Starting /dee2/code/volunteer_pipeline.sh ERR1744562 current disk space = 1548156116992 free memory = 1598366896 ERR1744562 SRAfilesize c6cba613e7b5b59decce16c82622e1d5 ERR1744562.sra ERR1744562.sra file validated ERR1744562 is paired end ERR1744562 is conventional basespace ERR1744562 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744562_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0825 34.0 33.0 34.0 32.0 34.0 2 33.1815 34.0 33.0 34.0 32.0 34.0 3 33.25525 34.0 33.0 34.0 32.0 34.0 4 33.1645 34.0 33.0 34.0 32.0 34.0 5 33.1395 34.0 33.0 34.0 32.0 34.0 6 36.73925 38.0 37.0 38.0 35.0 38.0 7 37.127 38.0 38.0 38.0 36.0 38.0 8 37.309 38.0 38.0 38.0 37.0 38.0 9 37.388 38.0 38.0 38.0 37.0 38.0 10-11 37.373999999999995 38.0 38.0 38.0 37.0 38.0 12-13 37.43 38.0 38.0 38.0 37.0 38.0 14-15 37.342749999999995 38.0 38.0 38.0 37.0 38.0 16-17 37.33675 38.0 38.0 38.0 37.0 38.0 18-19 37.32925 38.0 38.0 38.0 37.0 38.0 20-21 37.227374999999995 38.0 38.0 38.0 37.0 38.0 22-23 37.21575 38.0 38.0 38.0 37.0 38.0 24-25 37.2495 38.0 38.0 38.0 37.0 38.0 26-27 37.189499999999995 38.0 38.0 38.0 37.0 38.0 28-29 37.127625 38.0 38.0 38.0 36.0 38.0 30-31 37.081125 38.0 38.0 38.0 36.0 38.0 32-33 37.031 38.0 38.0 38.0 36.0 38.0 34-35 37.001625000000004 38.0 38.0 38.0 36.0 38.0 36-37 36.971375 38.0 38.0 38.0 36.0 38.0 38-39 36.937625 38.0 38.0 38.0 35.5 38.0 40-41 36.868750000000006 38.0 38.0 38.0 35.5 38.0 42-43 36.889125 38.0 38.0 38.0 36.0 38.0 44-45 36.667249999999996 38.0 38.0 38.0 34.5 38.0 46-47 36.57925 38.0 38.0 38.0 34.0 38.0 48-49 36.44175 38.0 38.0 38.0 34.0 38.0 50-51 36.343500000000006 38.0 38.0 38.0 33.0 38.0 52-53 36.03575 38.0 37.0 38.0 32.0 38.0 54-55 35.893875 38.0 37.0 38.0 31.5 38.0 56-57 35.789874999999995 38.0 37.0 38.0 31.0 38.0 58-59 35.25125 38.0 36.5 38.0 29.0 38.0 60-61 35.259 38.0 37.0 38.0 29.0 38.0 62-63 35.230125 38.0 36.5 38.0 29.0 38.0 64-65 34.79175 38.0 36.0 38.0 26.0 38.0 66-67 34.807 38.0 36.0 38.0 27.0 38.0 68-69 34.51775 38.0 35.0 38.0 26.0 38.0 70-71 34.186625 38.0 34.0 38.0 24.0 38.0 72-73 33.656 38.0 34.0 38.0 21.0 38.0 74-75 33.356875 38.0 33.5 38.0 19.5 38.0 76-77 33.095375000000004 38.0 33.0 38.0 17.0 38.0 78-79 33.09525 38.0 33.0 38.0 17.5 38.0 80-81 32.348 38.0 32.0 38.0 14.0 38.0 82-83 31.94475 37.0 30.5 38.0 14.0 38.0 84-85 31.974125 38.0 31.0 38.0 14.0 38.0 86-87 31.501375 37.0 29.5 38.0 14.0 38.0 88-89 31.38675 37.0 29.0 38.0 14.0 38.0 90-91 30.68025 37.0 28.0 38.0 13.0 38.0 92-93 30.274625 36.5 27.5 38.0 11.5 38.0 94-95 29.84825 36.0 26.5 38.0 11.0 38.0 96-97 29.871875 36.0 26.5 38.0 11.0 38.0 98-99 29.0975 35.0 24.0 38.0 6.5 38.0 100-101 28.42675 35.0 21.0 38.0 2.0 38.0 102-103 27.546125 33.5 19.0 38.0 2.0 38.0 104-105 26.54725 33.0 14.0 38.0 2.0 38.0 106-107 26.571624999999997 33.0 14.0 38.0 2.0 38.0 108-109 25.795 32.0 14.0 38.0 2.0 38.0 110-111 25.074875 31.0 13.0 38.0 2.0 38.0 112-113 24.352 30.5 12.0 38.0 2.0 38.0 114-115 23.543875 29.5 11.0 37.0 2.0 38.0 116-117 22.593249999999998 28.0 2.0 37.0 2.0 38.0 118-119 21.733 27.5 2.0 36.5 2.0 38.0 120-121 20.940375 27.0 2.0 36.5 2.0 38.0 122-123 19.339624999999998 22.0 2.0 36.0 2.0 38.0 124-125 16.514499999999998 6.5 2.0 35.5 2.0 38.0 126 7.36525 2.0 2.0 2.0 2.0 31.