799 56-57 24.675 23.3875 25.45 26.487500000000004 58-59 25.937500000000004 23.6375 24.9 25.525 60-61 24.41525953721076 23.176985616010008 25.728580362726706 26.67917448405253 62-63 24.887500000000003 23.525 24.9125 26.674999999999997 64-65 24.1875 23.6875 24.9 27.224999999999998 66-67 24.65 23.0375 25.55 26.7625 68-69 24.9375 24.05 24.5125 26.5 70-71 25.3125 23.2625 24.349999999999998 27.075 72-73 24.337500000000002 22.675 25.474999999999998 27.5125 74-75 24.337500000000002 23.575 25.6 26.487500000000004 76-77 25.087500000000002 22.7625 25.3125 26.8375 78-79 24.608248715055787 23.592829384480382 25.02193807195688 26.776983828506957 80-81 25.05047955577991 24.204946996466433 24.659262998485612 26.085310449268047 82-83 24.96236828901154 23.645258404415454 25.163070747616658 26.22930255895635 84-85 24.489795918367346 22.912232377613623 25.178414924251907 27.419556779767124 86-87 24.05 23.05 25.7125 27.187499999999996 88-89 25.374999999999996 23.2375 24.9 26.487500000000004 90-91 25.3 23.1125 24.3625 27.224999999999998 92-93 25.825 22.875 25.4625 25.837500000000002 94-95 24.325 23.7625 24.975 26.937499999999996 96-97 25.412499999999998 23.3 25.0625 26.224999999999998 98-99 26.1125 22.7125 25.174999999999997 26.0 100-101 24.7375 23.4125 25.25 26.6 102-103 25.05 24.2 25.0375 25.7125 104-105 26.625 23.4875 24.825 25.0625 106-107 25.087500000000002 24.375 24.675 25.8625 108-109 25.5 23.425 24.6875 26.387500000000003 110-111 25.575 23.1875 24.349999999999998 26.887499999999996 112-113 26.187500000000004 23.4125 24.1125 26.2875 114-115 25.337500000000002 23.65 24.575 26.437500000000004 116-117 25.8 23.25 24.712500000000002 26.237500000000004 118-119 24.975 24.175 25.7125 25.137500000000003 120-121 25.55 22.925 24.637500000000003 26.887499999999996 122-123 25.5125 24.8 24.2875 25.4 124-125 24.6625 24.275 24.275 26.787499999999998 126 27.05 21.675 23.75 27.525 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.5 22 2.0 23 2.5 24 2.5 25 3.5 26 3.5 27 4.0 28 4.5 29 4.0 30 5.5 31 6.5 32 8.0 33 17.0 34 27.5 35 31.5 36 43.5 37 48.5 38 57.0 39 93.0 40 105.5 41 128.0 42 155.5 43 163.5 44 175.0 45 177.0 46 168.5 47 154.0 48 155.0 49 151.0 50 132.0 51 127.0 52 131.0 53 119.5 54 115.5 55 104.0 56 91.5 57 101.5 58 94.5 59 79.0 60 80.0 61 85.5 62 76.0 63 68.5 64 72.5 65 73.5 66 59.5 67 49.5 68 63.0 69 64.0 70 54.0 71 49.0 72 44.5 73 44.0 74 34.5 75 25.0 76 22.5 77 14.5 78 8.0 79 5.5 80 3.0 81 1.0 82 2.5 83 2.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.4 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.2625 32-33 0.7250000000000001 34-35 0.8625 36-37 0.7000000000000001 38-39 0.1 40-41 0.2625 42-43 0.44999999999999996 44-45 0.15 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0375 56-57 0.0 58-59 0.0 60-61 0.0625 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.2875 80-81 0.95 82-83 0.35000000000000003 84-85 0.1625 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73193000253615 97.32499999999999 2 1.1159015977681968 2.1999999999999997 3 0.12680699974638598 0.375 4 0.025361399949277198 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.875 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.5125 0.0 0.0 0.0 0.0 110-111 1.7375 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114 2.