Starting /dee2/code/volunteer_pipeline.sh ERR1744561 current disk space = 1548158668800 free memory = 1599695368 ERR1744561 SRAfilesize 72b37b0cd5b088e63e337e6bd6d67a4b ERR1744561.sra ERR1744561.sra file validated ERR1744561 is paired end ERR1744561 is conventional basespace ERR1744561 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744561_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.11175 34.0 33.0 34.0 32.0 34.0 2 33.21075 34.0 33.0 34.0 32.0 34.0 3 33.21975 34.0 33.0 34.0 32.0 34.0 4 33.1435 34.0 33.0 34.0 32.0 34.0 5 33.04375 34.0 33.0 34.0 32.0 34.0 6 36.63525 38.0 37.0 38.0 34.0 38.0 7 37.1185 38.0 38.0 38.0 36.0 38.0 8 37.25975 38.0 38.0 38.0 37.0 38.0 9 37.29875 38.0 38.0 38.0 37.0 38.0 10-11 37.321625 38.0 38.0 38.0 37.0 38.0 12-13 37.29675 38.0 38.0 38.0 37.0 38.0 14-15 37.301249999999996 38.0 38.0 38.0 37.0 38.0 16-17 37.270624999999995 38.0 38.0 38.0 37.0 38.0 18-19 37.332625 38.0 38.0 38.0 37.0 38.0 20-21 37.257125 38.0 38.0 38.0 37.0 38.0 22-23 37.205625 38.0 38.0 38.0 37.0 38.0 24-25 37.234750000000005 38.0 38.0 38.0 37.0 38.0 26-27 37.165000000000006 38.0 38.0 38.0 36.5 38.0 28-29 37.082499999999996 38.0 38.0 38.0 35.5 38.0 30-31 37.05925 38.0 38.0 38.0 36.0 38.0 32-33 37.007875 38.0 38.0 38.0 36.0 38.0 34-35 36.939125000000004 38.0 38.0 38.0 36.0 38.0 36-37 36.961625 38.0 38.0 38.0 35.5 38.0 38-39 36.90625 38.0 38.0 38.0 35.5 38.0 40-41 36.8065 38.0 38.0 38.0 35.0 38.0 42-43 36.853625 38.0 38.0 38.0 35.0 38.0 44-45 36.7095 38.0 38.0 38.0 35.0 38.0 46-47 36.539625 38.0 38.0 38.0 34.0 38.0 48-49 36.435 38.0 38.0 38.0 34.0 38.0 50-51 36.316625 38.0 38.0 38.0 32.5 38.0 52-53 35.996625 38.0 37.0 38.0 31.5 38.0 54-55 35.877624999999995 38.0 37.0 38.0 31.0 38.0 56-57 35.7605 38.0 37.0 38.0 31.0 38.0 58-59 35.189750000000004 38.0 36.0 38.0 29.0 38.0 60-61 35.111374999999995 38.0 36.5 38.0 29.0 38.0 62-63 35.12175 38.0 36.5 38.0 29.0 38.0 64-65 34.751125 38.0 35.5 38.0 26.5 38.0 66-67 34.737750000000005 38.0 36.0 38.0 26.0 38.0 68-69 34.63675 38.0 35.5 38.0 26.0 38.0 70-71 34.24525 38.0 34.5 38.0 25.0 38.0 72-73 33.821625 38.0 34.0 38.0 22.0 38.0 74-75 33.20525 38.0 33.0 38.0 18.5 38.0 76-77 33.082125000000005 38.0 33.0 38.0 17.5 38.0 78-79 33.00075 38.0 33.0 38.0 16.5 38.0 80-81 32.13825 37.5 30.5 38.0 14.0 38.0 82-83 31.86275 37.0 30.0 38.0 14.0 38.0 84-85 31.917749999999998 37.0 30.0 38.0 14.0 38.0 86-87 31.540125 37.0 29.5 38.0 14.0 38.0 88-89 31.076124999999998 37.0 29.0 38.0 13.5 38.0 90-91 30.523 36.5 28.0 38.0 12.5 38.0 92-93 30.15475 36.5 27.0 38.0 11.5 38.0 94-95 29.652250000000002 36.0 25.0 38.0 11.0 38.0 96-97 29.6625 36.0 26.0 38.0 11.0 38.0 98-99 28.98725 35.0 23.5 38.0 6.5 38.0 100-101 28.2775 34.5 21.0 38.0 2.0 38.0 102-103 27.2725 33.0 18.0 38.0 2.0 38.0 104-105 26.20675 32.0 14.0 38.0 2.0 38.0 106-107 26.525624999999998 33.0 14.0 38.0 2.0 38.0 108-109 25.946625 33.0 14.0 38.0 2.0 38.0 110-111 24.911125 31.0 13.0 38.0 2.0 38.0 112-113 24.082875 30.0 11.5 37.0 2.0 38.0 114-115 23.147 29.0 6.5 37.0 2.0 38.0 116-117 22.217750000000002 28.0 2.0 37.0 2.0 38.0 118-119 21.460250000000002 26.5 2.0 36.5 2.0 38.0 120-121 20.638125 26.5 2.0 36.0 2.0 38.0 122-123 18.914625 18.5 2.0 36.0 2.0 38.0 124-125 16.311374999999998 2.0 2.0 35.0 2.0 38.0 126 7.4665 2.0 2.0 2.0 2.0 31.