Starting /dee2/code/volunteer_pipeline.sh ERR1744559 current disk space = 1548138639360 free memory = 1596760564 ERR1744559 SRAfilesize 0e8e88c56b05df3238ebb26642b05636 ERR1744559.sra ERR1744559.sra file validated ERR1744559 is paired end ERR1744559 is conventional basespace ERR1744559 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744559_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.178 34.0 33.0 34.0 32.0 34.0 2 33.3015 34.0 33.0 34.0 32.0 34.0 3 33.29 34.0 33.0 34.0 33.0 34.0 4 33.19975 34.0 33.0 34.0 32.0 34.0 5 33.24425 34.0 33.0 34.0 32.0 34.0 6 36.81675 38.0 37.0 38.0 35.0 38.0 7 37.29175 38.0 38.0 38.0 37.0 38.0 8 37.405 38.0 38.0 38.0 37.0 38.0 9 37.4715 38.0 38.0 38.0 37.0 38.0 10-11 37.4765 38.0 38.0 38.0 37.0 38.0 12-13 37.436125 38.0 38.0 38.0 37.5 38.0 14-15 37.45475 38.0 38.0 38.0 37.5 38.0 16-17 37.388999999999996 38.0 38.0 38.0 37.0 38.0 18-19 37.393249999999995 38.0 38.0 38.0 37.0 38.0 20-21 37.361125 38.0 38.0 38.0 37.0 38.0 22-23 37.36875 38.0 38.0 38.0 37.0 38.0 24-25 37.34 38.0 38.0 38.0 37.0 38.0 26-27 37.3175 38.0 38.0 38.0 37.0 38.0 28-29 37.224125 38.0 38.0 38.0 36.5 38.0 30-31 37.2715 38.0 38.0 38.0 37.0 38.0 32-33 37.1525 38.0 38.0 38.0 36.0 38.0 34-35 37.052875 38.0 38.0 38.0 36.0 38.0 36-37 37.091875 38.0 38.0 38.0 36.0 38.0 38-39 37.032375 38.0 38.0 38.0 36.0 38.0 40-41 36.92475 38.0 38.0 38.0 36.0 38.0 42-43 36.984125 38.0 38.0 38.0 36.0 38.0 44-45 36.86275 38.0 38.0 38.0 35.0 38.0 46-47 36.831625 38.0 38.0 38.0 35.0 38.0 48-49 36.689875 38.0 38.0 38.0 35.0 38.0 50-51 36.62375 38.0 38.0 38.0 34.0 38.0 52-53 36.216875 38.0 38.0 38.0 33.5 38.0 54-55 36.01975 38.0 37.5 38.0 31.5 38.0 56-57 35.9975 38.0 37.0 38.0 32.0 38.0 58-59 35.368624999999994 38.0 37.0 38.0 30.0 38.0 60-61 35.386125 38.0 37.0 38.0 29.0 38.0 62-63 35.361875 38.0 37.0 38.0 29.5 38.0 64-65 34.985875 38.0 36.5 38.0 28.0 38.0 66-67 35.122875 38.0 36.5 38.0 29.0 38.0 68-69 34.94225 38.0 36.0 38.0 29.0 38.0 70-71 34.645375 38.0 35.5 38.0 27.5 38.0 72-73 34.079875 38.0 34.0 38.0 23.5 38.0 74-75 33.750249999999994 38.0 33.5 38.0 21.5 38.0 76-77 33.751125 38.0 34.0 38.0 22.0 38.0 78-79 33.603625 38.0 33.5 38.0 21.0 38.0 80-81 32.931375 38.0 33.0 38.0 14.0 38.0 82-83 32.572874999999996 38.0 31.5 38.0 14.0 38.0 84-85 32.464625 38.0 31.0 38.0 14.0 38.0 86-87 32.091625 38.0 30.5 38.0 14.0 38.0 88-89 31.806625 37.0 30.0 38.0 14.0 38.0 90-91 31.437125 37.0 29.5 38.0 14.0 38.0 92-93 31.116500000000002 37.0 29.0 38.0 13.5 38.0 94-95 30.762999999999998 37.0 28.5 38.0 13.0 38.0 96-97 30.75425 37.0 29.0 38.0 12.5 38.0 98-99 29.81325 36.0 26.0 38.0 11.0 38.0 100-101 29.146 35.5 24.0 38.0 6.5 38.0 102-103 28.3265 34.0 21.5 38.0 2.0 38.0 104-105 27.478375 33.5 17.0 38.0 2.0 38.0 106-107 27.4015 33.0 18.5 38.0 2.0 38.0 108-109 26.759625 33.0 16.0 38.0 2.0 38.0 110-111 25.752875 33.0 14.0 38.0 2.0 38.0 112-113 25.172625 31.5 13.5 38.0 2.0 38.0 114-115 24.622875 31.0 12.5 37.5 2.0 38.0 116-117 23.544375000000002 29.0 11.0 37.0 2.0 38.0 118-119 22.664125 29.0 2.0 37.0 2.0 38.0 120-121 21.806874999999998 28.0 2.0 37.0 2.0 38.0 122-123 20.252375 26.5 2.0 36.5 2.0 38.0 124-125 17.582250000000002 10.5 2.0 36.0 2.0 38.0 126 7.8585 2.0 2.0 2.0 2.0 31.