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744556 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744556_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 52 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.80725 33.0 33.0 34.0 32.0 34.0 2 32.9375 34.0 33.0 34.0 32.0 34.0 3 32.95525 34.0 33.0 34.0 32.0 34.0 4 32.94125 34.0 33.0 34.0 32.0 34.0 5 32.951 34.0 33.0 34.0 32.0 34.0 6 37.0595 38.0 38.0 38.0 36.0 38.0 7 36.99325 38.0 38.0 38.0 36.0 38.0 8 37.008 38.0 38.0 38.0 36.0 38.0 9 37.1495 38.0 38.0 38.0 37.0 38.0 10-11 37.074 38.0 38.0 38.0 36.0 38.0 12-13 36.975875 38.0 38.0 38.0 36.0 38.0 14-15 36.980125 38.0 38.0 38.0 36.0 38.0 16-17 36.965125 38.0 38.0 38.0 36.0 38.0 18-19 36.8795 38.0 38.0 38.0 35.5 38.0 20-21 36.876125 38.0 38.0 38.0 35.5 38.0 22-23 36.93175 38.0 38.0 38.0 36.0 38.0 24-25 36.814625 38.0 38.0 38.0 35.5 38.0 26-27 36.673874999999995 38.0 38.0 38.0 34.5 38.0 28-29 36.640249999999995 38.0 38.0 38.0 34.5 38.0 30-31 36.7115 38.0 38.0 38.0 35.0 38.0 32-33 36.60825 38.0 38.0 38.0 35.0 38.0 34-35 36.607124999999996 38.0 38.0 38.0 34.0 38.0 36-37 36.477625 38.0 38.0 38.0 34.0 38.0 38-39 36.614374999999995 38.0 38.0 38.0 34.5 38.0 40-41 36.556875000000005 38.0 38.0 38.0 34.0 38.0 42-43 36.4955 38.0 38.0 38.0 34.0 38.0 44-45 36.383750000000006 38.0 38.0 38.0 34.0 38.0 46-47 36.33325 38.0 38.0 38.0 33.5 38.0 48-49 36.307375 38.0 38.0 38.0 34.0 38.0 50-51 36.321125 38.0 38.0 38.0 33.5 38.0 52-53 36.073125000000005 38.0 37.5 38.0 33.0 38.0 54-55 35.941125 38.0 37.0 38.0 32.5 38.0 56-57 35.771249999999995 38.0 37.0 38.0 31.0 38.0 58-59 35.70025 38.0 37.0 38.0 31.0 38.0 60-61 35.77475 38.0 37.0 38.0 31.0 38.0 62-63 35.5195 38.0 37.0 38.0 30.0 38.0 64-65 35.3615 38.0 37.0 38.0 29.0 38.0 66-67 35.152625 38.0 36.0 38.0 28.5 38.0 68-69 35.084375 38.0 36.0 38.0 28.0 38.0 70-71 34.871875 38.0 36.0 38.0 27.0 38.0 72-73 34.577749999999995 38.0 35.0 38.0 25.5 38.0 74-75 34.528 38.0 35.0 38.0 25.0 38.0 76-77 34.014875 38.0 34.0 38.0 22.5 38.0 78-79 33.916250000000005 38.0 34.0 38.0 23.5 38.0 80-81 33.627375 38.0 34.0 38.0 20.5 38.0 82-83 33.46425 38.0 33.5 38.0 20.5 38.0 84-85 33.173625 38.0 33.0 38.0 16.5 38.0 86-87 32.410125 38.0 32.0 38.0 14.0 38.0 88-89 32.337375 38.0 31.5 38.0 14.0 38.0 90-91 32.472375 38.0 33.0 38.0 14.0 38.0 92-93 31.907249999999998 38.0 31.0 38.0 13.5 38.0 94-95 31.464750000000002 37.5 29.5 38.0 13.0 38.0 96-97 31.213375 37.5 29.5 38.0 12.0 38.0 98-99 31.1175 38.0 29.0 38.0 11.5 38.0 100-101 30.341250000000002 37.0 27.5 38.0 11.0 38.0 102-103 29.9655 36.5 26.5 38.0 11.0 38.0 104-105 29.669 36.5 26.0 38.0 2.0 38.0 106-107 29.688125 37.0 26.5 38.0 2.0 38.0 108-109 28.788125 35.5 23.0 38.0 2.0 38.0 110-111 28.430999999999997 35.5 22.0 38.0 2.0 38.0 112-113 27.6125 34.0 20.0 38.0 2.0 38.0 114-115 26.955875 33.5 14.0 38.0 2.0 38.0 116-117 26.568875 33.0 14.0 38.0 2.0 38.0 118-119 26.171875 33.0 12.5 38.0 2.0 38.0 120-121 24.36325 32.5 6.5 38.0 2.0 38.0 122-123 23.250375 31.0 2.0 38.0 2.0 38.0 124-125 21.369374999999998 31.0 2.0 38.0 2.0 38.0 126 12.4915 2.0 2.0 28.