Starting /dee2/code/volunteer_pipeline.sh ERR1744558 current disk space = 1548150820864 free memory = 1601965396 ERR1744558 SRAfilesize 2886a5f6847092e9e6dc5b3839c81e0d ERR1744558.sra ERR1744558.sra file validated ERR1744558 is paired end ERR1744558 is conventional basespace ERR1744558 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744558_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19725 34.0 33.0 34.0 32.0 34.0 2 33.26425 34.0 33.0 34.0 32.0 34.0 3 33.265 34.0 33.0 34.0 33.0 34.0 4 33.1705 34.0 33.0 34.0 32.0 34.0 5 33.23375 34.0 33.0 34.0 32.0 34.0 6 36.76175 38.0 37.0 38.0 35.0 38.0 7 37.2585 38.0 38.0 38.0 36.0 38.0 8 37.41775 38.0 38.0 38.0 37.0 38.0 9 37.435 38.0 38.0 38.0 37.0 38.0 10-11 37.479625 38.0 38.0 38.0 37.0 38.0 12-13 37.44025 38.0 38.0 38.0 37.0 38.0 14-15 37.420249999999996 38.0 38.0 38.0 37.0 38.0 16-17 37.3125 38.0 38.0 38.0 37.0 38.0 18-19 37.412875 38.0 38.0 38.0 37.0 38.0 20-21 37.3505 38.0 38.0 38.0 37.0 38.0 22-23 37.368625 38.0 38.0 38.0 37.0 38.0 24-25 37.388374999999996 38.0 38.0 38.0 37.0 38.0 26-27 37.284625000000005 38.0 38.0 38.0 37.0 38.0 28-29 37.184375 38.0 38.0 38.0 36.5 38.0 30-31 37.157624999999996 38.0 38.0 38.0 36.0 38.0 32-33 37.137249999999995 38.0 38.0 38.0 36.0 38.0 34-35 37.071 38.0 38.0 38.0 36.0 38.0 36-37 37.1375 38.0 38.0 38.0 36.0 38.0 38-39 37.03775 38.0 38.0 38.0 36.0 38.0 40-41 36.958625 38.0 38.0 38.0 36.0 38.0 42-43 37.0025 38.0 38.0 38.0 36.0 38.0 44-45 36.871625 38.0 38.0 38.0 35.5 38.0 46-47 36.792874999999995 38.0 38.0 38.0 35.0 38.0 48-49 36.603375 38.0 38.0 38.0 34.0 38.0 50-51 36.461 38.0 38.0 38.0 33.5 38.0 52-53 36.223375000000004 38.0 38.0 38.0 33.0 38.0 54-55 36.0805 38.0 37.5 38.0 32.0 38.0 56-57 35.947874999999996 38.0 37.5 38.0 31.5 38.0 58-59 35.3395 38.0 37.0 38.0 29.0 38.0 60-61 35.288875000000004 38.0 37.0 38.0 29.0 38.0 62-63 35.4165 38.0 37.0 38.0 29.5 38.0 64-65 35.007999999999996 38.0 36.5 38.0 27.5 38.0 66-67 34.985375000000005 38.0 36.5 38.0 28.5 38.0 68-69 34.740125 38.0 36.0 38.0 26.5 38.0 70-71 34.492625000000004 38.0 35.5 38.0 25.5 38.0 72-73 34.043499999999995 38.0 34.0 38.0 22.5 38.0 74-75 33.731 38.0 33.5 38.0 21.5 38.0 76-77 33.526125 38.0 33.5 38.0 21.0 38.0 78-79 33.449625 38.0 33.5 38.0 21.0 38.0 80-81 32.619875 38.0 32.0 38.0 14.5 38.0 82-83 32.2965 38.0 31.0 38.0 14.0 38.0 84-85 32.291125 38.0 31.5 38.0 14.0 38.0 86-87 31.895874999999997 37.0 30.5 38.0 14.0 38.0 88-89 31.79825 37.0 30.5 38.0 14.0 38.0 90-91 31.002875000000003 37.0 29.0 38.0 13.5 38.0 92-93 30.430875 37.0 27.0 38.0 12.5 38.0 94-95 30.31175 37.0 27.5 38.0 12.0 38.0 96-97 30.258875 37.0 28.0 38.0 11.0 38.0 98-99 29.432499999999997 36.0 24.5 38.0 6.5 38.0 100-101 28.967875 35.5 23.5 38.0 2.0 38.0 102-103 27.9675 34.0 20.0 38.0 2.0 38.0 104-105 27.06175 33.0 16.0 38.0 2.0 38.0 106-107 27.087375 33.5 16.0 38.0 2.0 38.0 108-109 26.356875000000002 33.0 14.0 38.0 2.0 38.0 110-111 25.696375 33.0 14.0 38.0 2.0 38.0 112-113 25.13375 31.5 12.5 38.0 2.0 38.0 114-115 24.345625 31.0 11.5 38.0 2.0 38.0 116-117 23.240000000000002 29.0 6.5 37.0 2.0 38.0 118-119 22.612125 29.0 2.0 37.0 2.0 38.0 120-121 21.516 28.0 2.0 37.0 2.0 38.0 122-123 20.003999999999998 25.0 2.0 36.5 2.0 38.0 124-125 17.30475 10.0 2.0 36.0 2.0 38.0 126 7.50275 2.0 2.0 2.0 2.0 30.