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 1.0 5 0.0 6 1.0 7 0.0 8 1.0 9 3.0 10 2.0 11 5.0 12 9.0 13 12.0 14 7.0 15 15.0 16 20.0 17 16.0 18 32.0 19 29.0 20 36.0 21 38.0 22 41.0 23 40.0 24 58.0 25 85.0 26 81.0 27 90.0 28 115.0 29 135.0 30 176.0 31 234.0 32 292.0 33 380.0 34 477.0 35 636.0 36 693.0 37 239.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.22111055527764 6.753376688344172 7.628814407203602 43.39669834917459 2 27.05 10.525 31.75 30.675 3 24.775 14.299999999999999 22.3 38.625 4 31.6 21.25 19.375 27.775 5 28.325 25.35 23.5 22.825 6 24.625 27.400000000000002 24.575 23.400000000000002 7 18.7 22.025 40.475 18.8 8 22.275 21.349999999999998 30.875000000000004 25.5 9 20.474999999999998 20.375 34.849999999999994 24.3 10-11 23.724999999999998 29.7375 23.724999999999998 22.8125 12-13 23.6375 23.8375 26.075 26.450000000000003 14-15 22.0125 25.025 27.287499999999998 25.674999999999997 16-17 24.075 25.025 25.85 25.05 18-19 24.6125 23.7875 25.3 26.3 20-21 24.2375 23.9 26.375 25.4875 22-23 24.275 24.825 24.5625 26.337500000000002 24-25 24.4125 24.3875 25.15 26.05 26-27 24.575 24.875 24.375 26.174999999999997 28-29 25.087500000000002 24.9 24.875 25.137500000000003 30-31 24.337500000000002 24.5125 24.725 26.424999999999997 32-33 23.375 24.55 25.3 26.775 34-35 24.9 24.224999999999998 24.6875 26.187500000000004 36-37 23.7125 25.2 24.95 26.137500000000003 38-39 24.625 24.3625 24.9 26.1125 40-41 24.224999999999998 24.1375 26.437500000000004 25.2 42-43 23.9875 25.0375 24.474999999999998 26.5 44-45 24.6125 24.1125 25.637500000000003 25.637500000000003 46-47 24.4125 25.224999999999998 24.65 25.7125 48-49 23.5625 24.8 24.837500000000002 26.8 50-51 24.5 24.837500000000002 25.412499999999998 25.25 52-53 24.224999999999998 24.6875 24.9375 26.150000000000002 54-55 24.625 23.95 25.637500000000003 25.7875 56-57 23.7625 24.425 25.624999999999996 26.187500000000004 58-59 23.8817190828217 24.407968926199725 25.05951635133442 26.650795639644155 60-61 24.225316773303224 24.0120436582612 24.66440848074269 27.098231087692888 62-63 24.49184441656211 24.127979924717692 25.38268506900878 25.99749058971142 64-65 24.887218045112782 25.225563909774433 24.047619047619047 25.839598997493734 66-67 24.56756079217849 24.266733517172224 24.617698671346204 26.548007019303082 68-69 24.761904761904763 23.872180451127818 25.701754385964914 25.664160401002505 70-71 24.76118652589241 23.102061337355455 25.82956259426848 26.307189542483663 72-73 23.592527139611207 