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 2.0 11 5.0 12 6.0 13 4.0 14 13.0 15 18.0 16 20.0 17 14.0 18 29.0 19 46.0 20 37.0 21 29.0 22 54.0 23 45.0 24 74.0 25 79.0 26 61.0 27 114.0 28 114.0 29 159.0 30 160.0 31 214.0 32 335.0 33 350.0 34 527.0 35 592.0 36 665.0 37 232.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.818409204602304 7.628814407203602 7.20360180090045 48.349174587293646 2 25.074999999999996 10.0 31.374999999999996 33.550000000000004 3 23.575 13.025 21.625 41.775 4 29.225 20.0 20.150000000000002 30.625000000000004 5 29.425 24.175 23.200000000000003 23.200000000000003 6 26.174999999999997 27.85 24.099999999999998 21.875 7 19.525000000000002 22.025 39.074999999999996 19.375 8 20.125 23.925 29.75 26.200000000000003 9 19.75 21.349999999999998 34.975 23.925 10-11 23.0625 28.812500000000004 24.2 23.925 12-13 23.025000000000002 23.4875 27.6625 25.825 14-15 23.4625 25.2625 26.237500000000004 25.0375 16-17 25.0125 24.0 25.937500000000004 25.05 18-19 24.3875 24.075 25.974999999999998 25.5625 20-21 24.325 24.95 24.725 26.0 22-23 23.375 25.1 25.7625 25.7625 24-25 23.849999999999998 24.2 25.137500000000003 26.8125 26-27 23.7125 23.5875 26.0625 26.637499999999996 28-29 24.175 24.4875 25.337500000000002 26.0 30-31 23.2625 24.224999999999998 25.5 27.0125 32-33 24.087500000000002 23.95 25.900000000000002 26.0625 34-35 24.6125 24.1875 24.925 26.275 36-37 23.8125 24.2625 24.8625 27.0625 38-39 23.45 24.0375 25.9625 26.55 40-41 24.224999999999998 23.7125 25.7125 26.35 42-43 23.7375 24.212500000000002 25.2 26.85 44-45 24.099999999999998 24.45 25.374999999999996 26.075 46-47 23.8875 24.4125 25.6125 26.087500000000002 48-49 23.9375 24.025 25.374999999999996 26.6625 50-51 23.5875 24.5 25.775 26.137500000000003 52-53 24.725 25.424999999999997 24.337500000000002 25.5125 54-55 23.7875 24.7375 24.9 26.575 56-57 23.599999999999998 24.95 25.35 26.1 58-59 23.30657300551932 24.67385850476668 25.57701956848971 26.442548921224287 60-61 23.692810457516337 23.717948717948715 25.452488687782804 27.136752136752136 62-63 24.59778783308195 23.981900452488688 25.0 26.420311714429364 64-65 23.98093565784523 24.54534052426941 24.63313683682428 26.840586981061083 66-67 24.338226069501946 24.513862752477735 25.040772801405094 26.10713837661523 68-69 22.823086574654955 25.219573400250937 26.637390213299874 25.319949811794228 70-71 24.175685879687894 24.188270828089607 25.106972061414552 26.529071230807954 72-73 24.38100050530571 23.913592723597777 24.608388074785246 27.09701869631127 74-75 23.783031988873436 24.718674927298014 25.42672904286256 26.07156404096599 76-77 25.09155196363177 24.270741255208993 24.813739108473293 25.823967672685942 78-79 24.310650139134836 25.01897293195042 24.513028079939286 26.15734884897546 80-81 24.484894450764756 23.65061307040829 25.40766021994691 26.45683225888004 82-83 24.068695542366463 24.83899482257861 24.573809824472786 26.518499810582146 84-85 24.458087958902393 24.194963037213384 24.43302844255106 26.913920561333164 86-87 24.104234527687296 24.166875469807067 25.65772989225758 26.07116011024806 88-89 25.2442996742671 24.705587572037082 24.25457278877474 25.795539964921073 90-91 24.298948422633952 24.023535302954432 24.86229344016024 26.81522283425138 92-93 25.35705337008269 24.24204460035079 24.743172137308946 25.65772989225758 94-95 24.6084450570104 24.896629495050746 24.282671344443052 26.212254103495802 96-97 23.67597345686741 25.12833354200576 24.87792663077501 