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 5.0 13 7.0 14 5.0 15 9.0 16 17.0 17 26.0 18 41.0 19 21.0 20 23.0 21 39.0 22 48.0 23 47.0 24 57.0 25 64.0 26 84.0 27 99.0 28 124.0 29 140.0 30 148.0 31 190.0 32 272.0 33 331.0 34 494.0 35 629.0 36 770.0 37 305.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.28357089272318 6.826706676669167 9.552388097024256 49.33733433358339 2 26.05 10.725 32.2 31.025000000000002 3 24.474999999999998 14.424999999999999 21.0 40.1 4 28.999999999999996 21.675 19.425 29.9 5 28.875 25.5 22.3 23.325000000000003 6 24.875 30.025000000000002 22.95 22.15 7 17.8 22.15 40.625 19.425 8 22.275 22.6 30.825000000000003 24.3 9 19.15 23.0 34.050000000000004 23.799999999999997 10-11 23.7875 29.562500000000004 23.8625 22.787499999999998 12-13 23.3875 24.099999999999998 27.650000000000002 24.8625 14-15 22.225 24.3 27.625 25.85 16-17 24.025 25.087500000000002 25.8625 25.025 18-19 24.05 24.5625 26.8 24.587500000000002 20-21 24.2 24.1375 26.0375 25.624999999999996 22-23 23.150000000000002 24.9125 25.974999999999998 25.9625 24-25 23.674999999999997 24.425 24.775 27.125 26-27 23.825 25.2125 24.9875 25.974999999999998 28-29 23.2125 24.762500000000003 25.4375 26.5875 30-31 24.375 24.337500000000002 24.9 26.387500000000003 32-33 25.025 23.95 24.85 26.174999999999997 34-35 24.025 23.962500000000002 25.937500000000004 26.075 36-37 23.3875 25.4 24.5125 26.700000000000003 38-39 24.05 24.474999999999998 25.337500000000002 26.137500000000003 40-41 23.674999999999997 24.75 25.2875 26.2875 42-43 24.212500000000002 23.8375 25.35 26.6 44-45 23.1625 24.675 26.525 25.637500000000003 46-47 24.025 25.4875 24.4125 26.075 48-49 23.225 25.3 25.0 26.474999999999998 50-51 23.9125 24.575 25.674999999999997 25.837500000000002 52-53 23.425 24.224999999999998 25.650000000000002 26.700000000000003 54-55 23.25 24.337500000000002 25.900000000000002 26.5125 56-57 23.65 25.4375 25.25 25.662499999999998 58-59 23.986952703550372 24.940408982561788 25.68059214653118 25.392046167356668 60-61 23.847897255099472 24.12490556534878 25.195164945857467 26.832032233694285 62-63 22.538403424830015 24.968521782926214 25.409216821959202 27.083857970284562 64-65 24.000502891626855 24.18908725169726 25.056575308021124 26.753834548654766 66-67 23.716902999121597 24.40707742502196 25.850169406449997 26.02585016940645 68-69 23.69811320754717 25.08176100628931 25.610062893081757 25.610062893081757 70-71 23.02946361118106 23.860488541928984 25.98841601611685 27.121631830773108 72-73 23.376623376623375 24.83923843147144 24.864455932417098 26.919682259488088 74-75 23.047811277910938 24.32193768134225 26.050208149362934 26.580042891383876 76-77 23.661332997354165 24.2786947209273 25.14804082146907 26.911931460249466 78-79 24.38839848675914 24.4640605296343 25.523329129886505 25.624211853720052 80-81 24.057971014492754 24.310018903591683 25.75929426591052 25.872715816005044 82-83 24.41845844335471 23.902929712058345 25.14774299006664 26.530868854520307 84-85 23.96787551763082 25.28548123980424 24.92157108796587 25.82507215459907 86-87 25.087807325639737 24.385348720521826 25.100351229302557 25.426492724535876 88-89 23.218765679879578 25.05017561465128 25.476668339187153 26.25439036628199 90-91 24.11676271611125 24.780756702580806 25.407166123778502 25.695314457529438 92-93 23.965906242165957 24.316871396339934 25.821007771371267 25.89621459012284 