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 2.0 8 1.0 9 0.0 10 3.0 11 5.0 12 8.0 13 3.0 14 13.0 15 12.0 16 10.0 17 18.0 18 22.0 19 18.0 20 26.0 21 27.0 22 40.0 23 47.0 24 52.0 25 65.0 26 99.0 27 78.0 28 113.0 29 140.0 30 155.0 31 210.0 32 243.0 33 380.0 34 504.0 35 651.0 36 780.0 37 274.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.09554777388694 7.303651825912956 7.228614307153578 44.37218609304652 2 26.25 9.675 30.875000000000004 33.2 3 25.374999999999996 12.9 20.424999999999997 41.3 4 29.95 20.025000000000002 19.175 30.85 5 29.825000000000003 23.825 22.7 23.65 6 24.025 30.15 23.549999999999997 22.275 7 18.325 20.0 42.125 19.55 8 21.775 22.725 31.25 24.25 9 20.375 20.575 34.55 24.5 10-11 22.5875 29.575000000000003 24.9125 22.925 12-13 22.925 23.849999999999998 27.500000000000004 25.724999999999998 14-15 23.1125 25.162499999999998 27.55 24.175 16-17 24.975 23.7 25.9875 25.337500000000002 18-19 24.349999999999998 24.2875 25.55 25.8125 20-21 23.075000000000003 24.712500000000002 26.55 25.662499999999998 22-23 23.9375 24.55 26.2625 25.25 24-25 23.2375 25.137500000000003 24.625 27.0 26-27 23.674999999999997 24.099999999999998 25.525 26.700000000000003 28-29 23.799999999999997 25.2 25.2625 25.7375 30-31 24.1625 24.887500000000003 24.9125 26.0375 32-33 23.5 24.625 26.125 25.75 34-35 23.674999999999997 24.087500000000002 25.687500000000004 26.55 36-37 24.0625 24.0 25.75 26.187500000000004 38-39 23.1625 24.425 25.6 26.8125 40-41 23.974999999999998 25.575 24.375 26.075 42-43 24.075 24.1375 25.7625 26.025 44-45 23.25 24.25 26.187500000000004 26.3125 46-47 23.5375 24.1125 25.5375 26.8125 48-49 24.325 23.95 25.637500000000003 26.087500000000002 50-51 23.1875 24.5 25.5625 26.75 52-53 23.9 24.5625 25.650000000000002 25.887500000000003 54-55 23.925 24.1875 25.4375 26.450000000000003 56-57 23.549999999999997 24.6875 25.324999999999996 26.437500000000004 58-59 24.253075571177504 25.53351744915893 23.763494853125785 26.449912126537782 60-61 23.847897255099472 24.364140015109545 25.4973558297658 26.290606900025182 62-63 23.43238478972551 24.61596575169982 26.454293628808866 25.4973558297658 64-65 23.744349573078853 24.924660974384732 25.276243093922652 26.054746358613762 66-67 24.485183324962332 24.786539427423403 25.10045203415369 25.62782521346057 68-69 23.489511367918603 24.255746765481724 25.913829920864213 26.340911945735463 70-71 23.067237471669603 24.28859229413246 26.2150591790481 26.429111055149836 72-73 24.735116044399597 24.419778002018163 25.819878910191722 25.02522704339051 74-75 24.126182965299684 23.823343848580443 25.71608832807571 26.334384858044164 76-77 24.442203453926638 24.65649817219211 25.702760620194127 25.198537753687127 78-79 24.280666330136295 24.495204442200908 25.567895002523976 25.656234225138817 80-81 23.720050441361916 24.854981084489282 25.825977301387137 25.598991172761664 82-83 24.16267942583732 24.867791488290102 24.691513472676906 26.27801561319567 84-85 24.467017807875596 24.429395535490343 24.166039628793577 26.93754702784048 86-87 23.317036479879654 24.921649743011155 26.23793406042372 25.52337971668547 88-89 24.514350169194135 24.376488281739565 25.166060909888454 25.943100639177842 90-91 23.86676684197345 25.469571750563485 23.86676684197345 26.79689456548961 92-93 23.771929824561404 25.32581453634085 25.050125313283207 