26.31776637035182 98-99 25.037612838515543 24.134904714142426 24.711634904714142 26.115847542627886 100-101 25.012531328320804 24.160401002506266 24.962406015037594 25.86466165413534 102-103 24.586466165413533 24.523809523809522 25.062656641604008 25.827067669172934 104-105 25.009516558812333 24.19743687349321 24.895317853064334 25.897728714630126 106-107 24.882926211871915 24.832299708897608 24.439944310846727 25.844829768383747 108-109 24.4986037065245 23.57197258187357 24.98095963442498 26.948464077176947 110-111 24.789915966386555 24.05143875732111 24.242424242424242 26.916221033868094 112-113 24.87277353689567 24.338422391857506 24.65648854961832 26.132315521628495 114-115 25.143220878421385 23.704646721833228 24.659452577975813 26.49267982176957 116-117 24.54510752004072 23.807100139966916 25.461254612546124 26.18653772744624 118-119 24.74831145660762 24.7992863514719 24.02191920479164 26.43048298712884 120-121 24.897959183673468 24.744897959183675 23.762755102040817 26.59438775510204 122-123 24.850031908104658 24.607530312699424 24.952137843012125 25.59029993618379 124-125 25.49618320610687 24.35114503816794 24.55470737913486 25.597964376590333 126 28.262528618672096 19.638768761129484 25.311625540574916 26.787077079623504 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.5 27 4.5 28 5.0 29 5.5 30 10.5 31 12.5 32 13.5 33 20.0 34 24.0 35 30.0 36 43.5 37 64.5 38 72.5 39 76.5 40 92.0 41 128.5 42 150.0 43 160.5 44 170.5 45 182.0 46 183.0 47 181.5 48 178.0 49 167.5 50 167.0 51 151.0 52 131.5 53 113.5 54 106.0 55 102.5 56 109.0 57 107.0 58 98.5 59 91.5 60 81.0 61 80.0 62 80.5 63 78.5 64 71.0 65 64.5 66 64.0 67 51.0 68 40.0 69 43.0 70 45.5 71 39.0 72 28.5 73 21.0 74 14.5 75 11.0 76 9.5 77 6.0 78 6.0 79 4.0 80 1.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.35000000000000003 60-61 0.5499999999999999 62-63 0.5499999999999999 64-65 0.3375 66-67 0.36250000000000004 68-69 0.375 70-71 0.675 72-73 1.05 74-75 1.1375 76-77 1.0125 78-79 1.175 80-81 1.1125 82-83 1.0125 84-85 0.2375 86-87 0.22499999999999998 88-89 0.22499999999999998 90-91 0.15 92-93 0.22499999999999998 94-95 0.2375 96-97 0.1625 98-99 0.3 100-101 0.25 102-103 0.25 104-105 1.4874999999999998 106-107 1.2375 108-109 1.525 110-111 1.825 112-113 1.7500000000000002 114-115 1.8124999999999998 116-117 1.7624999999999997 118-119 1.9124999999999999 120-121 2.0 122-123 2.0625 124-125 1.7500000000000002 126 1.725 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.00256081946223 95.675 2 1.6901408450704223 3.3000000000000003 3 0.23047375160051217 0.675 4 0.02560819462227913 0.1 5 0.05121638924455826 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGAGTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTT 5 0.125 No Hit CCGGAACCCAAAGACTTTGATTTCTCATAAGGTGCCGGCGGAGTCCTATA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.05 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.725 0.0 0.0 0.0 0.0 114 3.