94-95 24.11543287327478 24.78042659974906 24.416562107904642 26.687578419071517 96-97 24.151746588205835 23.901339676975084 25.11581319644422 26.83110053837486 98-99 24.237096571643853 24.651513248775586 25.455230440788647 25.65615973879191 100-101 24.394224733207786 24.43188951663528 25.134965473948522 26.03892027620841 102-103 23.512427818227465 23.47476776299272 26.048204870700474 26.964599548079338 104-105 24.743962574282463 24.81982551523581 24.9209761031736 25.51523580730813 106-107 25.19565766220651 23.933350164099977 24.640242363039636 26.230749810653876 108-109 25.05700532049658 24.208259437547504 25.842411958449457 24.89232328350646 110-111 25.654051308102616 24.47294894589789 24.625349250698502 25.247650495300988 112-113 25.402663284717818 24.24857324032974 24.413443246670894 25.93532022828155 114-115 25.06030214548686 24.615970547162625 24.374761965215182 25.94896534213533 116-117 24.43145724812603 24.86342269089061 25.104815144200227 25.600304916783127 118-119 24.567869852567362 25.254194204372137 24.49161159125572 25.686324351804778 120-121 24.656313645621182 24.885437881873727 24.834521384928717 25.623727087576377 122-123 24.65299885394117 23.95262956831784 23.888959633261177 27.505411944479818 124-125 25.06981467377507 24.244732165524244 24.155877126174154 26.52957603452653 126 27.588832487309645 20.050761421319795 26.6751269035533 25.68527918781726 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 1.0 28 2.0 29 4.5 30 8.5 31 11.5 32 14.0 33 21.5 34 28.0 35 31.5 36 42.5 37 65.5 38 79.5 39 97.0 40 113.5 41 135.5 42 157.5 43 157.5 44 163.5 45 168.5 46 191.0 47 205.0 48 192.5 49 178.0 50 163.0 51 152.5 52 138.0 53 125.5 54 112.5 55 99.5 56 91.0 57 90.5 58 85.0 59 78.0 60 80.5 61 71.0 62 64.5 63 68.5 64 77.0 65 72.0 66 55.5 67 51.0 68 50.0 69 44.0 70 41.0 71 31.5 72 19.5 73 18.5 74 14.5 75 12.5 76 9.5 77 4.5 78 3.5 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.36250000000000004 60-61 0.7250000000000001 62-63 0.7250000000000001 64-65 0.575 66-67 0.3875 68-69 0.625 70-71 0.7250000000000001 72-73 0.8625 74-75 0.9125 76-77 0.7875 78-79 0.8750000000000001 80-81 0.8125 82-83 0.5875 84-85 0.3875 86-87 0.35000000000000003 88-89 0.35000000000000003 90-91 0.22499999999999998 92-93 0.27499999999999997 94-95 0.375 96-97 0.1625 98-99 0.46249999999999997 100-101 0.43750000000000006 102-103 0.42500000000000004 104-105 1.1375 106-107 0.975 108-109 1.325 110-111 1.575 112-113 1.4375 114-115 1.5375 116-117 1.6125 118-119 1.6500000000000001 120-121 1.7999999999999998 122-123 1.8375 124-125 1.525 126 1.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.0911386013633 98.125 2 0.8583690987124464 1.7000000000000002 3 0.025246149962130777 0.075 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4125 0.0 0.0 0.0 0.0 92-93 0.5625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.2374999999999998 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.9 0.0 0.0 0.0 0.0 106-107 2.4124999999999996 0.0 0.0 0.0 0.0 108-109 3.0375 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 4.0875 0.0 0.0 0.0 0.0 114 4.