25.85213032581454 94-95 24.385656970912738 24.611334002006018 25.438816449348046 25.5641925777332 96-97 24.229902329075884 25.231655396944653 24.818432256448787 25.720010017530683 98-99 22.820223309496924 24.66440848074269 26.458411742566806 26.056956467193576 100-101 23.513920240782543 24.91848507649862 25.344870830198147 26.22272385252069 102-103 24.078254326561325 24.078254326561325 25.445196889892152 26.398294456985198 104-105 23.20637732506643 24.99050993293686 26.799949386308995 25.003163355687715 106-107 24.58312278928752 23.711470439615965 26.402223345123797 25.303183425972716 108-109 23.75585665442573 25.022160314043308 25.174116753197417 26.047866278333544 110-111 23.79621394994283 24.355228052344046 25.42243679329183 26.426121204421293 112-113 24.6001523229246 24.87941101802488 25.082508250825082 25.437928408225435 114-115 23.955820743938048 23.549574711184462 26.02513647327663 26.469468071600865 116-117 24.28244856489713 24.815849631699262 25.20955041910084 25.69215138430277 118-119 25.063580874872837 24.45320447609359 25.19074262461852 25.29247202441506 120-121 24.790129737980156 24.955482065632154 24.548460951411855 25.705927244975836 122-123 24.063694267515924 25.312101910828027 24.522292993630572 26.101910828025478 124-125 24.14624857179129 25.009521391392664 24.654056112733276 26.19017392408277 126 27.3027150469424 20.32479066226846 26.439989850291806 25.932504440497333 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 1.0 24 2.0 25 2.0 26 1.5 27 2.0 28 4.5 29 6.0 30 6.0 31 9.5 32 15.0 33 19.5 34 31.5 35 39.5 36 45.0 37 66.5 38 88.0 39 96.0 40 111.5 41 137.5 42 157.0 43 157.0 44 165.5 45 181.0 46 181.5 47 182.5 48 178.0 49 168.0 50 171.5 51 161.5 52 136.5 53 113.5 54 94.5 55 103.0 56 107.0 57 90.0 58 81.0 59 80.5 60 79.5 61 75.0 62 74.5 63 69.5 64 63.0 65 60.0 66 49.5 67 51.0 68 55.5 69 50.0 70 44.0 71 37.0 72 27.5 73 19.5 74 15.5 75 11.5 76 7.0 77 7.0 78 4.5 79 2.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.42500000000000004 60-61 0.7250000000000001 62-63 0.7250000000000001 64-65 0.44999999999999996 66-67 0.44999999999999996 68-69 0.4875 70-71 0.7250000000000001 72-73 0.8999999999999999 74-75 0.9375 76-77 0.8375 78-79 0.95 80-81 0.8750000000000001 82-83 0.7250000000000001 84-85 0.325 86-87 0.2875 88-89 0.2625 90-91 0.17500000000000002 92-93 0.25 94-95 0.3 96-97 0.17500000000000002 98-99 0.36250000000000004 100-101 0.325 102-103 0.325 104-105 1.2125000000000001 106-107 1.05 108-109 1.2874999999999999 110-111 1.6125 112-113 1.525 114-115 1.5375 116-117 1.575 118-119 1.7000000000000002 120-121 1.725 122-123 1.875 124-125 1.5375 126 1.4749999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.775 #Duplication Level Percentage of deduplicated Percentage of total 1 98.96228802834726 97.75 2 0.8605416350291066 1.7000000000000002 3 0.15186028853454822 0.44999999999999996 4 0.02531004808909137 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6375 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.275 0.0 0.0 0.0 0.0 114 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744559 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744559_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.366 33.0 33.0 34.0 32.0 34.0 2 32.697 34.0 33.0 34.0 32.0 34.0 3 32.78275 34.0 33.0 34.0 