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744561 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744561_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 51 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1875 33.0 33.0 34.0 32.0 34.0 2 32.48475 34.0 33.0 34.0 31.0 34.0 3 32.52625 34.0 33.0 34.0 31.0 34.0 4 32.50425 34.0 33.0 34.0 32.0 34.0 5 32.334 34.0 33.0 34.0 31.0 34.0 6 36.05225 38.0 38.0 38.0 34.0 38.0 7 35.968 38.0 38.0 38.0 34.0 38.0 8 35.94975 38.0 38.0 38.0 34.0 38.0 9 35.79475 38.0 38.0 38.0 34.0 38.0 10-11 35.359750000000005 38.0 38.0 38.0 32.0 38.0 12-13 35.03975 38.0 38.0 38.0 30.0 38.0 14-15 34.983875 38.0 38.0 38.0 29.0 38.0 16-17 35.051625 38.0 38.0 38.0 30.0 38.0 18-19 34.943125 38.0 38.0 38.0 29.0 38.0 20-21 34.844125000000005 38.0 38.0 38.0 28.0 38.0 22-23 35.018125 38.0 38.0 38.0 28.5 38.0 24-25 35.143875 38.0 38.0 38.0 30.0 38.0 26-27 35.061499999999995 38.0 38.0 38.0 29.0 38.0 28-29 35.60975 38.0 38.0 38.0 29.0 38.0 30-31 35.813875 38.0 38.0 38.0 30.5 38.0 32-33 36.128625 38.0 38.0 38.0 34.0 38.0 34-35 36.1485 38.0 38.0 38.0 34.0 38.0 36-37 35.988 38.0 38.0 38.0 33.5 38.0 38-39 35.935 38.0 38.0 38.0 33.0 38.0 40-41 36.122125 38.0 38.0 38.0 34.0 38.0 42-43 36.0565 38.0 38.0 38.0 34.0 38.0 44-45 36.113 38.0 38.0 38.0 34.0 38.0 46-47 36.031125 38.0 38.0 38.0 34.0 38.0 48-49 35.83425 38.0 38.0 38.0 33.5 38.0 50-51 35.596500000000006 38.0 38.0 38.0 33.0 38.0 52-53 35.228624999999994 38.0 38.0 38.0 30.0 38.0 54-55 35.161500000000004 38.0 37.5 38.0 29.0 38.0 56-57 35.099374999999995 38.0 37.5 38.0 29.0 38.0 58-59 34.997375000000005 38.0 37.0 38.0 29.0 38.0 60-61 34.891875 38.0 37.0 38.0 29.0 38.0 62-63 34.819 38.0 37.0 38.0 28.5 38.0 64-65 34.605375 38.0 37.0 38.0 27.0 38.0 66-67 34.5715 38.0 37.0 38.0 26.0 38.0 68-69 34.36025 38.0 37.0 38.0 24.5 38.0 70-71 34.025625 38.0 36.5 38.0 23.0 38.0 72-73 33.883750000000006 38.0 36.0 38.0 21.5 38.0 74-75 33.904125 38.0 36.0 38.0 22.0 38.0 76-77 33.790625000000006 38.0 36.0 38.0 21.0 38.0 78-79 33.705875 38.0 35.0 38.0 20.5 38.0 80-81 33.521375 38.0 34.5 38.0 19.5 38.0 82-83 33.337625 38.0 34.0 38.0 17.0 38.0 84-85 33.25375 38.0 34.0 38.0 14.5 38.0 86-87 33.321124999999995 38.0 34.0 38.0 16.5 38.0 88-89 33.2065 38.0 34.0 38.0 14.0 38.0 90-91 32.6065 38.0 33.5 38.0 14.0 38.0 92-93 32.09675 38.0 33.0 38.0 13.0 38.0 94-95 31.744500000000002 38.0 31.5 38.0 12.0 38.0 96-97 31.647624999999998 38.0 31.0 38.0 12.0 38.0 98-99 31.7635 38.0 32.0 38.0 12.0 38.0 100-101 31.428125 38.0 30.5 38.0 11.5 38.0 102-103 31.575625000000002 38.0 31.0 38.0 12.0 38.0 104-105 31.365499999999997 38.0 31.0 38.0 11.0 38.0 106-107 31.069625000000002 38.0 29.5 38.0 11.0 38.0 108-109 30.81675 37.0 29.0 38.0 11.0 38.0 110-111 30.1475 36.5 27.5 38.0 2.0 38.0 112-113 29.376125000000002 36.0 25.5 38.0 2.0 38.0 114-115 28.993875 36.0 25.0 38.0 2.0 38.0 116-117 29.178625 36.0 25.5 38.0 2.0 38.0 118-119 28.448375 35.5 23.5 38.0 2.0 38.0 120-121 27.727125 35.5 20.0 38.0 2.0 38.0 122-123 26.918999999999997 35.0 13.5 38.0 2.0 38.0 124-125 24.870874999999998 33.5 2.0 38.0 2.0 38.0 126 12.37875 2.0 2.0 26.0 2.0 36.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 60.0 3 6.0 4 0.0 5 2.0 6 0.0 7 6.0 8 24.0 9 28.0 10 14.0 11 4.0 12 4.0 13 9.0 14 12.0 15 18.0 16 9.0 17 18.0 18 16.0 19 15.0 20 15.0 21 28.0 22 23.0 23 34.0 24 41.0 25 37.0 26 51.0 27 59.0 28 68.0 29 68.0 30 75.0 31 129.0 32 115.0 33 208.0 34 257.0 35 475.0 36 912.0 37 1160.