Starting /dee2/code/volunteer_pipeline.sh ERR1744557
    current disk space = 1548249808896
    free memory = 1601861924 
ERR1744557 SRAfilesize
b403cc087e45225955631d470b909f94  ERR1744557.sra
ERR1744557.sra file validated
ERR1744557 is paired end
ERR1744557 is conventional basespace
ERR1744557 read1 length is 126 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	ERR1744557_1.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	126
%GC	50
>>END_MODULE
>>Per base sequence quality	fail
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	33.083	34.0	33.0	34.0	32.0	34.0
2	33.17275	34.0	33.0	34.0	32.0	34.0
3	33.24675	34.0	33.0	34.0	32.0	34.0
4	33.1445	34.0	33.0	34.0	32.0	34.0
5	33.13	34.0	33.0	34.0	32.0	34.0
6	36.6815	38.0	37.0	38.0	34.0	38.0
7	37.174	38.0	38.0	38.0	36.0	38.0
8	37.3115	38.0	38.0	38.0	37.0	38.0
9	37.41	38.0	38.0	38.0	37.0	38.0
10-11	37.368375	38.0	38.0	38.0	37.0	38.0
12-13	37.353375	38.0	38.0	38.0	37.0	38.0
14-15	37.365625	38.0	38.0	38.0	37.0	38.0
16-17	37.339375	38.0	38.0	38.0	37.0	38.0
18-19	37.29925	38.0	38.0	38.0	37.0	38.0
20-21	37.284000000000006	38.0	38.0	38.0	37.0	38.0
22-23	37.305125	38.0	38.0	38.0	37.0	38.0
24-25	37.252625	38.0	38.0	38.0	37.0	38.0
26-27	37.135875	38.0	38.0	38.0	36.0	38.0
28-29	37.132125	38.0	38.0	38.0	36.5	38.0
30-31	37.18375	38.0	38.0	38.0	36.5	38.0
32-33	37.060249999999996	38.0	38.0	38.0	36.0	38.0
34-35	36.93625	38.0	38.0	38.0	36.0	38.0
36-37	37.055125000000004	38.0	38.0	38.0	36.0	38.0
38-39	36.882625000000004	38.0	38.0	38.0	35.5	38.0
40-41	36.856875	38.0	38.0	38.0	35.0	38.0
42-43	37.021625	38.0	38.0	38.0	36.0	38.0
44-45	36.874375	38.0	38.0	38.0	35.5	38.0
46-47	36.767375	38.0	38.0	38.0	34.5	38.0
48-49	36.675625	38.0	38.0	38.0	34.5	38.0
50-51	36.487	38.0	38.0	38.0	33.5	38.0
52-53	36.145250000000004	38.0	38.0	38.0	32.0	38.0
54-55	35.974875	38.0	37.5	38.0	31.5	38.0
56-57	35.992374999999996	38.0	37.0	38.0	31.5	38.0
58-59	35.38549999999999	38.0	37.0	38.0	30.0	38.0
60-61	35.344875	38.0	37.0	38.0	29.5	38.0
62-63	35.378875	38.0	37.0	38.0	29.5	38.0
64-65	35.021625	38.0	36.5	38.0	27.5	38.0
66-67	35.046125	38.0	36.5	38.0	29.0	38.0
68-69	34.89675	38.0	36.0	38.0	28.0	38.0
70-71	34.485875	38.0	35.5	38.0	25.5	38.0
72-73	34.10125	38.0	34.0	38.0	23.5	38.0
74-75	33.7345	38.0	34.0	38.0	21.5	38.0
76-77	33.420500000000004	38.0	33.5	38.0	19.5	38.0
78-79	33.413125	38.0	33.5	38.0	19.5	38.0
80-81	32.692	38.0	32.0	38.0	14.5	38.0
82-83	32.33175	38.0	31.0	38.0	14.0	38.0
84-85	32.461875	38.0	31.0	38.0	14.0	38.0
86-87	32.101875	37.5	30.5	38.0	14.0	38.0
88-89	31.869875	38.0	31.0	38.0	14.0	38.0
90-91	31.287125	37.0	29.5	38.0	14.0	38.0
92-93	30.921	37.0	28.5	38.0	13.5	38.0
94-95	30.609875000000002	36.5	28.5	38.0	12.5	38.0
96-97	30.662	37.0	29.0	38.0	11.5	38.0
98-99	29.722250000000003	36.5	25.0	38.0	11.0	38.0
100-101	29.07075	35.0	23.5	38.0	6.5	38.0
102-103	28.270875	34.0	21.0	38.0	2.0	38.0
104-105	27.362375	33.5	17.0	38.0	2.0	38.0
106-107	27.609375	33.5	20.0	38.0	2.0	38.0
108-109	27.067625	33.5	16.0	38.0	2.0	38.0
110-111	26.12525	33.0	14.0	38.0	2.0	38.0
112-113	25.591375	33.0	13.5	38.0	2.0	38.0
114-115	24.61775	31.0	12.0	38.0	2.0	38.0
116-117	23.478625	29.5	6.5	37.0	2.0	38.0
118-119	22.610125	28.5	2.0	37.0	2.0	38.0
120-121	21.865375	28.0	2.0	37.0	2.0	38.0
122-123	20.272375	26.0	2.0	36.5	2.0	38.0
124-125	17.702375	11.0	2.0	36.0	2.0	38.0
126	7.5535	2.0	2.0	2.0	2.0	30.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
2	1.0
3	1.0
4	0.0
5	0.0
6	0.0
7	1.0
8	0.0
9	3.0
10	2.0
11	2.0
12	1.0
13	5.0
14	11.0
15	10.0
16	26.0
17	21.0
18	34.0
19	21.0
20	40.0
21	29.0
22	37.0
23	41.0
24	56.0
25	60.0
26	76.0
27	97.0
28	112.0
29	121.0
30	155.0
31	196.0
32	283.0
33	326.0
34	498.0
35	616.0
36	811.0
37	307.0
>>END_MODULE
>>Per base sequence content	fail
#Base	G	A	T	C
1	40.13503375843961	7.151787946986747	7.876969242310578	44.836209052263065
2	26.35	10.174999999999999	31.05	32.425
3	24.5	14.475	21.425	39.6
4	28.4	21.725	20.325	29.549999999999997
5	27.700000000000003	25.85	23.325000000000003	23.125
6	22.525000000000002	30.45	23.875	23.150000000000002
7	18.975	20.925	41.025	19.075
8	21.375	22.675	29.775000000000002	26.174999999999997
9	18.95	20.424999999999997	35.725	24.9
10-11	23.0125	29.575000000000003	24.275	23.1375
