Starting /dee2/code/volunteer_pipeline.sh ERR1744560 current disk space = 1548186619904 free memory = 1596942580 ERR1744560 SRAfilesize 83ed6f602a0e0fbc71ba4711f7c39020 ERR1744560.sra ERR1744560.sra file validated ERR1744560 is paired end ERR1744560 is conventional basespace ERR1744560 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744560_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.491 18.0 18.0 28.0 18.0 33.0 2 27.50075 28.0 27.0 31.0 18.0 33.0 3 28.63875 29.0 27.0 31.0 25.0 33.0 4 31.5455 33.0 31.0 33.0 29.0 33.0 5 31.296 33.0 31.0 33.0 29.0 33.0 6 35.92875 37.0 36.0 38.0 33.0 38.0 7 36.7945 38.0 37.0 38.0 34.0 38.0 8 36.76525 38.0 37.0 38.0 34.0 38.0 9 37.186 38.0 38.0 38.0 36.0 38.0 10-11 37.35975 38.0 38.0 38.0 36.5 38.0 12-13 37.411125 38.0 38.0 38.0 37.0 38.0 14-15 37.443875 38.0 38.0 38.0 37.0 38.0 16-17 37.427375 38.0 38.0 38.0 37.0 38.0 18-19 37.51975 38.0 38.0 38.0 37.0 38.0 20-21 37.4855 38.0 38.0 38.0 37.5 38.0 22-23 37.434375 38.0 38.0 38.0 37.0 38.0 24-25 37.496750000000006 38.0 38.0 38.0 37.0 38.0 26-27 37.379875 38.0 38.0 38.0 37.0 38.0 28-29 37.394125 38.0 38.0 38.0 37.0 38.0 30-31 37.360749999999996 38.0 38.0 38.0 37.0 38.0 32-33 37.432249999999996 38.0 38.0 38.0 37.0 38.0 34-35 37.364 38.0 38.0 38.0 37.0 38.0 36-37 37.2995 38.0 38.0 38.0 37.0 38.0 38-39 37.26325 38.0 38.0 38.0 36.5 38.0 40-41 37.214125 38.0 38.0 38.0 36.5 38.0 42-43 37.249375 38.0 38.0 38.0 36.5 38.0 44-45 37.13225 38.0 38.0 38.0 36.0 38.0 46-47 37.221500000000006 38.0 38.0 38.0 36.0 38.0 48-49 37.1425 38.0 38.0 38.0 36.5 38.0 50-51 37.08575 38.0 38.0 38.0 36.0 38.0 52-53 37.094375 38.0 38.0 38.0 36.0 38.0 54-55 36.998000000000005 38.0 38.0 38.0 35.5 38.0 56-57 36.974125 38.0 38.0 38.0 35.5 38.0 58-59 36.878125 38.0 38.0 38.0 35.0 38.0 60-61 36.851124999999996 38.0 38.0 38.0 35.0 38.0 62-63 36.84725 38.0 38.0 38.0 35.0 38.0 64-65 36.735125 38.0 38.0 38.0 34.5 38.0 66-67 36.703500000000005 38.0 38.0 38.0 34.0 38.0 68-69 36.608125 38.0 38.0 38.0 34.0 38.0 70-71 36.491 38.0 38.0 38.0 34.0 38.0 72-73 36.666375 38.0 38.0 38.0 34.0 38.0 74-75 36.416624999999996 38.0 38.0 38.0 34.0 38.0 76-77 36.377125 38.0 38.0 38.0 34.0 38.0 78-79 36.14875 38.0 37.0 38.0 32.0 38.0 80-81 36.014375 38.0 37.0 38.0 31.5 38.0 82-83 35.885125 38.0 37.0 38.0 31.0 38.0 84-85 36.004875 38.0 37.0 38.0 32.0 38.0 86-87 35.907250000000005 38.0 37.0 38.0 31.0 38.0 88-89 35.630624999999995 38.0 37.0 38.0 30.5 38.0 90-91 35.4255 38.0 36.5 38.0 30.0 38.0 92-93 35.286125 38.0 36.0 38.0 29.0 38.0 94-95 35.234875 38.0 36.0 38.0 29.0 38.0 96-97 34.974000000000004 38.0 36.0 38.0 28.0 38.0 98-99 34.746875 38.0 35.5 38.0 27.5 38.0 100-101 34.93075 38.0 36.0 38.0 28.0 38.0 102-103 34.56 38.0 35.5 38.0 26.0 38.0 104-105 34.236999999999995 38.0 34.0 38.0 24.0 38.0 106-107 34.321125 38.0 35.0 38.0 25.5 38.0 108-109 34.05275 38.0 34.0 38.0 23.5 38.0 110-111 33.824125 38.0 34.0 38.0 22.5 38.0 112-113 33.812625 38.0 34.0 38.0 23.0 38.0 114-115 33.7585 38.0 34.0 38.0 22.0 38.0 116-117 32.934875000000005 38.0 33.0 38.0 18.0 38.0 118-119 32.79075 38.0 33.0 38.0 16.0 38.0 120-121 32.692750000000004 38.0 33.0 38.0 14.0 38.0 122-123 31.794874999999998 38.0 32.0 38.0 7.0 38.0 124-125 30.337625 38.0 31.0 38.0 2.0 38.0 126 17.654 20.