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744558 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744558_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38975 33.0 33.0 34.0 32.0 34.0 2 32.77925 34.0 33.0 34.0 32.0 34.0 3 32.76275 34.0 33.0 34.0 32.0 34.0 4 32.82325 34.0 33.0 34.0 32.0 34.0 5 32.682 34.0 33.0 34.0 31.0 34.0 6 36.475 38.0 38.0 38.0 35.0 38.0 7 36.38625 38.0 38.0 38.0 35.0 38.0 8 36.48575 38.0 38.0 38.0 36.0 38.0 9 36.1785 38.0 38.0 38.0 35.0 38.0 10-11 35.887625 38.0 38.0 38.0 34.0 38.0 12-13 35.562124999999995 38.0 38.0 38.0 33.5 38.0 14-15 35.556375 38.0 38.0 38.0 33.5 38.0 16-17 35.59625 38.0 38.0 38.0 33.5 38.0 18-19 35.489999999999995 38.0 38.0 38.0 33.0 38.0 20-21 35.350375 38.0 38.0 38.0 32.0 38.0 22-23 35.525125 38.0 38.0 38.0 33.0 38.0 24-25 35.662499999999994 38.0 38.0 38.0 33.5 38.0 26-27 35.60025 38.0 38.0 38.0 33.5 38.0 28-29 36.013625000000005 38.0 38.0 38.0 33.0 38.0 30-31 36.346999999999994 38.0 38.0 38.0 33.5 38.0 32-33 36.592 38.0 38.0 38.0 34.5 38.0 34-35 36.570499999999996 38.0 38.0 38.0 35.0 38.0 36-37 36.493125 38.0 38.0 38.0 34.5 38.0 38-39 36.44675 38.0 38.0 38.0 34.5 38.0 40-41 36.48325 38.0 38.0 38.0 34.5 38.0 42-43 36.502125 38.0 38.0 38.0 35.0 38.0 44-45 36.513 38.0 38.0 38.0 34.5 38.0 46-47 36.47 38.0 38.0 38.0 35.0 38.0 48-49 36.259875 38.0 38.0 38.0 34.0 38.0 50-51 35.958 38.0 38.0 38.0 34.0 38.0 52-53 35.692125000000004 38.0 38.0 38.0 33.0 38.0 54-55 35.701499999999996 38.0 38.0 38.0 33.0 38.0 56-57 35.635625000000005 38.0 38.0 38.0 33.0 38.0 58-59 35.497625 38.0 38.0 38.0 31.5 38.0 60-61 35.50925 38.0 38.0 38.0 31.0 38.0 62-63 35.42125 38.0 38.0 38.0 31.5 38.0 64-65 35.158249999999995 38.0 37.0 38.0 29.0 38.0 66-67 35.153999999999996 38.0 37.0 38.0 30.0 38.0 68-69 34.9075 38.0 37.0 38.0 28.0 38.0 70-71 34.654624999999996 38.0 37.0 38.0 26.5 38.0 72-73 34.62175 38.0 37.0 38.0 25.5 38.0 74-75 34.55575 38.0 37.0 38.0 25.5 38.0 76-77 34.418 38.0 36.5 38.0 25.0 38.0 78-79 34.386250000000004 38.0 36.0 38.0 25.5 38.0 80-81 34.042249999999996 38.0 36.0 38.0 23.0 38.0 82-83 33.91075 38.0 35.5 38.0 22.0 38.0 84-85 33.91875 38.0 35.5 38.0 22.0 38.0 86-87 33.930875 38.0 35.5 38.0 22.5 38.0 88-89 33.89975 38.0 36.0 38.0 22.0 38.0 90-91 33.38475 38.0 35.0 38.0 17.0 38.0 92-93 32.862875 38.0 33.5 38.0 14.0 38.0 94-95 32.633250000000004 38.0 33.0 38.0 14.0 38.0 96-97 32.615875 38.0 33.0 38.0 14.0 38.0 98-99 32.65475 38.0 33.0 38.0 14.0 38.0 100-101 32.44525 38.0 33.0 38.0 14.0 38.0 102-103 32.300625 38.0 32.5 38.0 14.0 38.0 104-105 32.158375 38.0 33.0 38.0 13.0 38.0 106-107 31.937375000000003 38.0 32.0 38.0 13.0 38.0 108-109 31.398625000000003 38.0 31.0 38.0 12.0 38.0 110-111 30.961 37.5 29.0 38.0 11.0 38.0 112-113 30.103875000000002 37.0 27.5 38.0 11.0 38.0 114-115 29.898249999999997 36.5 27.0 38.0 2.0 38.0 116-117 30.186500000000002 37.0 28.5 38.0 2.0 38.0 118-119 29.42 36.5 27.0 38.0 2.0 38.0 120-121 28.7675 36.0 25.0 38.0 2.0 38.0 122-123 27.953249999999997 36.0 21.0 38.0 2.0 38.0 124-125 25.962875 35.5 6.5 38.0 2.0 38.0 126 12.77875 2.0 2.0 28.0 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 25.0 3 6.0 4 0.0 5 2.0 6 1.0 7 7.0 8 30.0 9 24.0 10 7.0 11 1.0 12 4.0 13 7.0 14 9.0 15 11.0 16 15.0 17 14.0 18 14.0 19 15.0 20 20.0 21 17.0 22 20.0 23 32.0 24 32.0 25 35.0 26 39.0 27 48.0 28 60.0 29 73.0 30 83.0 31 85.0 32 132.0 33 177.0 34 287.0 35 430.0 36 902.0 37 1336.