12-13	22.8125	24.1875	28.1625	24.837500000000002
14-15	22.725	25.825	26.5375	24.9125
16-17	23.0625	25.687500000000004	26.150000000000002	25.1
18-19	23.4125	24.8125	25.874999999999996	25.900000000000002
20-21	23.974999999999998	25.074999999999996	25.374999999999996	25.575
22-23	22.5875	25.0125	26.087500000000002	26.3125
24-25	23.3625	24.3625	25.924999999999997	26.35
26-27	22.537499999999998	25.112499999999997	25.874999999999996	26.474999999999998
28-29	23.4375	25.7	25.162499999999998	25.7
30-31	23.7375	24.462500000000002	26.187500000000004	25.6125
32-33	23.5625	25.3	25.5625	25.575
34-35	22.825	24.9	25.25	27.025
36-37	22.9625	24.525	26.2125	26.3
38-39	22.1875	24.5625	26.5125	26.737499999999997
40-41	23.5125	25.0125	25.0375	26.437500000000004
42-43	23.525	24.8125	25.837500000000002	25.825
44-45	23.200000000000003	24.675	26.2875	25.837500000000002
46-47	24.4125	24.2	25.55	25.837500000000002
48-49	23.962500000000002	24.6625	25.374999999999996	26.0
50-51	23.6625	24.075	25.95	26.3125
52-53	24.525	24.625	24.975	25.874999999999996
54-55	22.7625	24.65	25.637500000000003	26.950000000000003
56-57	23.5625	24.525	25.974999999999998	25.937500000000004
58-59	23.744349573078853	25.765946760421897	25.13812154696133	25.35158211953792
60-61	23.900718155474358	25.664608794254757	24.480282222502208	25.95439082776868
62-63	22.95288485764676	24.313429075333836	26.278659611992943	26.455026455026452
64-65	23.43101496667086	24.739026537542447	25.342724185637028	26.487234310149667
66-67	23.228643216080403	25.087939698492463	25.552763819095475	26.13065326633166
68-69	23.814316266197004	24.808151968801106	25.210718329349604	26.16681343565228
70-71	24.299772899318697	24.3628564219026	25.73807721423164	25.599293464547063
72-73	23.33838766742482	24.665150366439224	25.86555471316654	26.130907252969422
74-75	24.372941474537622	24.030909551558146	25.19635165948822	26.399797314416013
76-77	23.656593753951192	24.668099633329117	25.780756100644837	25.894550512074847
78-79	23.810126582278482	23.93670886075949	25.658227848101266	26.59493670886076
80-81	22.940655447298493	23.952929267366823	27.15424522333291	25.952170062001773
82-83	23.885310092206645	24.883162814197295	24.93368700265252	26.29784009094354
84-85	23.7909810325336	24.68282879035297	24.11757316919985	27.408617007913577
86-87	24.673530889000503	23.832245102963334	26.167754897036666	25.3264691109995
88-89	24.59530681390388	25.159994980549634	25.109800476847788	25.134897728698707
90-91	23.79340604237182	24.194559358154695	25.072082236429736	26.93995236304375
92-93	24.397590361445783	24.184236947791167	25.64006024096386	25.778112449799195
94-95	23.493219487694624	24.949773982923155	25.376695128076342	26.18031140130588
96-97	23.471177944862156	24.686716791979947	25.977443609022554	25.86466165413534
98-99	23.564157345733317	24.770642201834864	25.49956013572955	26.165640316702277
100-101	24.377984418195524	24.55390801708972	24.66700175923599	26.401105805478764
102-103	23.78140703517588	24.28391959798995	25.515075376884422	26.41959798994975
104-105	24.28698187349474	24.40106477373558	24.9080998859171	26.403853466852578
106-107	24.43318556048132	24.99050031665611	25.497150094996833	25.079164027865737
108-109	24.584126984126982	24.203174603174602	24.977777777777778	26.234920634920634
110-111	23.674821610601427	24.80886850152905	25.649847094801224	25.866462793068294
112-113	24.780673871582962	24.640813731722822	24.691671964399237	25.886840432294978
114-115	24.429718363705874	24.633617943162992	24.391487192557666	26.54517650057347
116-117	23.70096790626592	23.79011716760061	25.802343352012226	26.70657157412124
118-119	24.180589210559877	25.213620711643927	24.078561407983674	26.527228669812526
120-121	23.811349693251536	24.795501022494886	24.91053169734151	26.482617586912067
122-123	24.86251438802916	24.606727202967132	24.811356951016755	25.719401457986958
124-125	25.289698204507832	25.149624347383163	24.309181204635173	25.25149624347383
126	27.62219959266802	21.206720977596742	24.84725050916497	26.323828920570264
>>END_MODULE
>>Per sequence GC content	fail
#GC Content	Count
0	0.0
1	0.0
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10	0.0
11	0.0
12	0.0
13	0.0
14	0.0
15	0.5