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.921906693711964 17.16531440162272 12.094320486815416 38.8184584178499 2 28.849999999999998 21.625 28.849999999999998 20.674999999999997 3 24.599198396793586 23.772545090180362 26.678356713426854 24.949899799599198 4 27.695771828871653 28.57142857142857 20.740555416562422 22.992244183137352 5 27.91750503018109 31.086519114688127 19.3158953722334 21.680080482897385 6 25.31774275546518 33.909506863243514 20.081342145399084 20.691408235892222 7 22.519765365978067 18.54118847232849 34.37898495281816 24.560061208875286 8 24.616171954964177 23.643807574206754 22.799385875127943 28.940634595701127 9 23.423423423423422 23.191763191763194 27.876447876447873 25.50836550836551 10-11 27.286922576447626 27.8334417696812 21.00195185426155 23.877683799609628 12-13 27.079785143456046 22.874361325822086 23.52941176470588 26.516441766015987 14-15 25.632620951881474 26.117739609282808 24.177264979677464 24.07237445915825 16-17 27.058206607236496 24.72469847928684 23.675930781331935 24.54116413214473 18-19 25.920587079019786 24.937753898571614 24.71497837767003 24.426680644738568 20-21 26.55983186654407 24.81282017601471 24.563247077367663 24.064100880073557 22-23 25.899751341447452 25.232299437246436 23.766522706452033 25.101426514854076 24-25 26.301369863013697 24.879321591650356 24.344422700587085 24.474885844748858 26-27 26.596858638743452 25.026178010471206 23.782722513089006 24.594240837696336 28-29 26.50556194859992 25.48267484976346 23.475258918296895 24.536504283339728 30-31 26.3962597927723 24.69042203689664 24.15971695729088 24.753601213040184 32-33 26.59534298300818 25.2863436123348 23.901825047199495 24.21648835745752 34-35 26.773340052916716 25.047247070681617 22.867582209902988 25.311830666498675 36-37 25.551931761164077 25.79026593075765 23.99648770697441 24.661314601103864 38-39 26.132797790887413 25.806451612903224 23.73540856031128 24.32534203589808 40-41 26.547783498681397 25.55569508979028 23.508727866382017 24.3877935451463 42-43 25.8 25.624999999999996 23.775 24.8 44-45 26.08150470219436 24.890282131661444 24.57680250783699 24.45141065830721 46-47 27.250000000000004 24.1625 22.95 25.637500000000003 48-49 25.446937999239257 25.561049828832257 23.773297831875237 25.21871434005325 50-51 26.092528514673845 25.746507753428165 23.78572343970268 24.37524029219531 52-53 26.39711563224311 25.341231006953386 23.396858099407673 24.864795261395827 54-55 26.47397365391994 25.258984524875306 23.78820821076864 24.47883361043612 56-57 26.177267449361374 24.83550509611663 24.113017675138693 24.874209779383307 58-59 26.375467078984666 24.558690890349183 24.404071640252546 24.661770390413608 60-61 26.514270954410435 25.248611649231563 23.750484308407593 24.48663308795041 62-63 25.831499935291834 24.809110909796818 24.420861912773393 24.93852724213796 64-65 26.466787283535798 24.644611010597053 24.256913931248384 24.631687774618765 66-67 25.87884291088338 24.776235568815668 24.14061486574134 25.204306654559606 68-69 25.80352514256091 25.62208398133748 23.62623120787973 24.948159668221876 70-71 26.24316584222859 23.965113251757355 23.704764384274927 26.08695652173913 72-73 25.834090614046474 25.055173309100347 23.97767103725821 25.133065039594964 74-75 26.409226383309576 24.115588959440196 23.986004924193338 25.489179733056886 76-77 26.194735497061078 25.057500638895984 23.984155379504216 24.763608484538718 78-79 26.462430660615226 23.802319717599595 24.306606152294503 25.42864346949067 80-81 26.777875329236174 25.912454534052426 22.50094067477737 24.80872946193403 82-83 26.412961567445365 23.775433308214016 24.717407686510928 25.094197437829692 84-85 26.134783158427112 24.731318750790237 24.250853458085725 24.883044632696926 