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 28.271854471955532 15.58868115209702 14.426478019201616 41.71298635674583 2 27.950000000000003 23.1 28.549999999999997 20.4 3 23.730932733183295 26.03150787696924 25.78144536134033 24.456114028507127 4 25.074999999999996 31.25 20.125 23.549999999999997 5 27.655310621242485 30.68637274549098 20.716432865731463 20.941883767535067 6 24.575627058525463 34.73524195591588 19.204459082847734 21.484671902710918 7 22.371762315896394 18.131030980192993 35.39867953275774 24.09852717115287 8 24.299541518084563 22.05807437595517 25.089149261334693 28.553234844625575 9 24.52588416196822 21.886212198872375 27.16555612506407 26.422347514095335 10-11 26.020144628099175 27.556818181818183 21.72004132231405 24.702995867768596 12-13 26.040582726326743 22.801768990634756 24.674817898022894 26.48283038501561 14-15 24.86662329212752 25.881587508132725 24.593363695510735 24.65842550422902 16-17 25.266579973992197 25.500650195058515 23.810143042912873 25.42262678803641 18-19 25.725061776563923 25.608011444921313 24.255429834828977 24.411496943685783 20-21 25.72062084257206 25.616277553149864 23.516368853528107 25.14673275074997 22-23 25.172100272762698 24.717495778672554 24.57462008052994 25.535783868034812 24-25 25.709105038207486 25.216940810775807 24.621163061779562 24.452791089237145 26-27 24.47043534762833 25.782975958414557 23.87264457439896 25.873944119558157 28-29 26.34730538922156 24.843929162950694 23.442476748630398 25.366288699197348 30-31 25.066029430260343 25.669727078354924 23.984404477424224 25.27983901396051 32-33 25.394835798445726 26.046628227625973 24.768112308849336 23.790423665078965 34-35 26.11912225705329 24.82758620689655 24.551724137931036 24.50156739811912 36-37 26.692529095232135 24.427480916030532 24.077086722562882 24.802903266174447 38-39 25.89162808159179 25.979226629958703 24.54010762107371 23.5890376673758 40-41 25.71392785571142 25.826653306613228 23.45941883767535 25.0 42-43 25.2 25.525 25.4375 23.8375 44-45 26.320400500625784 26.29536921151439 24.20525657071339 23.178973717146434 46-47 26.6125 24.8625 23.799999999999997 24.725 48-49 25.220903812168643 25.347134561979303 24.842211562736683 24.589750063115375 50-51 26.305041480536058 25.411614550095724 24.23739629865986 24.045947670708358 52-53 26.55388952966808 24.18300653594771 24.529027297193387 24.734076637190824 54-55 25.770308123249297 25.579322638146166 24.560733384262797 24.089635854341736 56-57 25.811834167629318 25.22140931844436 24.772173020151456 24.194583493774868 58-59 26.657263751763043 24.451852801641234 24.81087318887037 24.08001025772535 60-61 26.338769744445873 25.041736227045075 24.05290869397714 24.56658533453191 62-63 25.72053525476068 26.0036026762738 24.343798250128668 23.93206381883685 64-65 26.706078910165786 24.79115794884976 24.72689885618815 23.7758642847963 66-67 26.56270137904369 24.95166902951411 24.255703054517337 24.22992653692486 68-69 27.154450598995233 25.27373438103826 23.676413757567953 23.895401262398558 70-71 26.389966382208428 25.12283423842772 23.506594259115595 24.980605120248253 72-73 26.189555125725338 24.461637653127013 25.712443584784012 23.636363636363637 74-75 26.38763683193818 24.597553122987765 24.597553122987765 24.417256922086285 76-77 26.638666157566497 25.060455644648084 23.927707776505027 24.37317042128039 78-79 26.3237139272271 25.77164366373902 24.140526976160604 23.764115432873275 80-81 26.526526526526528 25.13763763763764 24.84984984984985 