16	1.0
17	0.5
18	0.0
19	0.0
20	0.0
21	1.0
22	2.0
23	2.0
24	2.0
25	1.5
26	2.5
27	3.5
28	7.0
29	9.0
30	9.5
31	12.5
32	18.0
33	22.0
34	33.0
35	41.0
36	49.0
37	62.5
38	75.0
39	97.5
40	121.0
41	136.0
42	149.5
43	173.0
44	177.0
45	177.0
46	186.5
47	185.0
48	173.5
49	164.5
50	164.0
51	166.0
52	145.5
53	125.0
54	106.5
55	91.5
56	99.5
57	95.0
58	83.5
59	71.5
60	73.5
61	74.0
62	62.0
63	63.5
64	61.0
65	56.5
66	59.0
67	54.5
68	46.5
69	36.0
70	33.0
71	33.5
72	26.5
73	20.5
74	17.5
75	13.0
76	10.0
77	6.0
78	3.0
79	2.5
80	1.0
81	1.5
82	1.5
83	0.5
84	0.0
85	0.0
86	0.0
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	0.025
2	0.0
3	0.0
4	0.0
5	0.0
6	0.0
7	0.0
8	0.0
9	0.0
10-11	0.0
12-13	0.0
14-15	0.0
16-17	0.0
18-19	0.0
20-21	0.0
22-23	0.0
24-25	0.0
26-27	0.0
28-29	0.0
30-31	0.0
32-33	0.0
34-35	0.0
36-37	0.0
38-39	0.0
40-41	0.0
42-43	0.0
44-45	0.0
46-47	0.0
48-49	0.0
50-51	0.0
52-53	0.0
54-55	0.0
56-57	0.0
58-59	0.44999999999999996
60-61	0.7875
62-63	0.775
64-65	0.6125
66-67	0.5
68-69	0.6375
70-71	0.9249999999999999
72-73	1.075
74-75	1.325
76-77	1.1375
78-79	1.25
80-81	1.2125000000000001
82-83	1.0375
84-85	0.4875
86-87	0.44999999999999996
88-89	0.3875
90-91	0.2875
92-93	0.4
94-95	0.44999999999999996
96-97	0.25
98-99	0.5375
100-101	0.525
102-103	0.5
104-105	1.3875
106-107	1.3125
108-109	1.5625
110-111	1.9
112-113	1.6875
114-115	1.9124999999999999
116-117	1.8499999999999999
118-119	1.9875
120-121	2.1999999999999997
122-123	2.2624999999999997
124-125	1.8375
126	1.7999999999999998
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
126	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	99.0
#Duplication Level	Percentage of deduplicated	Percentage of total
1	99.14141414141415	98.15
2	0.7323232323232324	1.4500000000000002
3	0.10101010101010101	0.3
4	0.025252525252525252	0.1
5	0.0	0.0
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	pass
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0125	0.0	0.0	0.0
38-39	0.0	0.025	0.0	0.0	0.0
40-41	0.0	0.025	0.0	0.0	0.0
42-43	0.0	0.025	0.0	0.0	0.0
44-45	0.0	0.025	0.0	0.0	0.0
46-47	0.0	0.025	0.0	0.0	0.0
48-49	0.0	0.025	0.0	0.0	0.0
50-51	0.0	0.025	0.0	0.0	0.0
52-53	0.0	0.025	0.0	0.0	0.0
54-55	0.0	0.025	0.0	0.0	0.0
56-57	0.0	0.025	0.0	0.0	0.0
58-59	0.0	0.025	0.0	0.0	0.0
60-61	0.0	0.025	0.0	0.0	0.0
62-63	0.0	0.025	0.0	0.0	0.0
64-65	0.0	0.025	0.0	0.0	0.0
66-67	0.0	0.025	0.0	0.0	0.0
68-69	0.025	0.025	0.0	0.0	0.0
70-71	0.025	0.025	0.0	0.0	0.0
72-73	0.025	0.025	0.0	0.0	0.0
74-75	0.025	0.025	0.0	0.0	0.0
76-77	0.025	0.025	0.0	0.0	0.0
78-79	0.037500000000000006	0.025	0.0	0.0	0.0
80-81	0.075	0.025	0.0	0.0	0.0
82-83	0.1	0.025	0.0	0.0	0.0
84-85	0.125	0.025	0.0	0.0	0.0
86-87	0.1875	0.025	0.0	0.0	0.0
88-89	0.32499999999999996	0.025	0.0	0.0	0.0
90-91	0.4625	0.025	0.0	0.0	0.0
92-93	0.575	0.025	0.0	0.0	0.0
94-95	0.7250000000000001	0.025	0.0	0.0	0.0
96-97	0.925	0.025	0.0	0.0	0.0
98-99	1.2000000000000002	0.025	0.0	0.0	0.0
100-101	1.5125	0.025	0.0	0.0	0.0
102-103	1.7875	0.025	0.0	0.0	0.0
104-105	2.0250000000000004	0.025	0.0	0.0	0.0
106-107	2.4625000000000004	0.025	0.0	0.0	0.0
108-109	2.875	0.025	0.0	0.0	0.0
110-111	3.3	0.025	0.0	0.0	0.0
112-113	3.775	0.025	0.0	0.0	0.0
114	4.125	0.025	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	pass
>>END_MODULE
ERR1744557 read2 length is 126 nt
##FastQC	0.11.5
>>Basic Statistics	pass
#Measure	Value
Filename	ERR1744557_2.fastq
File type	Conventional base calls
Encoding	Sanger / Illumina 1.9
Total Sequences	4000
Sequences flagged as poor quality	0
Sequence length	126
%GC	50
>>END_MODULE
>>Per base sequence quality	fail
#Base	Mean	Median	Lower Quartile	Upper Quartile	10th Percentile	90th Percentile
1	32.34625	33.0	33.0	34.0	32.0	34.0
2	32.694	34.0	33.0	34.0	32.0	34.0
3	32.83175	34.0	33.0	34.0	32.0	34.0
4	32.7065	34.0	33.0	34.0	32.0	34.0
5	32.576	34.0	33.0	34.0	31.0	34.0
6	36.42925	38.0	38.0	38.0	35.0	38.0
7	36.3	38.0	38.0	38.0	35.0	38.0
8	36.3165	38.0	38.0	38.0	35.0	38.0
9	36.116	38.0	38.0	38.0	35.0	38.0
10-11	35.71025	38.0	38.0	38.0	33.5	38.0
12-13	35.47325	38.0	38.0	38.0	33.0	38.0
14-15	35.47775	38.0	38.0	38.0	33.0	38.0
16-17	35.439625	38.0	38.0	38.0	33.0	38.0
18-19	35.39975	38.0	38.0	38.0	33.0	38.0
20-21	35.311625	38.0	38.0	38.0	32.0	38.0