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 0.0 17 2.0 18 1.0 19 2.0 20 12.0 21 10.0 22 12.0 23 16.0 24 14.0 25 8.0 26 23.0 27 28.0 28 28.0 29 59.0 30 63.0 31 78.0 32 131.0 33 149.0 34 289.0 35 447.0 36 1266.0 37 1359.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.86643321660831 17.333666833416707 7.8039019509754874 41.9959979989995 2 23.65 18.35 36.8 21.2 3 21.125 23.674999999999997 24.05 31.15 4 24.825 29.4 21.3 24.474999999999998 5 26.150000000000002 32.425 21.15 20.275000000000002 6 19.950000000000003 34.35 23.200000000000003 22.5 7 16.1 21.15 41.949999999999996 20.8 8 18.125 21.25 30.175 30.45 9 17.9 20.200000000000003 34.0 27.900000000000002 10-11 23.3625 30.425 21.65 24.5625 12-13 22.8625 23.474999999999998 26.0375 27.625 14-15 22.537499999999998 25.1875 26.787499999999998 25.4875 16-17 22.8625 26.237500000000004 24.375 26.525 18-19 22.5875 26.5625 25.674999999999997 25.174999999999997 20-21 22.95 25.1 26.05 25.900000000000002 22-23 22.662499999999998 25.5625 25.3 26.474999999999998 24-25 22.7125 26.650000000000002 24.675 25.9625 26-27 22.925 26.337500000000002 25.1 25.637500000000003 28-29 23.1875 25.4 25.887500000000003 25.525 30-31 21.9 26.137500000000003 25.687500000000004 26.275 32-33 23.400000000000002 25.775 25.2875 25.5375 34-35 23.2875 26.25 24.8625 25.6 36-37 22.237499999999997 26.2625 25.687500000000004 25.8125 38-39 22.3125 26.2875 25.4625 25.937500000000004 40-41 23.3625 25.674999999999997 25.912499999999998 25.05 42-43 23.6375 25.087500000000002 25.724999999999998 25.55 44-45 22.7625 25.874999999999996 25.0375 26.325 46-47 23.0375 26.2125 24.7 26.05 48-49 23.2875 25.775 25.637500000000003 25.3 50-51 22.95 25.924999999999997 25.9875 25.137500000000003 52-53 22.45 25.674999999999997 25.674999999999997 26.200000000000003 54-55 23.2125 25.624999999999996 25.900000000000002 25.2625 56-57 22.95 27.3375 25.35 24.3625 58-59 23.5875 26.1125 25.0375 25.2625 60-61 23.5625 25.35 24.925 26.1625 62-63 22.175 25.4375 25.624999999999996 26.7625 64-65 23.45 25.75 25.637500000000003 25.162499999999998 66-67 22.6125 25.575 25.2625 26.55 68-69 23.150000000000002 26.3125 25.724999999999998 24.8125 70-71 23.325000000000003 25.874999999999996 24.775 26.025 72-73 23.2125 26.6 24.325 25.8625 74-75 23.4375 25.75 25.412499999999998 25.4 76-77 23.5125 26.1 25.25 25.137500000000003 78-79 23.9 26.0625 24.474999999999998 25.5625 80-81 23.8125 25.5 24.5 26.187500000000004 82-83 23.5125 26.187500000000004 24.8125 25.4875 84-85 23.35 26.150000000000002 25.074999999999996 25.424999999999997 86-87 23.3 26.087500000000002 25.2 25.412499999999998 88-89 23.371264224084033 27.235213204951858 23.546329873702636 25.847192697261473 90-91 22.975 26.900000000000002 24.575 25.55 92-93 23.474999999999998 26.0375 24.825 25.662499999999998 94-95 24.2875 26.2875 24.4875 24.9375 96-97 23.1 25.6125 25.0125 26.275 98-99 23.875 25.7875 24.9375 25.4 100-101 24.625 26.187500000000004 22.925 26.2625 102-103 23.665458182272783 26.553319164895612 24.49056132016502 25.29066133266658 104-105 22.9375 26.9125 24.462500000000002 25.687500000000004 106-107 24.471676878829562 26.58496936351132 23.796423658872076 