23.485985985985984 82-83 25.356874530428247 25.782619584272474 24.27998998246932 24.58051590282995 84-85 25.99346076458752 25.817404426559353 24.069416498993963 24.119718309859156 86-87 26.17296474765407 25.90667004818666 24.346943951306113 23.57342125285316 88-89 24.93270093577746 25.176259453916167 24.830149980771697 25.060889629534678 90-91 25.831828733556872 25.70286303843178 24.696930616456022 23.768377611555326 92-93 26.102178423236516 25.648340248962654 24.234958506224068 24.014522821576765 94-95 26.65541417813555 25.733575694624772 24.30537522721371 23.305634900025968 96-97 25.796877016389214 25.564588979223124 24.880629758678538 23.757904245709124 98-99 26.533247256294384 25.267914783731438 24.157520981278243 24.041316978695935 100-101 26.292826895932247 25.060952136532787 24.31669446939561 24.329526498139355 102-103 27.300652758223475 24.958402662229616 24.433636247280173 23.307308332266736 104-105 26.349449987209006 25.594781273983113 23.95753389613712 24.09823484267076 106-107 27.043544690603515 25.413801884390118 22.956455309396485 24.586198115609882 108-109 25.572519083969464 25.368956743002546 24.05852417302799 25.0 110-111 27.37458619811561 25.261013496307616 24.178762414056532 23.185637891520244 112-113 26.78843226788432 25.83713850837139 24.21359715880264 23.16083206494165 114-115 26.300468295152513 26.46500442981901 24.60448044551323 22.63004682951525 116-117 26.82341044115788 25.71103526734926 24.09303501453672 23.372519276956137 118-119 27.934093789607097 25.766793409378963 23.34600760456274 22.953105196451205 120-121 27.55011978312949 25.368805951330227 23.830538393645188 23.250535871895096 122-123 27.23404255319149 25.632040050062578 24.6558197747184 22.478097622027533 124-125 27.094027795167147 25.892074621259546 23.87629898585201 23.137598597721297 126 28.974552784076597 22.978080120937264 23.885109599395314 24.16225749559083 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 2.5 6 2.5 7 1.0 8 0.5 9 1.0 10 2.0 11 3.0 12 4.5 13 5.5 14 4.5 15 4.0 16 6.0 17 6.5 18 6.0 19 8.5 20 6.5 21 4.5 22 8.0 23 7.5 24 7.5 25 6.5 26 4.0 27 7.0 28 11.5 29 10.0 30 9.5 31 13.5 32 16.0 33 16.5 34 25.5 35 38.5 36 44.0 37 61.0 38 73.5 39 89.5 40 114.0 41 119.5 42 134.0 43 161.0 44 170.0 45 167.5 46 176.0 47 194.5 48 170.5 49 141.0 50 152.0 51 156.5 52 132.0 53 118.0 54 112.5 55 99.0 56 99.0 57 93.5 58 88.0 59 84.0 60 72.0 61 71.5 62 86.5 63 81.0 64 66.5 65 57.5 66 58.0 67 63.5 68 57.0 69 39.0 70 29.5 71 28.0 72 24.5 73 20.5 74 13.0 75 9.5 76 6.0 77 4.0 78 2.5 79 2.5 80 3.0 81 1.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.05 2 0.0 3 0.025 4 0.0 5 0.2 6 1.325 7 1.55 8 1.8499999999999999 9 2.45 10-11 3.2 12-13 3.9 14-15 3.9375 16-17 3.875 18-19 3.8875 20-21 4.1625000000000005 22-23 3.7624999999999997 24-25 3.4875000000000003 26-27 3.8125 28-29 1.8875 30-31 0.6125 32-33 0.27499999999999997 34-35 0.3125 36-37 0.11249999999999999 38-39 0.11249999999999999 40-41 0.2 42-43 0.0 44-45 0.125 46-47 0.0 48-49 0.975 50-51 2.0625 52-53 2.4625 54-55 1.825 56-57 2.6125 58-59 2.5125 60-61 2.6625 62-63 2.85 64-65 2.7375 66-67 3.0124999999999997 68-69 2.9625 70-71 3.325 72-73 3.0625 74-75 2.9375 76-77 1.7874999999999999 78-79 0.375 80-81 0.1 82-83 0.17500000000000002 84-85 0.6 86-87 1.425 88-89 2.4875000000000003 90-91 3.075 92-93 3.5999999999999996 94-95 