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 0.0 5 0.0 6 1.0 7 2.0 8 2.0 9 3.0 10 3.0 11 4.0 12 9.0 13 11.0 14 12.0 15 15.0 16 21.0 17 22.0 18 28.0 19 28.0 20 20.0 21 41.0 22 28.0 23 44.0 24 34.0 25 66.0 26 60.0 27 68.0 28 76.0 29 106.0 30 121.0 31 166.0 32 182.0 33 273.0 34 364.0 35 495.0 36 867.0 37 824.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.0 15.65 10.975 40.375 2 27.474999999999998 21.85 30.0 20.674999999999997 3 22.15 23.974999999999998 25.474999999999998 28.4 4 26.075 30.3 18.475 25.15 5 27.325 32.35 19.15 21.175 6 23.375 33.125 20.599999999999998 22.900000000000002 7 23.3 17.95 32.525 26.224999999999998 8 22.55 22.275 24.025 31.15 9 23.875 21.775 26.674999999999997 27.675 10-11 25.687500000000004 27.675 20.75 25.887500000000003 12-13 25.887500000000003 22.8 23.875 27.437499999999996 14-15 24.212500000000002 24.6 24.7 26.487500000000004 16-17 24.762500000000003 25.275 22.9625 27.0 18-19 25.124999999999996 25.4375 23.7 25.7375 20-21 25.3 24.099999999999998 24.2875 26.3125 22-23 25.887500000000003 24.975 22.125 27.0125 24-25 24.925 24.45 24.4 26.224999999999998 26-27 26.4625 24.3625 23.5125 25.662499999999998 28-29 25.887500000000003 24.6625 23.1625 26.2875 30-31 25.35 24.95 23.549999999999997 26.150000000000002 32-33 25.662499999999998 24.7 23.3125 26.325 34-35 25.937500000000004 23.925 23.075000000000003 27.0625 36-37 24.762500000000003 24.962500000000002 23.8875 26.387500000000003 38-39 26.487500000000004 24.2625 23.1375 26.1125 40-41 26.1625 24.4375 22.425 26.974999999999998 42-43 25.662499999999998 24.675 22.7125 26.950000000000003 44-45 26.724999999999998 24.3875 23.3625 25.525 46-47 25.95 24.837500000000002 22.575 26.637499999999996 48-49 26.337500000000002 24.325 23.724999999999998 25.6125 50-51 25.837500000000002 24.474999999999998 23.474999999999998 26.2125 52-53 26.887499999999996 24.337500000000002 23.025000000000002 25.75 54-55 26.625 24.1125 23.200000000000003 26.0625 56-57 26.8625 24.4 23.1 25.637500000000003 58-59 26.5 24.45 23.5 25.55 60-61 26.687499999999996 24.1875 23.9 25.224999999999998 62-63 26.275 24.075 23.962500000000002 25.687500000000004 64-65 26.6125 24.85 23.075000000000003 25.4625 66-67 27.200000000000003 24.55 23.1 25.15 68-69 25.95 24.9125 23.525 25.6125 70-71 26.900000000000002 24.175 23.2875 25.637500000000003 72-73 25.8 24.337500000000002 24.45 25.412499999999998 74-75 26.275 24.775 24.025 24.925 76-77 26.3125 25.1875 23.225 25.275 78-79 25.4875 24.474999999999998 23.724999999999998 26.3125 80-81 26.6625 24.425 23.6875 25.224999999999998 82-83 26.6625 24.85 21.9 26.5875 84-85 26.474999999999998 