24.640242363039636 24.842211562736683 26.92501893461247 74-75 24.756975129402853 24.50448175735387 24.80747380381265 25.931069309430626 76-77 25.59576345984113 24.877064682889927 24.410540915395284 25.11663094187366 78-79 24.37547312641938 24.917991420640927 24.097905627050213 26.60862982588948 80-81 24.40070653545294 24.312389603835477 25.321725965177894 25.965177895533685 82-83 25.40022690028993 24.68170931551746 24.97163746375898 24.94642632043363 84-85 24.395742016280526 24.558547276142768 24.38321853475266 26.66249217282404 86-87 24.092161282243925 25.331830703731526 24.442774855997996 26.13323315802655 88-89 25.178414924251907 24.31451108050582 24.577438337298112 25.92963565794416 90-91 23.820843237833103 24.796697109971223 24.934317527836857 26.448142124358814 92-93 24.93116395494368 24.84355444305382 24.618272841051315 25.60700876095119 94-95 25.528984599974958 24.452234881682735 24.740202829598097 25.278577688744207 96-97 24.46196196196196 24.56206206206206 24.512012012012015 26.463963963963966 98-99 25.51033187226049 23.60676268002505 25.0093926111459 25.87351283656857 100-101 24.458359423919852 25.698184095178462 25.14715090795241 24.696305572949278 102-103 25.234815278647467 24.520976831559175 23.969943644333124 26.274264245460238 104-105 25.085475497024184 23.6165632518678 25.300747119159173 25.997214131948844 106-107 26.08695652173913 24.330131445904954 24.355409504550053 25.22750252780586 108-109 25.966290710936512 24.014700291471296 23.92599163604106 26.093017361551134 110-111 24.59913463985747 25.019088826673453 24.853652328836855 25.528124204632224 112-113 25.508130081300813 24.695121951219512 25.03810975609756 24.758638211382113 114-115 24.269005847953213 24.701245868293924 24.701245868293924 26.32850241545894 116-117 24.739649479298958 24.015748031496063 25.184150368300735 26.060452120904245 118-119 25.737913486005088 24.36386768447837 24.07124681933842 25.826972010178118 120-121 25.0031843077315 24.53190676346962 24.137052604763724 26.327856324035153 122-123 24.961754207037227 24.005609382967876 25.05099439061703 25.981642019377873 124-125 25.209656925031766 24.891994917407878 24.11689961880559 25.781448538754763 126 28.318135764944273 20.74468085106383 24.974670719351572 25.962512664640325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.5 27 2.5 28 4.0 29 5.0 30 7.0 31 10.5 32 14.5 33 20.0 34 27.0 35 35.5 36 46.0 37 62.0 38 76.5 39 90.0 40 124.0 41 147.5 42 147.5 43 167.0 44 181.5 45 180.0 46 181.5 47 170.5 48 169.5 49 174.0 50 156.5 51 138.0 52 122.0 53 107.5 54 105.0 55 95.5 56 85.0 57 80.5 58 82.5 59 82.5 60 76.5 61 66.0 62 62.5 63 74.0 64 74.0 65 63.0 66 62.5 67 62.5 68 60.0 69 63.0 70 58.5 71 50.5 72 37.0 73 25.0 74 15.5 75 13.0 76 15.0 77 9.5 78 3.0 79 2.5 80 2.0 81 1.0 82 1.