25.146930098787045 108-109 24.1125 26.2875 23.1125 26.487500000000004 110-111 24.275 26.7125 23.325000000000003 25.687500000000004 112-113 23.35501626219665 28.43382536902677 23.05479109331999 25.156367275456592 114-115 23.458797048893334 26.84756783793923 23.93397524071527 25.75965987245217 116-117 23.646367387770415 25.70964111541828 24.159059647367762 26.484931849443544 118-119 23.85298162270284 26.465808226028255 23.55294411801475 26.128266033254157 120-121 23.3625 25.7125 24.4875 26.437500000000004 122-123 23.825 26.237500000000004 23.9875 25.95 124-125 23.549999999999997 26.900000000000002 23.45 26.1 126 23.9 24.474999999999998 25.25 26.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 1.0 27 2.5 28 4.5 29 6.5 30 10.5 31 13.5 32 19.5 33 31.0 34 41.5 35 52.5 36 67.5 37 80.5 38 102.0 39 125.0 40 132.5 41 150.5 42 176.5 43 186.0 44 182.5 45 170.0 46 178.5 47 185.5 48 185.0 49 171.5 50 146.5 51 148.0 52 139.0 53 107.0 54 92.5 55 93.5 56 82.5 57 81.0 58 78.5 59 79.0 60 76.0 61 63.5 62 61.0 63 53.0 64 49.5 65 43.0 66 40.5 67 49.0 68 54.0 69 45.5 70 27.0 71 23.0 72 21.0 73 16.5 74 15.0 75 9.5 76 8.5 77 7.0 78 1.5 79 1.5 80 1.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0125 104-105 0.0 106-107 0.0375 108-109 0.0 110-111 0.0 112-113 0.075 114-115 0.0375 116-117 0.0375 118-119 0.0125 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54773869346734 99.05000000000001 2 0.4020100502512563 0.8 3 0.05025125628140704 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.23750000000000002 0.0 0.0 0.0 0.0 60-61 0.30000000000000004 0.0 0.0 0.0 0.0 62-63 0.3875 0.0 0.0 0.0 0.0 64-65 0.475 0.0 0.0 0.0 0.0 66-67 0.6375 0.0 0.0 0.0 0.0 68-69 0.7 0.0 0.0 0.0 0.0 70-71 0.8875 0.0 0.0 0.0 0.0 72-73 1.15 0.0 0.0 0.0 0.0 74-75 1.4625 0.0 0.0 0.0 0.0 76-77 1.8125 0.0 0.0 0.0 0.0 78-79 2.075 0.0 0.0 0.0 0.0 80-81 2.5625 0.0 0.0 0.0 0.0 82-83 3.0125 0.0 0.0 0.0 0.0 84-85 3.6375 0.0 0.0 0.0 0.0 86-87 4.225 0.0 0.0 0.0 0.0 88-89 4.800000000000001 0.0 0.0 0.0 0.0 90-91 5.4 0.0 0.0 0.0 0.0 92-93 6.0625 0.0 0.0 0.0 0.0 94-95 6.862500000000001 0.0 0.0 0.0 0.0 96-97 7.7125 0.0 0.0 0.0 0.0 98-99 8.7875 0.0 0.0 0.0 0.0 100-101 9.9875 0.0 0.0 0.0 0.0 102-103 11.25 0.0 0.0 0.0 0.0 104-105 12.2125 0.0 0.0 0.0 0.0 106-107 13.274999999999999 0.0 0.0 0.0 0.0 108-109 13.95 0.0 0.0 0.0 0.0 110-111 14.899999999999999 0.0 0.0 0.0 0.0 112-113 15.9125 0.0 0.0 0.0 0.0 114 16.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744560 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744560_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7755 33.0 33.0 34.0 32.0 34.0 2 32.98075 34.0 33.0 34.0 32.0 34.0 3 32.9435 34.0 33.0 34.0 31.0 34.0 4 32.97725 34.0 33.0 34.0 32.0 34.0 5 33.009 34.0 33.0 34.0 32.0 34.0 6 37.02675 38.0 38.0 38.0 37.0 38.0 7 36.95725 38.0 38.0 38.0 36.0 38.0 8 36.751 38.0 38.0 38.0 36.0 38.0 9 36.9395 38.0 38.0 38.0 37.0 38.0 10-11 36.950874999999996 38.0 38.0 38.0 36.0 38.0 12-13 36.998625000000004 38.0 38.0 38.0 36.5 38.0 14-15 37.1105 38.0 38.0 38.0 37.0 38.0 16-17 37.034625 38.0 38.0 38.0 36.5 38.0 18-19 37.02625 38.0 38.0 38.0 36.5 38.0 20-21 37.059375 38.0 38.0 38.0 37.0 38.0 22-23 37.07 38.0 38.0 38.0 37.0 38.0 24-25 37.008625 38.0 38.0 