3.7249999999999996 96-97 3.1375 98-99 3.1875 100-101 2.5875 102-103 2.3375 104-105 2.275 106-107 1.825 108-109 1.7500000000000002 110-111 1.825 112-113 1.4500000000000002 114-115 1.2375 116-117 1.1125 118-119 1.375 120-121 0.8625 122-123 0.125 124-125 0.1625 126 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49660206393153 98.825 2 0.37754845205134663 0.75 3 0.10067958721369243 0.3 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCTCGGTTCCGGTTCCGGTTCGTTAGGGTTTAGTGGGAGGAATGGCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.4125 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.9125 0.0 0.0 0.0 0.0 106-107 2.4 0.0 0.0 0.0 0.0 108-109 3.05 0.0 0.0 0.0 0.0 110-111 3.575 0.0 0.0 0.0 0.0 112-113 4.1 0.0 0.0 0.0 0.0 114 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra Read 921498 spots for ERR1744558.sra Written 921498 spots for ERR1744558.sra Read 921484 spots for ERR1744558.sra Written 921484 spots for ERR1744558.sra SRR ids: ['ERR1744558.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wleamuez ERR1744558.sra spots: 18429694 blocks: [[1, 921484], [921485, 1842968], [1842969, 2764452], [2764453, 3685936], [3685937, 4607420], [4607421, 5528904], [5528905, 6450388], [6450389, 7371872], [7371873, 8293356], [8293357, 9214840], [9214841, 10136324], [10136325, 11057808], [11057809, 11979292], [11979293, 12900776], [12900777, 13822260], [13822261, 14743744], [14743745, 15665228], [15665229, 16586712], [16586713, 17508196], [17508197, 18429694]] ERR1744558 file size 5323630 ERR1744558 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744558 ERR1744558_1.fastq ERR1744558_2.fastq Input file: ERR1744558_1.fastq Paired file: ERR1744558_2.fastq trimmed: ERR1744558-trimmed-pair1.fastq, ERR1744558-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:45:19 2024 >> started Sat Dec 7 00:45:38 2024 >> done (18.718s) 18429694 read pairs processed; of these: 15373 ( 0.08%) short read pairs filtered out after trimming by size control 20125 ( 0.11%) empty read pairs filtered out after trimming by size control 18394196 (99.81%) read pairs available; of these: 15923314 (86.57%) trimmed read pairs available after processing 2470882 (13.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 8 0.00% 21 12 0.00% 22 20 0.00% 23 22 0.00% 24 27 0.00% 25 29 0.00% 26 44 0.00% 27 32 0.00% 28 53 0.00% 29 66 0.00% 30 70 0.00% 31 86 0.00% 32 105 0.00% 33 114 0.00% 34 149 0.00% 35 173 0.00% 36 232 0.00% 37 232 0.00% 38 303 0.00% 39 343 0.00% 40 377 0.00% 41 467 0.00% 42 559 0.00% 43 636 0.00% 44 624 0.00% 45 772 0.00% 46 809 0.00% 47 1009 0.01% 48 1095 0.01% 49 1253 0.01% 50 1304 0.01% 51 1440 0.01% 52 1622 0.01% 53 1836 0.01% 54 2037 0.01% 55 2131 0.01% 56 2279 0.01% 57 2555 0.01% 58 2823 0.02% 59 3273 0.02% 60 3398 0.02% 61 3701 0.02% 62 4138 0.02% 63 4665 0.03% 64 4999 0.03% 65 5550 0.03% 66 6078 0.03% 67 6644 0.04% 68 7232 0.04% 69 7806 0.04% 70 8740 0.05% 71 9645 0.05% 72 10727 0.06% 73 11600 0.06% 74 12223 0.07% 75 13435 0.07% 76 14398 0.08% 77 15545 0.08% 78 16453 0.09% 79 17498 0.10% 80 18528 0.10% 81 19869 0.11% 82 21477 0.12% 83 23769 0.13% 84 25362 0.14% 85 26976 0.15% 86 29752 0.16% 87 32306 0.18% 88 35011 0.19% 89 37311 0.20% 90 43726 0.24% 91 49474 0.27% 92 45250 0.25% 93 47749 0.26% 94 51476 0.28% 95 54878 0.30% 96 58598 0.32% 97 63760 0.35% 98 68042 0.37% 