22-23	35.381625	38.0	38.0	38.0	32.5	38.0
24-25	35.420249999999996	38.0	38.0	38.0	32.0	38.0
26-27	35.447375	38.0	38.0	38.0	33.0	38.0
28-29	35.8775	38.0	38.0	38.0	33.0	38.0
30-31	36.241875	38.0	38.0	38.0	33.5	38.0
32-33	36.443375	38.0	38.0	38.0	34.5	38.0
34-35	36.446625	38.0	38.0	38.0	35.0	38.0
36-37	36.413375	38.0	38.0	38.0	35.0	38.0
38-39	36.347625	38.0	38.0	38.0	34.0	38.0
40-41	36.35575	38.0	38.0	38.0	34.0	38.0
42-43	36.415875	38.0	38.0	38.0	35.0	38.0
44-45	36.42425	38.0	38.0	38.0	35.0	38.0
46-47	36.37125	38.0	38.0	38.0	35.0	38.0
48-49	36.154375	38.0	38.0	38.0	34.0	38.0
50-51	35.825874999999996	38.0	38.0	38.0	33.5	38.0
52-53	35.512375	38.0	38.0	38.0	33.0	38.0
54-55	35.489375	38.0	38.0	38.0	31.0	38.0
56-57	35.493125	38.0	38.0	38.0	33.0	38.0
58-59	35.36775	38.0	38.0	38.0	31.0	38.0
60-61	35.331875	38.0	38.0	38.0	31.0	38.0
62-63	35.2545	38.0	38.0	38.0	30.0	38.0
64-65	34.896	38.0	37.0	38.0	28.5	38.0
66-67	34.946	38.0	37.0	38.0	28.5	38.0
68-69	34.854749999999996	38.0	37.5	38.0	28.5	38.0
70-71	34.573750000000004	38.0	37.0	38.0	25.5	38.0
72-73	34.366875	38.0	37.0	38.0	25.0	38.0
74-75	34.309125	38.0	36.0	38.0	24.0	38.0
76-77	34.349625	38.0	36.5	38.0	24.0	38.0
78-79	34.319	38.0	36.0	38.0	24.5	38.0
80-81	34.06975	38.0	36.0	38.0	22.0	38.0
82-83	33.8845	38.0	35.5	38.0	21.5	38.0
84-85	33.787875	38.0	35.0	38.0	21.0	38.0
86-87	33.829375	38.0	36.0	38.0	21.0	38.0
88-89	33.71925	38.0	35.0	38.0	20.5	38.0
90-91	33.281125	38.0	34.5	38.0	16.5	38.0
92-93	32.854	38.0	34.0	38.0	14.0	38.0
94-95	32.69725	38.0	33.0	38.0	14.0	38.0
96-97	32.407125	38.0	33.0	38.0	14.0	38.0
98-99	32.573625	38.0	33.0	38.0	14.0	38.0
100-101	32.285250000000005	38.0	33.0	38.0	14.0	38.0
102-103	32.45675	38.0	33.0	38.0	14.0	38.0
104-105	32.232375000000005	38.0	33.0	38.0	13.5	38.0
106-107	32.004875	38.0	32.5	38.0	12.5	38.0
108-109	31.50625	38.0	31.0	38.0	11.0	38.0
110-111	31.005875	37.5	29.5	38.0	11.0	38.0
112-113	30.325875	37.0	28.0	38.0	6.5	38.0
114-115	29.779375	36.5	26.5	38.0	2.0	38.0
116-117	29.95675	37.0	28.0	38.0	2.0	38.0
118-119	29.44775	36.5	27.0	38.0	2.0	38.0
120-121	28.922375000000002	36.5	24.5	38.0	2.0	38.0
122-123	28.0105	36.0	21.5	38.0	2.0	38.0
124-125	26.104125	35.5	7.5	38.0	2.0	38.0
126	13.12625	2.0	2.0	28.0	2.0	37.0
>>END_MODULE
>>Per sequence quality scores	pass
#Quality	Count
2	36.0
3	7.0
4	3.0
5	1.0
6	1.0
7	7.0
8	28.0
9	33.0
10	11.0
11	2.0
12	2.0
13	1.0
14	8.0
15	9.0
16	13.0
17	12.0
18	13.0
19	18.0
20	28.0
21	23.0
22	25.0
23	24.0
24	20.0
25	34.0
26	38.0
27	37.0
28	60.0
29	68.0
30	73.0
31	102.0
32	135.0
33	171.0
34	253.0
35	435.0
36	915.0
37	1354.0
>>END_MODULE
>>Per base sequence content	warn
#Base	G	A	T	C
1	33.257287705956905	17.9467680608365	14.220532319391635	34.57541191381496
2	31.65	21.925	27.35	19.075
3	23.173173173173172	27.077077077077078	25.875875875875877	23.873873873873876
4	25.969477107830873	31.3234926194646	20.06504878658994	22.641981486114584
5	26.614727318421714	32.495601910027645	19.80397084694647	21.085699924604175
6	23.01829268292683	34.603658536585364	21.214430894308943	21.163617886178862
7	21.465033180193977	19.448698315467077	35.73251659009699	23.35375191424196
8	24.02148887183423	22.84471731900742	23.816832949603477	29.316960859554875
9	23.19362303934173	22.60221136538956	28.156338390331705	26.047827204937
10-11	26.336274001037886	29.034769071094967	20.8484691229891	23.78048780487805
12-13	26.403027930044377	22.9182980944923	25.254502740798745	25.424171234664577
14-15	25.39164490861619	25.195822454308093	24.464751958224543	24.947780678851174
16-17	26.54046997389034	24.765013054830288	24.295039164490863	24.39947780678851
18-19	25.53191489361702	26.00182743767132	24.64430231040334	23.821955358308315
20-21	26.297894599189224	25.30404080031385	24.48018830914084	23.917876291356087
22-23	25.296803652968038	25.74037834311807	24.01826484018265	24.944553163731246
24-25	25.972674040338322	25.777488614183476	24.76252439817827	23.487312947299934
26-27	26.652757856304603	25.84430825400965	23.771026209414526	23.73190768027122
28-29	26.119785001279755	25.838239058100843	23.803429741489634	24.238546199129768
30-31	25.633589711259614	25.381414701803052	24.7761946791073	24.20880090783003
32-33	25.559748427672957	26.037735849056602	24.465408805031448	23.937106918238992