32.0 34.0 4 32.755 34.0 33.0 34.0 32.0 34.0 5 32.696 34.0 33.0 34.0 31.0 34.0 6 36.40125 38.0 38.0 38.0 35.0 38.0 7 36.2595 38.0 38.0 38.0 35.0 38.0 8 36.30675 38.0 38.0 38.0 35.0 38.0 9 36.0785 38.0 38.0 38.0 34.0 38.0 10-11 35.79625 38.0 38.0 38.0 34.0 38.0 12-13 35.558625 38.0 38.0 38.0 33.0 38.0 14-15 35.46125 38.0 38.0 38.0 33.0 38.0 16-17 35.50975 38.0 38.0 38.0 33.0 38.0 18-19 35.419875 38.0 38.0 38.0 32.5 38.0 20-21 35.327375 38.0 38.0 38.0 31.0 38.0 22-23 35.414125 38.0 38.0 38.0 32.5 38.0 24-25 35.538 38.0 38.0 38.0 33.0 38.0 26-27 35.47125 38.0 38.0 38.0 33.0 38.0 28-29 35.8735 38.0 38.0 38.0 33.0 38.0 30-31 36.144625000000005 38.0 38.0 38.0 33.5 38.0 32-33 36.417249999999996 38.0 38.0 38.0 35.0 38.0 34-35 36.43475 38.0 38.0 38.0 35.0 38.0 36-37 36.360375 38.0 38.0 38.0 35.0 38.0 38-39 36.259875 38.0 38.0 38.0 34.0 38.0 40-41 36.3395 38.0 38.0 38.0 34.0 38.0 42-43 36.31125 38.0 38.0 38.0 34.0 38.0 44-45 36.3575 38.0 38.0 38.0 34.5 38.0 46-47 36.305499999999995 38.0 38.0 38.0 34.5 38.0 48-49 36.107 38.0 38.0 38.0 34.0 38.0 50-51 35.856750000000005 38.0 38.0 38.0 34.0 38.0 52-53 35.611999999999995 38.0 38.0 38.0 33.0 38.0 54-55 35.536375 38.0 38.0 38.0 32.0 38.0 56-57 35.475624999999994 38.0 38.0 38.0 32.5 38.0 58-59 35.481875 38.0 38.0 38.0 33.0 38.0 60-61 35.264875 38.0 37.5 38.0 30.5 38.0 62-63 35.211875 38.0 37.5 38.0 29.0 38.0 64-65 34.954 38.0 37.0 38.0 29.0 38.0 66-67 34.979875 38.0 37.0 38.0 28.5 38.0 68-69 34.730000000000004 38.0 37.0 38.0 27.0 38.0 70-71 34.67175 38.0 37.0 38.0 27.5 38.0 72-73 34.36125 38.0 36.5 38.0 25.0 38.0 74-75 34.333 38.0 36.5 38.0 24.0 38.0 76-77 34.13825 38.0 36.0 38.0 22.5 38.0 78-79 34.142250000000004 38.0 36.0 38.0 23.0 38.0 80-81 33.8665 38.0 35.5 38.0 22.0 38.0 82-83 33.644000000000005 38.0 34.5 38.0 20.5 38.0 84-85 33.62575 38.0 35.0 38.0 19.5 38.0 86-87 33.707750000000004 38.0 35.5 38.0 21.0 38.0 88-89 33.557 38.0 35.0 38.0 18.5 38.0 90-91 33.049 38.0 34.0 38.0 14.0 38.0 92-93 32.554249999999996 38.0 33.0 38.0 14.0 38.0 94-95 32.352000000000004 38.0 33.0 38.0 13.5 38.0 96-97 32.23475 38.0 33.0 38.0 14.0 38.0 98-99 32.303875 38.0 33.0 38.0 13.0 38.0 100-101 31.96875 38.0 31.5 38.0 13.0 38.0 102-103 32.089375 38.0 32.0 38.0 13.5 38.0 104-105 31.817 38.0 31.0 38.0 13.0 38.0 106-107 31.62425 38.0 31.0 38.0 12.0 38.0 108-109 31.192375 38.0 30.0 38.0 11.0 38.0 110-111 30.723875 37.0 28.5 38.0 11.0 38.0 112-113 30.107625 37.0 27.5 38.0 6.5 38.0 114-115 29.662750000000003 36.5 26.5 38.0 2.0 38.0 116-117 29.719875000000002 36.5 27.5 38.0 2.0 38.0 118-119 29.065625 36.0 24.5 38.0 2.0 38.0 120-121 28.522875 36.0 23.0 38.0 2.0 38.0 122-123 27.808374999999998 36.0 21.0 38.0 2.0 38.0 124-125 25.980375000000002 35.0 7.5 38.0 2.0 38.0 126 12.6635 2.0 2.0 27.0 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 11.0 4 3.0 5 2.0 6 2.0 7 6.0 8 26.0 9 23.0 10 15.0 11 4.0 12 2.0 13 12.0 14 13.0 15 9.0 16 16.0 17 18.0 18 15.0 19 17.0 20 17.0 21 17.0 22 26.0 23 18.0 24 29.0 25 32.0 26 33.0 27 42.0 28 58.0 29 78.0 30 97.0 31 99.0 32 135.0 33 178.0 34 257.0 35 451.0 36 956.0 37 1253.