38.0 36.5 38.0 26-27 36.997125 38.0 38.0 38.0 36.0 38.0 28-29 36.939875 38.0 38.0 38.0 37.0 38.0 30-31 36.92975 38.0 38.0 38.0 37.0 38.0 32-33 36.952 38.0 38.0 38.0 36.0 38.0 34-35 36.90675 38.0 38.0 38.0 36.5 38.0 36-37 36.527375 38.0 38.0 38.0 36.0 38.0 38-39 36.616 38.0 38.0 38.0 36.0 38.0 40-41 36.50875 38.0 38.0 38.0 35.5 38.0 42-43 36.478125 38.0 38.0 38.0 35.0 38.0 44-45 36.40675 38.0 38.0 38.0 35.5 38.0 46-47 36.57625 38.0 38.0 38.0 35.5 38.0 48-49 36.602125 38.0 38.0 38.0 35.0 38.0 50-51 36.431749999999994 38.0 38.0 38.0 35.0 38.0 52-53 36.35475 38.0 38.0 38.0 34.0 38.0 54-55 36.338125000000005 38.0 38.0 38.0 34.5 38.0 56-57 36.466750000000005 38.0 38.0 38.0 34.0 38.0 58-59 36.609624999999994 38.0 38.0 38.0 35.0 38.0 60-61 36.665 38.0 38.0 38.0 35.0 38.0 62-63 36.542375 38.0 38.0 38.0 34.5 38.0 64-65 36.451499999999996 38.0 38.0 38.0 34.0 38.0 66-67 36.442875 38.0 38.0 38.0 34.0 38.0 68-69 36.364625000000004 38.0 38.0 38.0 34.0 38.0 70-71 36.227500000000006 38.0 38.0 38.0 34.0 38.0 72-73 36.3495 38.0 38.0 38.0 34.0 38.0 74-75 36.301874999999995 38.0 38.0 38.0 34.0 38.0 76-77 36.172875000000005 38.0 38.0 38.0 33.5 38.0 78-79 36.254125 38.0 38.0 38.0 34.0 38.0 80-81 36.146625 38.0 38.0 38.0 33.5 38.0 82-83 36.007875 38.0 38.0 38.0 33.0 38.0 84-85 35.954375 38.0 38.0 38.0 33.0 38.0 86-87 35.862750000000005 38.0 38.0 38.0 31.5 38.0 88-89 35.656875 38.0 37.0 38.0 31.0 38.0 90-91 35.7585 38.0 38.0 38.0 31.5 38.0 92-93 35.448375 38.0 37.0 38.0 31.0 38.0 94-95 35.361125 38.0 37.0 38.0 31.0 38.0 96-97 34.932375 38.0 37.0 38.0 27.5 38.0 98-99 35.0565 38.0 36.5 38.0 28.5 38.0 100-101 34.893125 38.0 36.5 38.0 28.0 38.0 102-103 34.7325 38.0 36.0 38.0 27.5 38.0 104-105 34.425250000000005 38.0 36.0 38.0 25.0 38.0 106-107 34.132375 38.0 35.0 38.0 24.0 38.0 108-109 33.830749999999995 38.0 34.0 38.0 22.0 38.0 110-111 34.113125 38.0 35.0 38.0 24.0 38.0 112-113 33.831375 38.0 34.5 38.0 21.5 38.0 114-115 33.54325 38.0 34.0 38.0 20.0 38.0 116-117 33.329 38.0 33.5 38.0 19.5 38.0 118-119 32.66225 38.0 33.0 38.0 13.5 38.0 120-121 32.741625 38.0 33.0 38.0 13.5 38.0 122-123 32.167249999999996 38.0 33.0 38.0 11.5 38.0 124-125 30.8495 38.0 32.0 38.0 2.0 38.0 126 19.49525 23.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 6.0 4 0.0 5 3.0 6 2.0 7 1.0 8 0.0 9 0.0 10 2.0 11 0.0 12 1.0 13 2.0 14 2.0 15 4.0 16 6.0 17 6.0 18 11.0 19 10.0 20 9.0 21 8.0 22 16.0 23 13.0 24 16.0 25 30.0 26 27.0 27 27.0 28 31.0 29 31.0 30 62.0 31 79.0 32 108.0 33 139.0 34 173.0 35 329.0 36 711.0 37 2127.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.594567404426556 19.13983903420523 10.814889336016096 33.45070422535211 2 27.400000000000002 24.025 31.624999999999996 16.950000000000003 3 21.475 25.2 28.299999999999997 25.025 4 26.650000000000002 31.674999999999997 19.775000000000002 21.9 5 26.8 34.150000000000006 18.9 20.150000000000002 6 21.082978190022562 35.3472048132364 21.15818500877413 22.41163198796691 7 21.91194968553459 17.48427672955975 37.45911949685535 23.144654088050316 8 22.692889561270803 20.146243066061523 26.32375189107413 30.837115481593546 9 22.26690123146519 21.110831867303343 29.25358130183463 27.368685599396837 10-11 26.01177797268513 28.630497431399576 