34-35	26.022398389329304	25.330313325783315	25.330313325783315	23.316974959104066
36-37	26.156739811912228	25.391849529780565	23.786833855799372	24.66457680250784
38-39	26.57132103876553	25.71822857859741	24.501317275122318	23.20913310751474
40-41	26.151914626490896	25.51161330822348	23.502824858757062	24.83364720652856
42-43	26.775	25.7125	23.925	23.5875
44-45	25.34169278996865	25.68025078369906	24.100313479623825	24.877742946708466
46-47	25.937500000000004	25.5125	24.625	23.925
48-49	26.12270714737508	25.692599620493358	24.37697659709045	23.807716635041114
50-51	26.35490070467649	25.24023062139654	24.61242793081358	23.79244074311339
52-53	25.762842796446506	25.5053431183211	23.715720355349557	25.016093729882837
54-55	25.319856704196518	25.422210849539407	25.358239508700102	23.89969293756397
56-57	25.848058815942217	25.564297691216304	25.02257190764865	23.56507158519283
58-59	26.448622199330412	24.594385784187484	24.723152201905744	24.233839814576356
60-61	25.780242455506837	25.96079442868197	24.232654114005676	24.026309001805522
62-63	26.100994446596925	25.274441430969908	24.551207542296268	24.0733565801369
64-65	26.27840909090909	24.961260330578515	24.573863636363637	24.18646694214876
66-67	25.954198473282442	25.90244533574848	24.233406650278173	23.909949540690906
68-69	26.408996897621513	25.49120992761117	23.94002068252327	24.159772492244052
70-71	27.275087628196808	24.587822926132677	24.496949240555626	23.64014020511489
72-73	25.73167573167573	25.55037555037555	25.187775187775184	23.53017353017353
74-75	26.018362860468123	25.164877796456743	24.725203672572093	24.09155567050304
76-77	26.078631605820778	25.925453152923154	23.70436558590758	24.291549655348483
78-79	26.242920075519194	25.210824417872875	24.61925739458779	23.92699811202014
80-81	26.031347962382444	25.818181818181817	24.37617554858934	23.774294670846395
82-83	26.271505713926913	26.47243501193018	23.194775838251918	24.061283435890996
84-85	25.23329129886507	25.598991172761664	25.27112232030265	23.896595208070618
86-87	25.87172308475439	25.99898192924408	23.911936879613133	24.217358106388396
88-89	25.94928562234522	26.180975672544733	24.185866906937832	23.683871798172223
90-91	25.57024364955936	25.34992223950233	25.051840331778124	24.027993779160187
92-93	26.54786680541103	24.77887617065557	25.104058272632674	23.56919875130073
94-95	26.73099491459121	25.753031686008605	23.979658364845484	23.5363150345547
96-97	26.09259499416418	25.89806769549994	25.197769420308653	22.811567890027234
98-99	25.09727626459144	25.252918287937742	25.38261997405966	24.267185473411153
100-101	25.770272012375916	25.602681449013794	24.0685832151605	24.558463323449786
102-103	26.91072575465639	25.7931920359666	23.7893384714194	23.50674373795761
104-105	26.74030310814282	24.98073465193938	24.659645517595685	23.619316722322118
106-107	26.99143332054724	25.763968801943488	23.97391637897967	23.270681498529598
108-109	26.492012779552716	25.98083067092652	24.728434504792332	22.798722044728432
110-111	26.400613967766688	26.055257099002304	24.17498081350729	23.369148119723715
112-113	27.65469824293354	25.65571683218742	23.834988540870896	22.85459638400815
114-115	26.462749079832466	26.51351694377459	23.492829039218176	23.530904937174768
116-117	26.444500760263555	26.444500760263555	24.12569690826153	22.98530157121135
118-119	27.113257912800304	25.460785559933903	23.490530062285497	23.935426464980296
120-121	27.237108190091003	25.846814964610722	24.001516683518705	22.914560161779576
122-123	27.251065964384246	26.21018309505894	23.16277903185352	23.375971908703285
124-125	27.701769800426764	26.459143968871597	24.224927827287562	21.614158403414084
126	29.836065573770494	23.076923076923077	24.312736443883985	22.774274905422445
>>END_MODULE
>>Per sequence GC content	fail
#GC Content	Count
0	0.0
1	0.0
2	1.0
3	2.0
4	2.5
5	4.5
6	5.0
7	3.0
8	3.5
9	3.0
10	1.5
11	2.5
12	2.5
13	3.5
14	5.0
15	6.0
16	8.5
17	9.0
18	6.5
19	7.0
20	8.0
21	7.0
22	5.5
23	5.5
24	7.0
25	5.0
26	4.5
27	8.5
28	9.5
29	10.5
30	13.0
31	14.5
32	19.0
33	18.5
34	27.0
35	36.5
36	47.0
37	64.0
38	71.0
39	90.0
40	118.0
41	134.5
42	148.0
43	166.5
44	175.5
45	173.0
46	176.0
47	178.5
48	172.5