24.462500000000002 23.525 25.5375 86-87 26.737499999999997 24.9875 23.25 25.025 88-89 26.400000000000002 25.087500000000002 23.0125 25.5 90-91 26.474999999999998 23.0875 24.925 25.5125 92-93 27.6 23.9375 22.325 26.137500000000003 94-95 26.85 24.325 23.2375 25.587500000000002 96-97 26.05 24.349999999999998 23.1625 26.437500000000004 98-99 26.637499999999996 25.3 22.775000000000002 25.2875 100-101 27.0875 24.375 22.675 25.8625 102-103 26.674999999999997 23.5375 23.4125 26.375 104-105 26.700000000000003 24.85 23.4375 25.0125 106-107 26.887499999999996 24.7375 22.525000000000002 25.85 108-109 25.775 25.3 23.599999999999998 25.324999999999996 110-111 26.487500000000004 25.0 22.662499999999998 25.85 112-113 27.025 24.2375 22.5 26.237500000000004 114-115 26.1625 24.825 23.4625 25.55 116-117 26.974999999999998 24.837500000000002 22.925 25.2625 118-119 26.6625 24.725 22.525000000000002 26.087500000000002 120-121 27.200000000000003 25.224999999999998 22.400000000000002 25.174999999999997 122-123 27.8875 25.387500000000003 22.025 24.7 124-125 27.1125 24.6625 22.6125 25.6125 126 28.95 23.025000000000002 20.7 27.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 1.0 14 2.0 15 3.0 16 2.5 17 0.5 18 0.5 19 2.5 20 5.0 21 4.5 22 4.0 23 3.0 24 1.0 25 3.0 26 4.0 27 4.0 28 3.5 29 3.5 30 6.0 31 8.0 32 10.5 33 15.5 34 20.0 35 26.5 36 42.0 37 59.5 38 67.5 39 81.0 40 98.5 41 116.0 42 134.0 43 148.5 44 165.0 45 154.0 46 143.0 47 158.5 48 157.5 49 137.5 50 139.0 51 133.5 52 106.0 53 104.5 54 100.5 55 92.0 56 88.0 57 83.0 58 88.5 59 88.5 60 83.0 61 89.5 62 105.0 63 98.0 64 82.5 65 77.5 66 81.5 67 81.0 68 73.5 69 69.0 70 62.5 71 61.5 72 51.5 73 39.5 74 41.0 75 32.0 76 18.5 77 14.0 78 8.0 79 3.0 80 2.0 81 1.5 82 1.5 83 1.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0 104-105 0.0 106-107 0.0 108-109 0.0 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.0 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.85554425228891 97.175 2 0.7884028484231942 1.55 3 0.20345879959308238 0.6 4 0.10172939979654119 0.4 5 0.025432349949135298 0.125 6 0.025432349949135298 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGCTTGCGGTGGATACCTAGGCACCCAGAGACGAGGAAGGGCGTAGCAAG 6 0.15 No Hit GCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6625000000000001 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9 0.0 0.0 0.0 0.0 102-103 0.9624999999999999 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.4875 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114 2.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929736 spots for ERR1744556.sra Written 929736 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra Read 929720 spots for ERR1744556.sra Written 929720 spots for ERR1744556.sra SRR ids: ['ERR1744556.