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.38938053097345 17.168141592920357 13.653603034134006 36.78887484197219 2 29.075 22.125 29.349999999999998 19.45 3 23.28492739108663 25.81372058087131 26.039058587881826 24.86229344016024 4 26.870152614460846 29.87240430322742 20.84063047285464 22.416812609457093 5 27.414095811387007 32.10433910208177 20.165537998495108 20.31602708803612 6 23.606889564336374 35.38500506585613 19.427558257345492 21.580547112462007 7 22.85568847034869 17.714431152965133 34.588953932298296 24.840926444387883 8 23.27718223583461 23.940786115364983 24.502297090352222 28.27973455844819 9 24.480369515011546 22.60713369258404 27.25173210161663 25.660764690787786 10-11 25.998190980746866 28.33699444372658 21.488564414006976 24.176250161519576 12-13 25.061808718282368 23.6174365647365 24.879635653871176 26.44111906310995 14-15 25.403645833333332 24.869791666666664 24.765625 24.9609375 16-17 25.930747201249677 24.91538661806821 24.433741213225723 24.720124967456393 18-19 24.453409682457053 26.015096304008328 24.297241020301925 25.23425299323269 20-21 25.153374233128833 25.610233650959408 24.513771048166035 24.722621067745727 22-23 25.66601689408707 23.911630929174787 24.379467186484728 26.042884990253413 24-25 25.398470908384084 25.08746922379163 25.32072048723597 24.19333938058831 26-27 24.94472623227988 25.55598907530238 24.00832357913903 25.490961113278708 28-29 26.737217901313272 24.276424837434654 24.04692082111437 24.9394364401377 30-31 24.757587205641606 25.18574486840448 25.097594761365066 24.959073164588844 32-33 25.0 26.292670682730922 24.42269076305221 24.284638554216865 34-35 24.79276563677468 25.106757096206984 25.018839487565934 25.081637779452397 36-37 24.790179130652636 24.82775898784918 25.629462608042093 24.752599273456095 38-39 25.451127819548873 25.802005012531325 23.696741854636592 25.050125313283207 40-41 25.768025078369906 25.304075235109718 23.73667711598746 25.19122257053292 42-43 25.650000000000002 25.112499999999997 24.15 25.087500000000002 44-45 26.01127113337508 26.086412022542266 24.83406386975579 23.068252974326864 46-47 26.224999999999998 25.624999999999996 23.875 24.275 48-49 26.00783520788576 25.325413875900416 25.022115506129154 23.64463541008467 50-51 26.121405750798722 25.95527156549521 23.94888178913738 23.97444089456869 52-53 25.609443161406208 25.28868360277136 24.275083397485243 24.82678983833718 54-55 26.73810435004465 25.0159459114683 24.531190202831993 23.71475953565506 56-57 26.06348798354967 24.99678704536692 24.89397249710834 24.045752473975067 58-59 25.79278469636667 24.84272692258313 24.77853382975992 24.585954551290282 60-61 26.1473197069032 24.823242061961693 24.309037151304793 24.72040107983031 62-63 26.725025746652936 25.952626158599383 23.815653964984552 23.50669412976313 64-65 26.214965286706093 25.083569040884544 24.247878632039086 24.453587040370277 66-67 25.657894736842106 25.29669762641899 24.4969040247678 24.548503611971103 68-69 25.583494519664736 25.13217279174726 25.01611863313991 24.268214055448098 70-71 26.62959130884635 24.637868598034142 24.59906880496637 24.13347128815313 72-73 26.499806476583665 25.05483163462779 24.796800412849954 23.64856147593859 74-75 25.1062733479325 25.84052557001159 24.46219245137189 24.591008630684012 76-77 25.783439490445858 24.64968152866242 25.299363057324843 24.26751592356688 78-79 27.083071509362828 23.82807590800553 24.770642201834864 24.31821038079678 80-81 