49	170.0
50	157.0
51	143.5
52	139.5
53	124.5
54	100.5
55	91.5
56	86.5
57	81.5
58	80.0
59	78.0
60	75.0
61	68.5
62	60.0
63	52.5
64	58.5
65	62.0
66	62.5
67	55.0
68	48.5
69	51.0
70	40.5
71	27.0
72	25.0
73	22.0
74	17.5
75	13.0
76	7.5
77	5.0
78	2.0
79	1.0
80	1.0
81	0.0
82	0.5
83	0.5
84	0.0
85	0.5
86	0.5
87	0.0
88	0.0
89	0.0
90	0.0
91	0.0
92	0.0
93	0.0
94	0.0
95	0.0
96	0.0
97	0.0
98	0.0
99	0.0
100	0.0
>>END_MODULE
>>Per base N content	pass
#Base	N-Count
1	1.375
2	0.0
3	0.1
4	0.075
5	0.525
6	1.6
7	2.0500000000000003
8	2.275
9	2.775
10-11	3.65
12-13	4.2250000000000005
14-15	4.25
16-17	4.25
18-19	4.237500000000001
20-21	4.4125
22-23	4.1875
24-25	3.9375
26-27	4.1375
28-29	2.325
30-31	0.8625
32-33	0.625
34-35	0.6625
36-37	0.3125
38-39	0.36250000000000004
40-41	0.43750000000000006
42-43	0.0
44-45	0.3125
46-47	0.0
48-49	1.1875
50-51	2.4375
52-53	2.9125
54-55	2.3
56-57	3.0875
58-59	2.9250000000000003
60-61	3.075
62-63	3.2125
64-65	3.2
66-67	3.3875
68-69	3.3000000000000003
70-71	3.7125
72-73	3.4750000000000005
74-75	3.3375000000000004
76-77	2.075
78-79	0.6875
80-81	0.3125
82-83	0.46249999999999997
84-85	0.8750000000000001
86-87	1.775
88-89	2.8875
90-91	3.55
92-93	3.9
94-95	4.1375
96-97	3.6125
98-99	3.6249999999999996
100-101	3.0375
102-103	2.6875
104-105	2.675
106-107	2.2375
108-109	2.1875
110-111	2.275
112-113	1.825
114-115	1.5125
116-117	1.35
118-119	1.6625
120-121	1.0999999999999999
122-123	0.325
124-125	0.41250000000000003
126	0.8750000000000001
>>END_MODULE
>>Sequence Length Distribution	pass
#Length	Count
126	4000.0
>>END_MODULE
>>Sequence Duplication Levels	pass
#Total Deduplicated Percentage	99.25
#Duplication Level	Percentage of deduplicated	Percentage of total
1	99.44584382871537	98.7
2	0.4030226700251889	0.8
3	0.12594458438287154	0.375
4	0.0	0.0
5	0.025188916876574305	0.125
6	0.0	0.0
7	0.0	0.0
8	0.0	0.0
9	0.0	0.0
>10	0.0	0.0
>50	0.0	0.0
>100	0.0	0.0
>500	0.0	0.0
>1k	0.0	0.0
>5k	0.0	0.0
>10k+	0.0	0.0
>>END_MODULE
>>Overrepresented sequences	warn
#Sequence	Count	Percentage	Possible Source
AGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT	5	0.125	No Hit
>>END_MODULE
>>Adapter Content	pass
#Position	Illumina Universal Adapter	Illumina Small RNA 3' Adapter	Illumina Small RNA 5' Adapter	Nextera Transposase Sequence	SOLID Small RNA Adapter
1	0.0	0.0	0.0	0.0	0.0
2	0.0	0.0	0.0	0.0	0.0
3	0.0	0.0	0.0	0.0	0.0
4	0.0	0.0	0.0	0.0	0.0
5	0.0	0.0	0.0	0.0	0.0
6	0.0	0.0	0.0	0.0	0.0
7	0.0	0.0	0.0	0.0	0.0
8	0.0	0.0	0.0	0.0	0.0
9	0.0	0.0	0.0	0.0	0.0
10-11	0.0	0.0	0.0	0.0	0.0
12-13	0.0	0.0	0.0	0.0	0.0
14-15	0.0	0.0	0.0	0.0	0.0
16-17	0.0	0.0	0.0	0.0	0.0
18-19	0.0	0.0	0.0	0.0	0.0
20-21	0.0	0.0	0.0	0.0	0.0
22-23	0.0	0.0	0.0	0.0	0.0
24-25	0.0	0.0	0.0	0.0	0.0
26-27	0.0	0.0	0.0	0.0	0.0
28-29	0.0	0.0	0.0	0.0	0.0
30-31	0.0	0.0	0.0	0.0	0.0
32-33	0.0	0.0	0.0	0.0	0.0
34-35	0.0	0.0	0.0	0.0	0.0
36-37	0.0	0.0	0.0	0.0	0.0
38-39	0.0	0.0	0.0	0.0	0.0
40-41	0.0	0.0	0.0	0.0	0.0
42-43	0.0	0.0	0.0	0.0	0.0
44-45	0.0	0.0	0.0	0.0	0.0
46-47	0.0	0.0	0.0	0.0	0.0
48-49	0.0	0.0	0.0	0.0	0.0
50-51	0.0	0.0	0.0	0.0	0.0
52-53	0.0	0.0	0.0	0.0	0.0
54-55	0.0	0.0	0.0	0.0	0.0
56-57	0.0	0.0	0.0	0.0	0.0
58-59	0.0	0.0	0.0	0.0	0.0
60-61	0.0	0.0	0.0	0.0	0.0
62-63	0.0	0.0	0.0	0.0	0.0
64-65	0.0	0.0	0.0	0.0	0.0
66-67	0.0	0.0	0.0	0.0	0.0
68-69	0.025	0.0	0.0	0.0	0.0
70-71	0.025	0.0	0.0	0.0	0.0
72-73	0.025	0.0	0.0	0.0	0.0
74-75	0.025	0.0	0.0	0.0	0.0
76-77	0.025	0.0	0.0	0.0	0.0
78-79	0.037500000000000006	0.0	0.0	0.0	0.0
80-81	0.075	0.0	0.0	0.0	0.0
82-83	0.1	0.0	0.0	0.0	0.0
84-85	0.125	0.0	0.0	0.0	0.0
86-87	0.1875	0.0	0.0	0.0	0.0
88-89	0.32499999999999996	0.0	0.0	0.0	0.0
90-91	0.4625	0.0	0.0	0.0	0.0
92-93	0.5625	0.0	0.0	0.0	0.0
94-95	0.6875	0.0	0.0	0.0	0.0
96-97	0.8625	0.0	0.0	0.0	0.0
98-99	1.125	0.0	0.0	0.0	0.0
100-101	1.45	0.0	0.0	0.0	0.0
102-103	1.75	0.0	0.0	0.0	0.0
104-105	1.9874999999999998	0.0	0.0	0.0	0.0
106-107	2.4875	0.0	0.0	0.0	0.0
108-109	3.0375	0.0	0.0	0.0	0.0
110-111	3.45	0.0	0.0	0.0	0.0
112-113	3.95	0.0	0.0	0.0	0.0
114	4.4	0.0	0.0	0.0	0.0
>>END_MODULE
>>Kmer Content	pass
>>END_MODULE
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911752 spots for ERR1744557.sra
Written 911752 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
Read 911734 spots for ERR1744557.sra