86-87 26.406210231611098 25.38813947569356 23.593789768388902 24.61186052430644 88-89 27.37343810382584 24.69406157413371 23.637768903774315 24.294731418266135 90-91 26.468295218295218 24.389293139293137 24.285343035343036 24.85706860706861 92-93 25.17619420516836 25.998433829287393 23.7144348734012 25.110937092143043 94-95 26.729436380279846 24.45403426180201 24.29710997776906 24.519419380149078 96-97 25.273010920436818 25.208008320332816 24.414976599063962 25.104004160166404 98-99 26.68053569106748 25.471330126121437 24.210115719672345 23.63801846313873 100-101 26.795615731785944 25.841392649903288 23.752417794970988 23.61057382333978 102-103 26.182519280205657 25.205655526992288 25.15424164524422 23.45758354755784 104-105 28.029816218994984 25.3309343272073 23.878678833054877 22.760570620742833 106-107 25.831202046035806 25.792838874680307 24.066496163682867 24.309462915601024 108-109 26.02197240674502 25.396014307613697 24.936126724578436 23.645886561062852 110-111 27.026335975453847 25.172590130401435 23.587317821529023 24.2137560726157 112-113 27.422024188415023 25.652450668364104 22.851686823679184 24.073838319541693 114-115 26.279690080020323 26.394004826622634 23.777467293280832 23.54883780007621 116-117 27.087033747779753 26.211621415884295 23.103273280893173 23.598071555442782 118-119 27.515583259127336 25.30212441165246 23.432133316371964 23.750159012848236 120-121 27.136887425604662 24.946182094466256 23.540585032290743 24.376345447638343 122-123 27.556782532312713 25.875266658300916 22.97653406951939 23.591416739866986 124-125 27.859384808537353 26.001255492780917 22.887633396107972 23.25172630257376 126 29.068010075566754 23.249370277078086 21.51133501259446 26.171284634760706 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.0 4 3.0 5 4.5 6 4.5 7 4.5 8 3.5 9 3.5 10 4.0 11 4.0 12 3.0 13 4.0 14 6.5 15 4.0 16 5.5 17 8.5 18 7.0 19 7.0 20 5.0 21 5.5 22 9.0 23 9.0 24 5.5 25 5.5 26 11.0 27 8.0 28 5.0 29 8.0 30 13.5 31 17.5 32 20.5 33 22.0 34 24.0 35 31.5 36 45.5 37 57.0 38 65.0 39 80.0 40 98.5 41 126.0 42 131.5 43 140.0 44 154.5 45 162.5 46 162.5 47 159.0 48 157.0 49 143.0 50 143.0 51 142.0 52 118.0 53 114.0 54 123.0 55 112.5 56 100.0 57 88.0 58 98.0 59 102.5 60 85.5 61 77.5 62 80.0 63 79.5 64 76.0 65 71.0 66 64.0 67 63.0 68 62.0 69 50.0 70 45.0 71 37.0 72 23.5 73 22.5 74 20.0 75 16.5 76 11.5 77 4.5 78 3.0 79 3.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.2 4 0.075 5 0.6 6 1.6500000000000001 7 1.975 8 2.3 9 2.875 10-11 3.9375 12-13 4.5875 14-15 4.6625 16-17 4.65 18-19 4.6125 20-21 4.8375 22-23 4.4875 24-25 4.1875 26-27 4.5 28-29 2.2375 30-31 1.075 32-33 0.6875 34-35 0.7875 36-37 0.35000000000000003 38-39 0.41250000000000003 40-41 0.46249999999999997 42-43 0.0 44-45 0.3125 46-47 0.0 48-49 1.4125 50-51 2.4625 52-53 2.9250000000000003 54-55 2.2624999999999997 56-57 3.1125 58-59 2.9875 60-61 3.2125 62-63 3.4125 64-65 3.2750000000000004 66-67 3.6374999999999997 68-69 3.55 70-71 3.975 72-73 3.7125 74-75 3.5374999999999996 76-77 2.175 78-79 0.8500000000000001 80-81 0.3375 82-83 0.475 84-85 1.1375 86-87 1.775 88-89 2.9625 90-91 3.8 92-93 4.2250000000000005 94-95 4.4125 96-97 3.85 98-99 3.8625 100-101 3.0625 102-103 2.75 104-105 2.7375 106-107 2.25 108-109 2.15 110-111 2.225 112-113 1.8124999999999998 114-115 1.5875 116-117 1.4749999999999999 118-119 1.7375000000000003 120-121 