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gc0rny0r ERR1744556.sra spots: 18594416 blocks: [[1, 929720], [929721, 1859440], [1859441, 2789160], [2789161, 3718880], [3718881, 4648600], [4648601, 5578320], [5578321, 6508040], [6508041, 7437760], [7437761, 8367480], [8367481, 9297200], [9297201, 10226920], [10226921, 11156640], [11156641, 12086360], [12086361, 13016080], [13016081, 13945800], [13945801, 14875520], [14875521, 15805240], [15805241, 16734960], [16734961, 17664680], [17664681, 18594416]] ERR1744556 file size 5371406 ERR1744556 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744556 ERR1744556_1.fastq ERR1744556_2.fastq Input file: ERR1744556_1.fastq Paired file: ERR1744556_2.fastq trimmed: ERR1744556-trimmed-pair1.fastq, ERR1744556-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:40:14 2024 >> started Sat Dec 7 00:40:34 2024 >> done (20.200s) 18594416 read pairs processed; of these: 12899 ( 0.07%) short read pairs filtered out after trimming by size control 9780 ( 0.05%) empty read pairs filtered out after trimming by size control 18571737 (99.88%) read pairs available; of these: 12948137 (69.72%) trimmed read pairs available after processing 5623600 (30.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 38 0.00% 20 30 0.00% 21 52 0.00% 22 38 0.00% 23 40 0.00% 24 53 0.00% 25 70 0.00% 26 59 0.00% 27 92 0.00% 28 97 0.00% 29 121 0.00% 30 90 0.00% 31 126 0.00% 32 103 0.00% 33 80 0.00% 34 68 0.00% 35 90 0.00% 36 98 0.00% 37 106 0.00% 38 126 0.00% 39 136 0.00% 40 145 0.00% 41 160 0.00% 42 205 0.00% 43 222 0.00% 44 263 0.00% 45 289 0.00% 46 337 0.00% 47 372 0.00% 48 426 0.00% 49 447 0.00% 50 470 0.00% 51 528 0.00% 52 521 0.00% 53 592 0.00% 54 661 0.00% 55 679 0.00% 56 765 0.00% 57 884 0.00% 58 958 0.01% 59 1066 0.01% 60 1221 0.01% 61 1285 0.01% 62 1356 0.01% 63 1523 0.01% 64 1765 0.01% 65 1929 0.01% 66 2019 0.01% 67 2219 0.01% 68 2559 0.01% 69 3057 0.02% 70 3130 0.02% 71 3369 0.02% 72 4087 0.02% 73 4211 0.02% 74 4726 0.03% 75 5168 0.03% 76 5685 0.03% 77 6071 0.03% 78 6462 0.03% 79 7130 0.04% 80 7856 0.04% 81 8683 0.05% 82 9038 0.05% 83 10037 0.05% 84 10997 0.06% 85 12179 0.07% 86 13086 0.07% 87 14369 0.08% 88 15646 0.08% 89 16968 0.09% 90 18440 0.10% 91 19704 0.11% 92 21588 0.12% 93 23439 0.13% 94 25447 0.14% 95 27541 0.15% 96 29909 0.16% 97 32662 0.18% 98 35930 0.19% 99 39050 0.21% 100 42948 0.23% 101 46768 0.25% 102 50888 0.27% 103 55735 0.30% 104 60946 0.33% 105 66334 0.36% 106 73050 0.39% 107 79888 0.43% 108 87737 0.47% 109 96072 0.52% 110 104908 0.56% 111 114919 0.62% 112 125598 0.68% 113 137879 0.74% 114 150421 0.81% 115 167391 0.90% 116 186820 1.01% 117 210880 1.14% 118 242764 1.31% 119 284816 1.53% 120 353123 1.90% 121 436989 2.35% 122 591660 3.19% 123 874038 4.71% 124 1651081 8.89% 125 6181208 33.28% 126 5623600 30.28% 18571737 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.92 fanout-score-rank=14 prefix-density=0.58 prefix-fanout=3.