20.736749780729234 24.620974815186067 12-13 26.559959984994375 21.883206202325873 24.034012754783042 27.522821057896714 14-15 24.218554638659665 25.18129532383096 26.644161040260066 23.95598899724931 16-17 25.72536268134067 25.587793896948476 23.936968484242122 24.749874937468736 18-19 25.618904726181547 24.8062015503876 24.69367341835459 24.88122030507627 20-21 25.45 26.3 24.4 23.849999999999998 22-23 25.78466925096911 25.334500437664126 24.92184569213455 23.95898461923221 24-25 25.715714464308036 25.528191023877984 24.40305038129766 24.353044130516317 26-27 25.534842987614166 24.92180658075816 25.94770424121106 23.595646190416613 28-29 25.24771102470839 25.222626363978428 25.0344914085037 24.49517120280948 30-31 26.01605619668841 24.94982438534872 24.849473156046162 24.184646261916708 32-33 25.952380952380956 25.03759398496241 25.18796992481203 23.82205513784461 34-35 25.984449460747427 25.056433408577877 24.868322046651617 24.090795084023075 36-37 25.208807896735003 25.677043786383198 24.411541381928625 24.702606934953174 38-39 25.84836634287877 25.30591648795257 25.19238047180522 23.653336697363443 40-41 26.18384401114206 24.9177006837174 24.626487718409724 24.271967586730817 42-43 25.20582647245092 24.952501583280558 25.307156428119065 24.53451551614946 44-45 25.247273649505452 25.716459548567084 25.069743849860508 23.966522952066953 46-47 26.487644982349973 25.529500756429652 24.621785173978818 23.361069087241553 48-49 25.820238843494657 25.216844751728473 25.631678189817723 23.331238214959146 50-51 25.439150764564637 25.19903955516239 25.224314419309994 24.13749526096297 52-53 26.402223345123797 25.101061141990904 24.62102071753411 23.875694795351187 54-55 25.81662252490856 23.685206205069996 26.53550258544583 23.962668684575608 56-57 25.92499686441741 25.210084033613445 26.175843471717048 22.689075630252102 58-59 26.136505948653728 25.159674389480273 24.658735128365684 24.04508453350031 60-61 25.4375 25.4875 25.687500000000004 23.3875 62-63 25.869402051538653 25.168876657493122 25.69427070302727 23.267450587940957 64-65 25.807663410969194 24.167292762334082 25.820185324317556 24.204858502379164 66-67 26.2557935613178 25.00313165476638 24.477013654014783 24.26406112990104 68-69 26.282131661442005 25.918495297805645 24.927899686520377 22.871473354231973 70-71 26.713444430522493 24.721212880591402 25.297581756672095 23.267760932214006 72-73 26.394796097072803 25.243932949712285 25.068801601200903 23.29246935201401 74-75 24.75916426873514 26.135368447391468 25.522332040535467 23.58313524333792 76-77 26.553106212424847 24.9749498997996 24.185871743486974 24.28607214428858 78-79 25.572375828850248 25.672463405479796 25.222069310646816 23.533091455023143 80-81 26.675837918959477 25.325162581290645 24.212106053026513 23.78689344672336 82-83 26.73502563461298 26.08478179317244 23.858947105164436 23.321245467050144 84-85 26.206551637909474 24.99374843710928 24.956239059764943 23.843460865216304 86-87 26.575 25.912499999999998 24.625 22.8875 88-89 27.625 24.837500000000002 24.2625 23.275000000000002 90-91 27.144286071517882 25.44386096524131 24.518629657414355 22.893223305826456 92-93 27.2625 25.7875 25.087500000000002 21.8625 