1.2874999999999999 122-123 0.3875 124-125 0.43750000000000006 126 0.75 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73257287705957 97.375 2 1.1660329531051965 2.3 3 0.07604562737642585 0.22499999999999998 4 0.025348542458808618 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0125 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.5125 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.9375 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.25 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.6124999999999998 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.1 0.0 0.0 0.0 0.0 110-111 2.4 0.0 0.0 0.0 0.0 112-113 2.9 0.0 0.0 0.0 0.0 114 3.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067112 spots for ERR1744561.sra Written 1067112 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra Read 1067094 spots for ERR1744561.sra Written 1067094 spots for ERR1744561.sra SRR ids: ['ERR1744561.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_55269bzt ERR1744561.sra spots: 21341898 blocks: [[1, 1067094], [1067095, 2134188], [2134189, 3201282], [3201283, 4268376], [4268377, 5335470], [5335471, 6402564], [6402565, 7469658], [7469659, 8536752], [8536753, 9603846], [9603847, 10670940], [10670941, 11738034], [11738035, 12805128], [12805129, 13872222], [13872223, 14939316], [14939317, 16006410], [16006411, 17073504], [17073505, 18140598], [18140599, 19207692], [19207693, 20274786], [20274787, 21341898]] ERR1744561 file size 6168283 ERR1744561 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744561 ERR1744561_1.fastq ERR1744561_2.fastq Input file: ERR1744561_1.fastq Paired file: ERR1744561_2.fastq trimmed: ERR1744561-trimmed-pair1.fastq, ERR1744561-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:56:30 2024 >> started Sat Dec 7 00:56:51 2024 >> done (21.697s) 21341898 read pairs processed; of these: 25840 ( 0.12%) short read pairs filtered out after trimming by size control 41266 ( 0.19%) empty read pairs filtered out after trimming by size control 21274792 (99.69%) read pairs available; of these: 18738063 (88.08%) trimmed read pairs available after processing 2536729 (11.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 13 0.00% 20 15 0.00% 21 15 0.00% 22 19 0.00% 23 23 0.00% 24 39 0.00% 25 35 0.00% 26 36 0.00% 27 49 0.00% 28 60 0.00% 29 79 0.00% 30 84 0.00% 31 95 0.00% 32 136 0.00% 33 182 0.00% 34 169 0.00% 35 206 0.00% 36 238 0.00% 37 300 0.00% 38 354 0.00% 39 446 0.00% 40 504 0.00% 41 592 0.00% 42 652 0.00% 43 750 0.00% 44 803 0.00% 45 945 0.00% 46 999 0.00% 47 1180 0.01% 48 1384 0.01% 49 1513 0.01% 50 1663 0.01% 51 1790 0.01% 52 2003 0.01% 53 2239 0.01% 54 2409 0.01% 55 2642 0.01% 56 2909 0.01% 57 3261 0.02% 58 3413 0.02% 59 3944 0.02% 60 4483 0.02% 61 4768 0.02% 62 5135 0.02% 63 5643 0.03% 64 6318 0.03% 65 6758 0.03% 66 7374 0.03% 67 8032 0.04% 68 8921 0.04% 69 9657 0.05% 70 10790 0.05% 71 11694 0.05% 72 13242 0.06% 73 13968 0.07% 74 15118 0.07% 75 16317 0.08% 76 17091 0.08% 77 18416 0.09% 78 19524 0.09% 79 20845 0.10% 80 22127 0.10% 81 23453 0.11% 82 25299 0.12% 83 27009 0.13% 84 29408 0.14% 85 31600 0.15% 86 33928 0.16% 87 36491 0.17% 88 39508 0.19% 89 42091 0.20% 90 49588 0.23% 91 56445 0.27% 92 51156 0.24% 93 54054 0.25% 94 57800 0.27% 95 62119 0.29% 96 66077 0.31% 97 70798 0.33% 98 76734 0.36% 99 81534 0.38% 100 88609 0.42% 101 95680 0.45% 102 103236 