Written 911734 spots for ERR1744557.sra
SRR ids: ['ERR1744557.sra']
extra args: ['--split-files', '--defline-qual', '+']
tempdir: /tmp/pfd_gst3iw0p
ERR1744557.sra spots: 18234698
blocks: [[1, 911734], [911735, 1823468], [1823469, 2735202], [2735203, 3646936], [3646937, 4558670], [4558671, 5470404], [5470405, 6382138], [6382139, 7293872], [7293873, 8205606], [8205607, 9117340], [9117341, 10029074], [10029075, 10940808], [10940809, 11852542], [11852543, 12764276], [12764277, 13676010], [13676011, 14587744], [14587745, 15499478], [15499479, 16411212], [16411213, 17322946], [17322947, 18234698]]
ERR1744557 file size 5267074
ERR1744557 completed basic pipeline successfully
skewer v0.2.2 [April 4, 2016]
COMMAND LINE:	skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744557 ERR1744557_1.fastq ERR1744557_2.fastq
Input file:	ERR1744557_1.fastq
Paired file:	ERR1744557_2.fastq
trimmed:	ERR1744557-trimmed-pair1.fastq, ERR1744557-trimmed-pair2.fastq

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- end quality threshold (-q):		10
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ 
-- number of concurrent threads (-t):	20
Sat Dec  7 00:44:34 2024 >> started

Sat Dec  7 00:44:51 2024 >> done (16.516s)
18234698 read pairs processed; of these:
   15894 ( 0.09%) short read pairs filtered out after trimming by size control
   29474 ( 0.16%) empty read pairs filtered out after trimming by size control
18189330 (99.75%) read pairs available; of these:
15760800 (86.65%) trimmed read pairs available after processing
 2428530 (13.35%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 18	       6	  0.00%
 19	      13	  0.00%
 20	      13	  0.00%
 21	      13	  0.00%
 22	      19	  0.00%
 23	      23	  0.00%
 24	      22	  0.00%
 25	      23	  0.00%
 26	      36	  0.00%
 27	      41	  0.00%
 28	      49	  0.00%
 29	      59	  0.00%
 30	      59	  0.00%
 31	      74	  0.00%
 32	      92	  0.00%
 33	     108	  0.00%
 34	     136	  0.00%
 35	     178	  0.00%
 36	     194	  0.00%
 37	     194	  0.00%
 38	     248	  0.00%
 39	     344	  0.00%
 40	     320	  0.00%
 41	     378	  0.00%
 42	     482	  0.00%
 43	     495	  0.00%
 44	     586	  0.00%
 45	     649	  0.00%
 46	     750	  0.00%
 47	     783	  0.00%
 48	     874	  0.00%
 49	    1042	  0.01%
 50	    1083	  0.01%
 51	    1222	  0.01%
 52	    1404	  0.01%
 53	    1579	  0.01%
 54	    1679	  0.01%
 55	    1845	  0.01%
 56	    2046	  0.01%
 57	    2191	  0.01%
 58	    2340	  0.01%
 59	    2665	  0.01%
 60	    2895	  0.02%
 61	    3149	  0.02%
 62	    3562	  0.02%
 63	    3998	  0.02%
 64	    4357	  0.02%
 65	    4958	  0.03%
 66	    5330	  0.03%
 67	    5810	  0.03%
 68	    6437	  0.04%
 69	    6956	  0.04%
 70	    7982	  0.04%
 71	    8786	  0.05%
 72	    9503	  0.05%
 73	   10242	  0.06%
 74	   11181	  0.06%
 75	   12066	  0.07%
 76	   13088	  0.07%
 77	   13988	  0.08%
 78	   14467	  0.08%
 79	   15892	  0.09%
 80	   16699	  0.09%
 81	   18186	  0.10%
 82	   19941	  0.11%
 83	   21520	  0.12%
 84	   23365	  0.13%
 85	   25245	  0.14%
 86	   27215	  0.15%
 87	   29683	  0.16%
 88	   32116	  0.18%
 89	   34162	  0.19%
 90	   40722	  0.22%
 91	   47182	  0.26%
 92	   42039	  0.23%
 93	   45029	  0.25%
 94	   48508	  0.27%
 95	   52014	  0.29%
 96	   55397	  0.30%
 97	   60037	  0.33%
 98	   63931	  0.35%
 99	   68621	  0.38%
100	   74295	  0.41%
101	   79984	  0.44%
102	   87065	  0.48%
103	   93555	  0.51%
104	  101277	  0.56%
105	  108505	  0.60%
106	  117693	  0.65%
107	  124672	  0.69%
108	  134692	  0.74%
109	  144482	  0.79%
110	  157611	  0.87%
111	  171720	  0.94%
112	  187659	  1.03%
113	  207352	  1.14%
114	  227234	  1.25%
115	  249978	  1.37%
116	  277665	  1.53%
117	  314364	  1.73%
118	  360650	  1.98%
119	  421574	  2.32%
120	  506115	  2.78%
121	  632454	  3.48%
122	  820220	  4.51%
123	 1169104	  6.43%
124	 2042257	 11.23%
125	 5986007	 32.91%
126	 2428530	 13.35%
18189330 reads passed initial QC


criterion=sequence-density
sequence-density=0.27
sequence-density-rank=1
fanout-score=2.15
fanout-score-rank=39
prefix-density=0.28
prefix-fanout=2.0
sequence=GCAAGACATCTTC


criterion=fanout-score
sequence-density=0.10
sequence-density-rank=17