94-95 26.487500000000004 26.025 24.025 23.4625 96-97 27.57799774464353 25.184813933091093 24.771331913294073 22.46585640897131 98-99 28.325 25.087500000000002 25.3 21.2875 100-101 27.575 26.200000000000003 23.974999999999998 22.25 102-103 28.785794673002375 25.747155183193698 23.858947105164436 21.608103038639488 104-105 27.56892230576441 26.666666666666668 23.897243107769423 21.8671679197995 106-107 28.653653653653656 25.875875875875877 23.586086086086087 21.884384384384383 108-109 27.221526908635795 25.632040050062578 24.06758448060075 23.078848560700877 110-111 29.1375 25.5375 23.275000000000002 22.05 112-113 29.125 25.85 22.975 22.05 114-115 27.987499999999997 25.337500000000002 24.587500000000002 22.0875 116-117 28.6375 24.712500000000002 24.349999999999998 22.3 118-119 29.727363681840917 24.824912456228116 24.087043521760883 21.360680340170084 120-121 28.487499999999997 25.424999999999997 24.55 21.5375 122-123 29.525000000000002 25.6125 23.925 20.9375 124-125 29.4875 25.087500000000002 24.1125 21.3125 126 28.249999999999996 25.25 24.0 22.5 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 1.0 19 1.5 20 0.5 21 0.5 22 0.5 23 1.0 24 3.0 25 4.0 26 4.0 27 5.5 28 6.0 29 7.0 30 10.5 31 15.0 32 19.5 33 31.0 34 43.0 35 46.0 36 51.0 37 58.0 38 73.5 39 97.5 40 122.5 41 141.5 42 140.0 43 155.0 44 172.5 45 176.0 46 186.5 47 191.0 48 183.5 49 162.0 50 153.0 51 159.0 52 142.0 53 116.0 54 108.0 55 91.5 56 86.0 57 84.5 58 78.0 59 84.5 60 85.5 61 76.5 62 72.5 63 68.5 64 56.5 65 57.0 66 63.0 67 58.5 68 50.0 69 44.5 70 39.0 71 31.0 72 24.5 73 20.5 74 14.0 75 9.5 76 6.0 77 4.0 78 2.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.27499999999999997 7 0.625 8 0.8500000000000001 9 0.525 10-11 0.2375 12-13 0.0375 14-15 0.025 16-17 0.05 18-19 0.025 20-21 0.0 22-23 0.0375 24-25 0.0125 26-27 0.08750000000000001 28-29 0.3375 30-31 0.35000000000000003 32-33 0.25 34-35 0.325 36-37 1.225 38-39 0.9125 40-41 1.275 42-43 1.3125 44-45 1.425 46-47 0.8500000000000001 48-49 0.5625 50-51 1.0875 52-53 1.05 54-55 0.8875 56-57 0.3375 58-59 0.1875 60-61 0.0 62-63 0.075 64-65 0.17500000000000002 66-67 0.21250000000000002 68-69 0.3125 70-71 0.2375 72-73 0.075 74-75 0.08750000000000001 76-77 0.2 78-79 0.08750000000000001 80-81 0.05 82-83 0.0375 84-85 0.025 86-87 0.0 88-89 0.0 90-91 0.025 92-93 0.0 94-95 0.0 96-97 0.2375 98-99 0.0 100-101 0.0 102-103 0.0375 104-105 0.25 106-107 0.1 108-109 0.125 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.05 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26786165109822 98.3 2 0.6563998990154002 1.3 3 0.025246149962130777 0.075 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025246149962130777 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.1375 0.0 0.0 0.0 0.0 56-57 0.2 0.0 0.0 0.0 0.0 58-59 0.2625 0.0 0.0 0.0 0.0 60-61 0.32499999999999996 0.0 0.0 0.0 0.0 62-63 0.4125 0.0 0.0 0.0 0.0 64-65 0.5 0.0 0.0 0.0 0.0 66-67 0.6375 0.0 0.0 0.0 0.0 68-69 0.7 0.0 0.0 0.0 0.0 70-71 0.8875 0.0 0.0 0.0 0.0 72-73 1.15 0.0 0.0 0.0 0.0 74-75 1.45 0.0 0.0 0.0 0.0 76-77 1.7875 0.0 0.0 0.0 0.0 78-79 2.025 0.0 0.0 0.0 0.0 80-81 2.4875 0.0 0.0 0.0 0.0 82-83 2.925 0.0 0.0 0.0 0.0 84-85 3.5625 0.0 0.0 0.0 0.0 86-87 4.175 0.0 0.0 0.0 0.0 88-89 4.8 0.0 0.0 0.0 0.0 90-91 5.3875 0.0 0.0 0.0 0.0 92-93 6.0125 0.0 0.0 0.0 0.0 94-95 6.7875 0.0 0.0 0.0 0.0 96-97 7.65 0.0 0.0 0.0 0.0 98-99 8.6875 0.0 0.0 0.0 0.0 100-101 9.8625 0.0 0.0 0.0 0.0 102-103 11.087499999999999 0.0 0.0 0.0 0.0 104-105 12.024999999999999 0.0 0.0 0.0 0.0 106-107 13.05 0.0 0.0 0.0 0.0 108-109 13.7375 0.0 0.0 0.0 0.0 110-111 14.7 0.0 0.0 0.0 0.0 112-113 15.6625 0.0 0.0 0.0 0.0 114 16.