99 72608 0.39% 100 77295 0.42% 101 83160 0.45% 102 89263 0.49% 103 96710 0.53% 104 103598 0.56% 105 111326 0.61% 106 120240 0.65% 107 126891 0.69% 108 135955 0.74% 109 146424 0.80% 110 158695 0.86% 111 171982 0.93% 112 189190 1.03% 113 206761 1.12% 114 228544 1.24% 115 249182 1.35% 116 277401 1.51% 117 314618 1.71% 118 363245 1.97% 119 422514 2.30% 120 509927 2.77% 121 637469 3.47% 122 823144 4.48% 123 1176276 6.39% 124 2048612 11.14% 125 6013455 32.69% 126 2470882 13.43% 18394196 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=32 prefix-density=0.49 prefix-fanout=2.1 sequence=CCAGTCTCCCTGTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=26 fanout-score=315.09 fanout-score-rank=1 prefix-density=1.08 prefix-fanout=25.0 sequence=CTTCTTCTTGTGCTC criterion=sequence-density sequence-density=0.79 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=38 prefix-density=0.78 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=24 fanout-score=200.91 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=23.6 sequence=CGCCGCCGCCGC ERR1744558 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:46:23 Started mapping on | Dec 07 00:46:23 Finished on | Dec 07 00:47:39 Mapping speed, Million of reads per hour | 871.30 Number of input reads | 18394196 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 17641774 Uniquely mapped reads % | 95.91% Average mapped length | 239.50 Number of splices: Total | 13968721 Number of splices: Annotated (sjdb) | 13070080 Number of splices: GT/AG | 13777267 Number of splices: GC/AG | 147589 Number of splices: AT/AC | 6430 Number of splices: Non-canonical | 37435 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.50 Insertion rate per base | 0.02% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 323203 % of reads mapped to multiple loci | 1.76% Number of reads mapped to too many loci | 26381 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.57% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 437388 437388 437388 N_multimapping 323203 323203 323203 N_noFeature 890712 17166438 1013681 N_ambiguous 400442 2684 48616 UnstrandedReadsAssigned:16350620 PositiveStrandReadsAssigned:472652 NegativeStrandReadsAssigned:16579477 Dataset is classified negative stranded MeadianReadLen=123 20thPercentileLength=111 echo kmer=107 ERR1744558 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744558-trimmed-pair1.fastq ERR1744558-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,394,196 reads, 16,633,171 reads pseudoaligned [quant] estimated average fragment length: 205.592 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 ERR1744558.ke.tsv 35125 ERR1744558.se.tsv 88098 total ==> ERR1744558.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 731.745 0 0 PNS24247 1044 839.408 77.4145 7.68833 PNS24249 1928 1723.41 116.768 5.64831 PNS24246 1044 839.408 77.4145 7.68833 PNS24248 1044 839.408 77.4145 7.68833 PNS24244 1471 1266.41 170.988 11.2558 PNS24243 293 111.254 1 0.749319 KQK14069 1603 1398.41 19364.4 1154.39 KQK14071 474 273.405 1521.09 463.802 ==> ERR1744558.se.tsv <== BRADI_1g14170v3 30133 BRADI_1g53295v3 417 BRADI_1g59795v3 115 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 405 BRADI_1g74790v3 273 BRADI_1g09890v3 0 BRADI_1g77505v3 280 BRADI_1g48960v3 0 ERR1744558 completed mapping pipeline successfully