26.515531062124246 25.789078156312623 23.847695390781563 23.847695390781563 82-83 26.72348959639007 24.354474805715718 24.880922536976684 24.041113060917525 84-85 26.014109347442684 25.144872763920382 24.514991181657848 24.326026706979086 86-87 25.628013194620653 25.31083481349911 24.638416645521442 24.42273534635879 88-89 25.908332263448454 25.073822056746693 24.32918217999743 24.68866349980742 90-91 26.232258064516127 24.748387096774195 24.81290322580645 24.206451612903226 92-93 25.596782563570315 25.661650233523613 23.61183186299948 25.12973533990659 94-95 25.623376623376625 25.545454545454543 24.896103896103895 23.935064935064933 96-97 26.501356063541266 25.51982435748418 24.589952214903786 23.388867364070773 98-99 25.76933023015257 26.11843806568399 23.959141453322992 24.153090250840446 100-101 25.860739979445015 25.423946557040082 24.07502569373073 24.640287769784173 102-103 26.063557150179395 25.845720143516143 24.64120963608406 23.449513070220398 104-105 26.20451050743209 25.1922091235264 23.859559200410047 24.74372116863147 106-107 26.2654596455438 25.01593777891113 25.066938671426747 23.651663904118323 108-109 26.207160147789526 24.550898203592812 24.729264874506306 24.512676774111352 110-111 27.061822817080945 25.20076481835564 23.989802421924793 23.747609942638622 112-113 26.476190476190474 25.193650793650797 24.19047619047619 24.13968253968254 114-115 25.734177215189874 26.0 24.0 24.265822784810126 116-117 26.82772577789021 25.06956741715153 24.17151530483177 23.931191500126488 118-119 26.883083946233832 25.944712148110575 23.231042353537916 23.941161552117677 120-121 26.96288815955567 25.637465286543804 23.908104014137844 23.491542539762687 122-123 27.023302430468554 25.72037083437735 23.314958656978202 23.941368078175895 124-125 26.97417899222863 25.482577086989224 23.564803208824266 23.978440711957884 126 28.225806451612907 23.336693548387096 23.336693548387096 25.100806451612907 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 2.0 5 4.0 6 4.0 7 1.5 8 1.5 9 2.5 10 2.0 11 1.5 12 3.0 13 4.5 14 6.0 15 9.5 16 9.0 17 9.5 18 7.5 19 4.0 20 4.0 21 6.5 22 7.5 23 4.5 24 5.0 25 5.0 26 5.0 27 9.5 28 11.5 29 10.0 30 11.5 31 13.5 32 13.5 33 14.5 34 24.0 35 41.5 36 52.0 37 57.0 38 80.5 39 99.5 40 106.5 41 125.0 42 133.5 43 150.0 44 165.5 45 166.5 46 175.0 47 167.5 48 159.5 49 164.0 50 159.5 51 145.5 52 132.0 53 117.5 54 107.5 55 107.0 56 97.5 57 93.0 58 97.0 59 86.5 60 85.5 61 84.5 62 75.5 63 73.0 64 64.5 65 61.5 66 59.0 67 52.5 68 48.5 69 39.0 70 36.0 71 33.5 72 25.0 73 18.0 74 11.0 75 11.5 76 9.0 77 3.0 78 1.5 79 0.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.15 4 0.075 5 0.325 6 1.3 7 1.775 8 2.0500000000000003 9 2.5749999999999997 10-11 3.2625 12-13 3.9375 14-15 4.0 16-17 3.975 18-19 3.95 20-21 4.237500000000001 22-23 3.8125 24-25 3.5374999999999996 26-27 3.8875 28-29 1.9625 30-31 0.7374999999999999 32-33 0.4 34-35 0.475 36-37 0.21250000000000002 38-39 0.25 40-41 0.3125 42-43 0.0 44-45 0.1875 46-47 0.0 48-49 1.0875 50-51 2.1875 52-53 2.5749999999999997 54-55 2.0125 56-57 2.7375 58-59 2.6374999999999997 60-61 2.7625 62-63 2.9000000000000004 64-65 2.775 66-67 3.1 68-69 3.0625 70-71 3.35 72-73 3.1125 74-75 2.9625 76-77 1.875 78-79 0.5375 80-81 0.2 82-83 0.27499999999999997 84-85 0.775 86-87 