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732263 spots for ERR1744560.sra Written 732263 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra Read 732249 spots for ERR1744560.sra Written 732249 spots for ERR1744560.sra SRR ids: ['ERR1744560.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6gulitvg ERR1744560.sra spots: 14644994 blocks: [[1, 732249], [732250, 1464498], [1464499, 2196747], [2196748, 2928996], [2928997, 3661245], [3661246, 4393494], [4393495, 5125743], [5125744, 5857992], [5857993, 6590241], [6590242, 7322490], [7322491, 8054739], [8054740, 8786988], [8786989, 9519237], [9519238, 10251486], [10251487, 10983735], [10983736, 11715984], [11715985, 12448233], [12448234, 13180482], [13180483, 13912731], [13912732, 14644994]] ERR1744560 file size 4225919 ERR1744560 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744560 ERR1744560_1.fastq ERR1744560_2.fastq Input file: ERR1744560_1.fastq Paired file: ERR1744560_2.fastq trimmed: ERR1744560-trimmed-pair1.fastq, ERR1744560-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:47:20 2024 >> started Sat Dec 7 00:47:35 2024 >> done (14.965s) 14644994 read pairs processed; of these: 16159 ( 0.11%) short read pairs filtered out after trimming by size control 13758 ( 0.09%) empty read pairs filtered out after trimming by size control 14615077 (99.80%) read pairs available; of these: 9851474 (67.41%) trimmed read pairs available after processing 4763603 (32.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 91 0.00% 19 70 0.00% 20 65 0.00% 21 62 0.00% 22 78 0.00% 23 75 0.00% 24 61 0.00% 25 60 0.00% 26 64 0.00% 27 70 0.00% 28 73 0.00% 29 97 0.00% 30 84 0.00% 31 114 0.00% 32 144 0.00% 33 169 0.00% 34 172 0.00% 35 217 0.00% 36 184 0.00% 37 235 0.00% 38 253 0.00% 39 321 0.00% 40 404 0.00% 41 444 0.00% 42 522 0.00% 43 617 0.00% 44 687 0.00% 45 759 0.01% 46 839 0.01% 47 1051 0.01% 48 1162 0.01% 49 1444 0.01% 50 1677 0.01% 51 1823 0.01% 52 2205 0.02% 53 2407 0.02% 54 2728 0.02% 55 3109 0.02% 56 3283 0.02% 57 3862 0.03% 58 4237 0.03% 59 4757 0.03% 60 5533 0.04% 61 6481 0.04% 62 7129 0.05% 63 8068 0.06% 64 9169 0.06% 65 10139 0.07% 66 11215 0.08% 67 12304 0.08% 68 13565 0.09% 69 14945 0.10% 70 16802 0.11% 71 18659 0.13% 72 21367 0.15% 73 23880 0.16% 74 26425 0.18% 75 29435 0.20% 76 36222 0.25% 77 36015 0.25% 78 35453 0.24% 79 37705 0.26% 80 40912 0.28% 81 42422 0.29% 82 46260 0.32% 83 49313 0.34% 84 52903 0.36% 85 54840 0.38% 86 57285 0.39% 87 60008 0.41% 88 62816 0.43% 89 64098 0.44% 90 65255 0.45% 91 68868 0.47% 92 69924 0.48% 93 71564 0.49% 94 75914 0.52% 95 77325 0.53% 96 79124 0.54% 97 81458 0.56% 98 82145 0.56% 99 83253 0.57% 100 85272 0.58% 101 86026 0.59% 102 87540 0.60% 103 89814 0.61% 104 91304 0.62% 105 92720 0.63% 106 95165 0.65% 107 96702 0.66% 108 99928 0.68% 109 102086 0.70% 110 102605 0.70% 111 105357 0.72% 112 108844 0.74% 113 110954 0.76% 114 114557 0.78% 115 119984 0.82% 116 126089 0.86% 117 134130 0.92% 118 143861 0.98% 119 157863 1.08% 120 179241 1.23% 121 210236 1.44% 122 271531 1.86% 123 408192 2.79% 124 791627 5.42% 125 4132872 28.28% 126 4763603 32.59% 14615077 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=5.33 fanout-score-rank=17 prefix-density=0.24 prefix-fanout=4.