fanout-score=235.28
fanout-score-rank=1
prefix-density=0.89
prefix-fanout=25.3
sequence=CTTCTTCTTGTC


criterion=sequence-density
sequence-density=0.56
sequence-density-rank=1
fanout-score=1.93
fanout-score-rank=35
prefix-density=0.55
prefix-fanout=1.9
sequence=GAAGATGTCTTGC


criterion=fanout-score
sequence-density=0.09
sequence-density-rank=21
fanout-score=91.40
fanout-score-rank=1
prefix-density=0.46
prefix-fanout=18.7
sequence=GGAGGAGGAGCTT
ERR1744557 testing PE reads STAR mapping to Ensembl genome
                                 Started job on |	Dec 07 00:45:30
                             Started mapping on |	Dec 07 00:45:30
                                    Finished on |	Dec 07 00:46:39
       Mapping speed, Million of reads per hour |	949.01

                          Number of input reads |	18189330
                      Average input read length |	240
                                    UNIQUE READS:
                   Uniquely mapped reads number |	17357221
                        Uniquely mapped reads % |	95.43%
                          Average mapped length |	239.81
                       Number of splices: Total |	13487218
            Number of splices: Annotated (sjdb) |	12588858
                       Number of splices: GT/AG |	13296729
                       Number of splices: GC/AG |	147565
                       Number of splices: AT/AC |	4896
               Number of splices: Non-canonical |	38028
                      Mismatch rate per base, % |	0.40%
                         Deletion rate per base |	0.03%
                        Deletion average length |	2.51
                        Insertion rate per base |	0.02%
                       Insertion average length |	2.70
                             MULTI-MAPPING READS:
        Number of reads mapped to multiple loci |	397835
             % of reads mapped to multiple loci |	2.19%
        Number of reads mapped to too many loci |	36802
             % of reads mapped to too many loci |	0.20%
                                  UNMAPPED READS:
       % of reads unmapped: too many mismatches |	0.00%
                 % of reads unmapped: too short |	1.35%
                     % of reads unmapped: other |	0.84%
                                  CHIMERIC READS:
                       Number of chimeric reads |	0
                            % of chimeric reads |	0.00%
N_unmapped	442803	442803	442803
N_multimapping	397835	397835	397835
N_noFeature	951241	16821216	1078898
N_ambiguous	459136	2811	51301
UnstrandedReadsAssigned:15946844 PositiveStrandReadsAssigned:533194 NegativeStrandReadsAssigned:16227022
Dataset is classified negative stranded
MeadianReadLen=123 20thPercentileLength=112 echo kmer=107
ERR1744557 Starting Kallisto paired end mapping to ensembl reference transcriptome

[quant] fragment length distribution will be estimated from the data
[index] k-mer length: 31
[index] number of targets: 52,972
[index] number of k-mers: 66,720,672
[index] number of equivalence classes: 111,837
[quant] running in paired-end mode
[quant] will process pair 1: ERR1744557-trimmed-pair1.fastq
                             ERR1744557-trimmed-pair2.fastq
[quant] finding pseudoalignments for the reads ... done
[quant] processed 18,189,330 reads, 16,275,335 reads pseudoaligned
[quant] estimated average fragment length: 194.084
[   em] quantifying the abundances ... done
[   em] the Expectation-Maximization algorithm ran for 1,182 rounds

  52973 ERR1744557.ke.tsv
  35125 ERR1744557.se.tsv
  88098 total
==> ERR1744557.ke.tsv <==
target_id	length	eff_length	est_counts	tpm
PNS24245	936	743.123	0	0
PNS24247	1044	850.916	40.7398	4.10397
PNS24249	1928	1734.92	60.6333	2.99575
PNS24246	1044	850.916	40.7398	4.10397
PNS24248	1044	850.916	40.7398	4.10397
PNS24244	1471	1277.92	176.147	11.8153
PNS24243	293	116.646	0	0
KQK14069	1603	1409.92	9571.51	581.914
KQK14071	474	283.853	1593.86	481.313

==> ERR1744557.se.tsv <==
BRADI_1g14170v3	19305
BRADI_1g53295v3	574
BRADI_1g59795v3	176
BRADI_1g07683v3	0
BRADI_1g00485v3	3
BRADI_1g20270v3	177
BRADI_1g74790v3	244
BRADI_1g09890v3	0
BRADI_1g77505v3	315
BRADI_1g48960v3	0
ERR1744557 completed mapping pipeline successfully