1.4749999999999999 88-89 2.6374999999999997 90-91 3.125 92-93 3.65 94-95 3.75 96-97 3.2125 98-99 3.325 100-101 2.7 102-103 2.45 104-105 2.45 106-107 1.9625 108-109 1.8875 110-111 1.9375 112-113 1.5625 114-115 1.25 116-117 1.175 118-119 1.425 120-121 0.975 122-123 0.22499999999999998 124-125 0.27499999999999997 126 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.6813020439061317 1.35 3 0.12616704516780217 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.4875 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.3125 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.8875 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114 2.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993370 spots for ERR1744559.sra Written 993370 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra Read 993360 spots for ERR1744559.sra Written 993360 spots for ERR1744559.sra SRR ids: ['ERR1744559.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_22y7jpg0 ERR1744559.sra spots: 19867210 blocks: [[1, 993360], [993361, 1986720], [1986721, 2980080], [2980081, 3973440], [3973441, 4966800], [4966801, 5960160], [5960161, 6953520], [6953521, 7946880], [7946881, 8940240], [8940241, 9933600], [9933601, 10926960], [10926961, 11920320], [11920321, 12913680], [12913681, 13907040], [13907041, 14900400], [14900401, 15893760], [15893761, 16887120], [16887121, 17880480], [17880481, 18873840], [18873841, 19867210]] ERR1744559 file size 5740566 ERR1744559 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744559 ERR1744559_1.fastq ERR1744559_2.fastq Input file: ERR1744559_1.fastq Paired file: ERR1744559_2.fastq trimmed: ERR1744559-trimmed-pair1.fastq, ERR1744559-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:46:40 2024 >> started Sat Dec 7 00:46:58 2024 >> done (18.412s) 19867210 read pairs processed; of these: 20080 ( 0.10%) short read pairs filtered out after trimming by size control 19930 ( 0.10%) empty read pairs filtered out after trimming by size control 19827200 (99.80%) read pairs available; of these: 17081365 (86.15%) trimmed read pairs available after processing 2745835 (13.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 10 0.00% 20 8 0.00% 21 14 0.00% 22 13 0.00% 23 17 0.00% 24 16 0.00% 25 30 0.00% 26 51 0.00% 27 40 0.00% 28 49 0.00% 29 67 0.00% 30 73 0.00% 31 82 0.00% 32 115 0.00% 33 115 0.00% 34 135 0.00% 35 178 0.00% 36 204 0.00% 37 270 0.00% 38 300 0.00% 39 365 0.00% 40 391 0.00% 41 480 0.00% 42 548 0.00% 43 635 0.00% 44 708 0.00% 45 774 0.00% 46 844 0.00% 47 948 0.00% 48 1084 0.01% 49 1203 0.01% 50 1259 0.01% 51 1500 0.01% 52 1635 0.01% 53 1812 0.01% 54 1956 0.01% 55 2183 0.01% 56 2397 0.01% 57 2509 0.01% 58 2938 0.01% 59 3078 0.02% 60 3413 0.02% 61 3696 0.02% 62 4094 0.02% 63 4614 0.02% 64 4948 0.02% 65 5474 0.03% 66 5931 0.03% 67 6743 0.03% 68 7193 0.04% 69 7849 0.04% 70 8795 0.04% 71 9691 0.05% 72 10542 0.05% 73 11586 0.06% 74 12398 0.06% 75 13020 0.07% 76 14090 0.07% 77 15149 0.08% 78 15725 0.08% 79 16607 0.08% 80 17761 0.09% 81 19184 0.10% 82 20625 0.10% 83 21802 0.11% 84 23583 0.12% 85 25397 0.13% 86 27248 0.14% 87 29775 0.15% 88 31975 0.16% 89 34360 0.17% 90 40318 0.20% 91 47078 0.24% 92 40598 0.20% 93 42966 0.22% 94 46034 0.23% 95 48733 0.25% 96 51983 0.26% 97 56046 0.28% 98 60402 