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCAGGGTACTCCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=18 fanout-score=254.50 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=29.7 sequence=CTTCTTCTTGTCCACGTTCTCCACGCTCTTCTCCTGGAACGCAGACATGGCGGACTCCGCCACCAACTTGCCGCTCGACA criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=40 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=121.22 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=18.1 sequence=GCCGCCGCCGCC ERR1744560 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:48:15 Started mapping on | Dec 07 00:48:15 Finished on | Dec 07 00:49:17 Mapping speed, Million of reads per hour | 848.62 Number of input reads | 14615077 Average input read length | 236 UNIQUE READS: Uniquely mapped reads number | 14073025 Uniquely mapped reads % | 96.29% Average mapped length | 236.23 Number of splices: Total | 9700502 Number of splices: Annotated (sjdb) | 9016498 Number of splices: GT/AG | 9554764 Number of splices: GC/AG | 107194 Number of splices: AT/AC | 3837 Number of splices: Non-canonical | 34707 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.43 Insertion rate per base | 0.03% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 221651 % of reads mapped to multiple loci | 1.52% Number of reads mapped to too many loci | 21699 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.64% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 330405 330405 330405 N_multimapping 221651 221651 221651 N_noFeature 811954 13564380 1000333 N_ambiguous 360851 2341 41332 UnstrandedReadsAssigned:12900220 PositiveStrandReadsAssigned:506304 NegativeStrandReadsAssigned:13031360 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=112 echo kmer=107 ERR1744560 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744560-trimmed-pair1.fastq ERR1744560-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,615,077 reads, 13,077,602 reads pseudoaligned [quant] estimated average fragment length: 197.11 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 ERR1744560.ke.tsv 35125 ERR1744560.se.tsv 88098 total ==> ERR1744560.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 740.173 0 0 PNS24247 1044 847.89 29.125 3.64697 PNS24249 1928 1731.89 27.448 1.68266 PNS24246 1044 847.89 29.125 3.64697 PNS24248 1044 847.89 29.125 3.64697 PNS24244 1471 1274.89 102.177 8.50916 PNS24243 293 132.708 0 0 KQK14069 1603 1406.89 12349.1 931.928 KQK14071 474 287.434 1367.53 505.132 ==> ERR1744560.se.tsv <== BRADI_1g14170v3 21951 BRADI_1g53295v3 301 BRADI_1g59795v3 128 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 242 BRADI_1g74790v3 189 BRADI_1g09890v3 0 BRADI_1g77505v3 263 BRADI_1g48960v3 0 ERR1744560 completed mapping pipeline successfully