0.49% 103 111822 0.53% 104 120388 0.57% 105 130059 0.61% 106 141598 0.67% 107 151505 0.71% 108 162862 0.77% 109 176616 0.83% 110 193130 0.91% 111 211335 0.99% 112 234093 1.10% 113 260429 1.22% 114 289968 1.36% 115 322932 1.52% 116 358941 1.69% 117 412123 1.94% 118 478456 2.25% 119 561639 2.64% 120 679885 3.20% 121 847775 3.98% 122 1083202 5.09% 123 1502164 7.06% 124 2477121 11.64% 125 6342987 29.81% 126 2536729 11.92% 21274792 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=27 prefix-density=0.55 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCG criterion=fanout-score sequence-density=0.17 sequence-density-rank=14 fanout-score=10.88 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=5.0 sequence=CAGGTTCTTCACC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.96 fanout-score-rank=18 prefix-density=0.49 prefix-fanout=2.6 sequence=GGTGGTGCATGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=26.13 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=2.5 sequence=CCTCAAGCCAAAGCCTCTTGCTAAGCGTACCACACTATACAGACGTGCGCGCGCAGCCATGGCACCCACCGTGATGGCTTCCTCCGCCACCTCCGTGGCTCCTTTCCA ERR1744561 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:57:33 Started mapping on | Dec 07 00:57:33 Finished on | Dec 07 00:59:14 Mapping speed, Million of reads per hour | 758.31 Number of input reads | 21274792 Average input read length | 239 UNIQUE READS: Uniquely mapped reads number | 19003672 Uniquely mapped reads % | 89.32% Average mapped length | 238.98 Number of splices: Total | 14625603 Number of splices: Annotated (sjdb) | 13610621 Number of splices: GT/AG | 14407502 Number of splices: GC/AG | 168342 Number of splices: AT/AC | 5955 Number of splices: Non-canonical | 43804 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 810433 % of reads mapped to multiple loci | 3.81% Number of reads mapped to too many loci | 212495 % of reads mapped to too many loci | 1.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.68% % of reads unmapped: other | 4.18% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1474058 1474058 1474058 N_multimapping 810433 810433 810433 N_noFeature 1307500 18425899 1468069 N_ambiguous 484090 2956 67719 UnstrandedReadsAssigned:17212082 PositiveStrandReadsAssigned:574817 NegativeStrandReadsAssigned:17467884 Dataset is classified negative stranded MeadianReadLen=123 20thPercentileLength=110 echo kmer=105 ERR1744561 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744561-trimmed-pair1.fastq ERR1744561-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,274,792 reads, 17,615,375 reads pseudoaligned [quant] estimated average fragment length: 207.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 ERR1744561.ke.tsv 35125 ERR1744561.se.tsv 88098 total ==> ERR1744561.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 729.78 0 0 PNS24247 1044 837.561 81.481 7.54176 PNS24249 1928 1721.56 71.844 3.2352 PNS24246 1044 837.561 81.481 7.54176 PNS24248 1044 837.561 81.481 7.54176 PNS24244 1471 1264.56 179.713 11.0172 PNS24243 293 107.816 0 0 KQK14069 1603 1396.56 18016 1000.07 KQK14071 474 271.17 723.302 206.781 ==> ERR1744561.se.tsv <== BRADI_1g14170v3 23090 BRADI_1g53295v3 898 BRADI_1g59795v3 219 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 203 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 388 BRADI_1g48960v3 0 ERR1744561 completed mapping pipeline successfully