0.30% 99 64681 0.33% 100 69792 0.35% 101 75086 0.38% 102 80502 0.41% 103 87151 0.44% 104 94186 0.48% 105 101221 0.51% 106 109860 0.55% 107 117304 0.59% 108 126484 0.64% 109 136922 0.69% 110 150151 0.76% 111 163148 0.82% 112 181911 0.92% 113 201715 1.02% 114 223728 1.13% 115 249091 1.26% 116 278926 1.41% 117 321361 1.62% 118 376147 1.90% 119 445398 2.25% 120 542352 2.74% 121 684724 3.45% 122 899854 4.54% 123 1300420 6.56% 124 2302337 11.61% 125 6798447 34.29% 126 2745835 13.85% 19827200 reads passed initial QC criterion=sequence-density sequence-density=0.25 sequence-density-rank=1 fanout-score=5.97 fanout-score-rank=14 prefix-density=0.32 prefix-fanout=4.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=257.78 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=26.8 sequence=CTTCTTCTTGTGCTC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=40 prefix-density=0.54 prefix-fanout=2.1 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=99.61 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.8 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTT ERR1744559 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:47:37 Started mapping on | Dec 07 00:47:37 Finished on | Dec 07 00:48:54 Mapping speed, Million of reads per hour | 926.99 Number of input reads | 19827200 Average input read length | 241 UNIQUE READS: Uniquely mapped reads number | 18964476 Uniquely mapped reads % | 95.65% Average mapped length | 240.67 Number of splices: Total | 14968008 Number of splices: Annotated (sjdb) | 14024318 Number of splices: GT/AG | 14761972 Number of splices: GC/AG | 160096 Number of splices: AT/AC | 5693 Number of splices: Non-canonical | 40247 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 400492 % of reads mapped to multiple loci | 2.02% Number of reads mapped to too many loci | 38913 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.26% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 474159 474159 474159 N_multimapping 400492 400492 400492 N_noFeature 1005914 18454295 1142524 N_ambiguous 427490 2973 54452 UnstrandedReadsAssigned:17531072 PositiveStrandReadsAssigned:507208 NegativeStrandReadsAssigned:17767500 Dataset is classified negative stranded MeadianReadLen=124 20thPercentileLength=112 echo kmer=107 ERR1744559 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744559-trimmed-pair1.fastq ERR1744559-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,827,200 reads, 17,831,413 reads pseudoaligned [quant] estimated average fragment length: 206.513 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 ERR1744559.ke.tsv 35125 ERR1744559.se.tsv 88098 total ==> ERR1744559.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 730.734 0 0 PNS24247 1044 838.487 65.7177 5.966 PNS24249 1928 1722.49 73.2801 3.23838 PNS24246 1044 838.487 65.7177 5.966 PNS24248 1044 838.487 65.7177 5.966 PNS24244 1471 1265.49 139.567 8.39501 PNS24243 293 105.771 0 0 KQK14069 1603 1397.49 13022.3 709.31 KQK14071 474 271.792 984.672 275.773 ==> ERR1744559.se.tsv <== BRADI_1g14170v3 20263 BRADI_1g53295v3 318 BRADI_1g59795v3 152 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 412 BRADI_1g74790v3 356 BRADI_1g09890v3 0 BRADI_1g77505v3 270 BRADI_1g48960v3 0 ERR1744559 completed mapping pipeline successfully