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=209.36 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=20.0 sequence=CCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCGACGAAGTGGAAGCTGTCATCTGCACCATCCTTGAGCGAGAGGAGTGCCTTGATTCCACCGCAGCGGCTGTGGCCAATCACCACGATGACCTCAACCTTGAGGGCACACACGGCGTACTCGATGGCCGACCCAACACCGGCGTACTTGTTCTTGCAGTAGGACGGGACCATGTTGGCGATGTTGCGGACGGTGAAGGCCTCGCCGGGCTCCAGGCCCAGGGTCACCGACGGGCACACACGTGAGTCGGCGCAGGCGAACACCATGTACTTGGGGGCCTGGCCGGCCTTGAGCGGCTCGAAGACATCCGGCTTCTTGTCGTAGACCTCGGTCTTGAACTTCTCGAACCCGGTCTTGAGGCGCTCCACGGCGGCGTCCATCAATGCGGGCGCGACGGGCGCGGCCTGGACGGGGGCGTTCCTGATGAGCCTGGGGCGGAAGCTGCCGGAAGAGGACGGGGCCGGGGTGCCGAG criterion=sequence-density sequence-density=0.94 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=29 prefix-density=1.01 prefix-fanout=2.1 sequence=CTCAAGTCCACCGCCGG criterion=fanout-score sequence-density=0.12 sequence-density-rank=28 fanout-score=179.38 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=21.8 sequence=GCGGCGGCGGCGA ERR1744556 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:41:32 Started mapping on | Dec 07 00:41:32 Finished on | Dec 07 00:43:20 Mapping speed, Million of reads per hour | 619.06 Number of input reads | 18571737 Average input read length | 245 UNIQUE READS: Uniquely mapped reads number | 17464424 Uniquely mapped reads % | 94.04% Average mapped length | 244.50 Number of splices: Total | 15067499 Number of splices: Annotated (sjdb) | 13910872 Number of splices: GT/AG | 14829362 Number of splices: GC/AG | 179940 Number of splices: AT/AC | 6608 Number of splices: Non-canonical | 51589 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.80 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 358856 % of reads mapped to multiple loci | 1.93% Number of reads mapped to too many loci | 36415 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.00% % of reads unmapped: other | 0.84% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 753093 753093 753093 N_multimapping 358856 358856 358856 N_noFeature 865986 16994922 1030156 N_ambiguous 376026 2859 71223 UnstrandedReadsAssigned:16222412 PositiveStrandReadsAssigned:466643 NegativeStrandReadsAssigned:16363045 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=122 echo kmer=117 ERR1744556 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744556-trimmed-pair1.fastq ERR1744556-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,571,737 reads, 16,498,058 reads pseudoaligned [quant] estimated average fragment length: 236.73 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52973 ERR1744556.ke.tsv 35125 ERR1744556.se.tsv 88098 total ==> ERR1744556.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 700.852 0 0 PNS24247 1044 808.27 59.2269 6.56768 PNS24249 1928 1692.27 182.27 9.65376 PNS24246 1044 808.27 59.2269 6.56768 PNS24248 1044 808.27 59.2269 6.56768 PNS24244 1471 1235.27 64.0489 4.64729 PNS24243 293 104.267 0 0 KQK14069 1603 1367.27 18877.1 1237.46 KQK14071 474 251.556 255.376 90.9904 ==> ERR1744556.se.tsv <== BRADI_1g14170v3 20037 BRADI_1g53295v3 1777 BRADI_1g59795v3 239 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 194 BRADI_1g74790v3 117 BRADI_1g09890v3 0 BRADI_1g77505v3 332 BRADI_1g48960v3 0 ERR1744556 completed mapping pipeline successfully