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.2375 60-61 0.36250000000000004 62-63 0.375 64-65 0.25 66-67 0.27499999999999997 68-69 0.25 70-71 0.5499999999999999 72-73 0.975 74-75 0.9875 76-77 0.8625 78-79 0.9249999999999999 80-81 0.9249999999999999 82-83 0.8375 84-85 0.1875 86-87 0.17500000000000002 88-89 0.1625 90-91 0.08750000000000001 92-93 0.125 94-95 0.1625 96-97 0.1 98-99 0.1875 100-101 0.1875 102-103 0.1875 104-105 1.2874999999999999 106-107 1.0999999999999999 108-109 1.3625 110-111 1.775 112-113 1.6 114-115 1.675 116-117 1.575 118-119 1.7500000000000002 120-121 1.8624999999999998 122-123 1.95 124-125 1.625 126 1.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14249684741489 98.275 2 0.832282471626734 1.6500000000000001 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 1.075 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.9875 0.0 0.0 0.0 0.0 112-113 2.25 0.0 0.0 0.0 0.0 114 2.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744562 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744562_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3345 33.0 33.0 34.0 32.0 34.0 2 32.6525 34.0 33.0 34.0 32.0 34.0 3 32.6855 34.0 33.0 34.0 32.0 34.0 4 32.60575 34.0 33.0 34.0 32.0 34.0 5 32.4815 34.0 33.0 34.0 31.0 34.0 6 36.2135 38.0 38.0 38.0 35.0 38.0 7 36.12025 38.0 38.0 38.0 34.0 38.0 8 36.1315 38.0 38.0 38.0 35.0 38.0 9 35.954 38.0 38.0 38.0 34.0 38.0 10-11 35.591875 38.0 38.0 38.0 33.5 38.0 12-13 35.323625 38.0 38.0 38.0 33.0 38.0 14-15 35.264875 38.0 38.0 38.0 32.5 38.0 16-17 35.260625000000005 38.0 38.0 38.0 32.5 38.0 18-19 35.198625 38.0 38.0 38.0 32.0 38.0 20-21 35.159375 38.0 38.0 38.0 31.0 38.0 22-23 35.186125000000004 38.0 38.0 38.0 32.0 38.0 24-25 35.234875 38.0 38.0 38.0 31.0 38.0 26-27 35.207 38.0 38.0 38.0 31.0 38.0 28-29 35.68125 38.0 38.0 38.0 31.0 38.0 30-31 35.973 38.0 38.0 38.0 32.0 38.0 32-33 36.281125 38.0 38.0 38.0 34.0 38.0 34-35 36.300749999999994 38.0 38.0 38.0 34.5 38.0 36-37 36.212500000000006 38.0 38.0 38.0 34.0 38.0 38-39 36.058 38.0 38.0 38.0 34.0 38.0 40-41 36.160875000000004 38.0 38.0 38.0 34.0 38.0 42-43 36.0745 38.0 38.0 38.0 34.0 38.0 44-45 36.153875 38.0 38.0 38.0 34.0 38.0 46-47 36.096374999999995 38.0 38.0 38.0 34.0 38.0 48-49 35.93175 38.0 38.0 38.0 34.0 38.0 50-51 35.65025 38.0 38.0 38.0 33.5 38.0 52-53 35.377250000000004 38.0 38.0 38.0 31.5 38.0 54-55 35.396249999999995 38.0 38.0 38.0 31.0 38.0 56-57 35.226 38.0 38.0 38.0 31.0 38.0 58-59 35.157875000000004 38.0 38.0 38.0 30.0 38.0 60-61 35.05875 38.0 37.5 38.0 29.0 38.0 62-63 34.97525 38.0 37.5 38.0 29.0 38.0 64-65 34.710499999999996 38.0 37.0 38.0 27.5 38.0 66-67 34.741 38.0 37.0 38.0 27.0 38.0 68-69 34.60025 38.0 37.0 38.0 25.5 38.0 70-71 34.375375 38.0 37.0 38.0 25.0 38.0 72-73 34.317 38.0 36.5 38.0 25.0 38.0 74-75 34.093999999999994 38.0 36.0 38.0 23.5 38.0 76-77 33.95525 38.0 36.0 38.0 21.5 38.0 78-79 33.900375 38.0 36.0 38.0 22.0 38.0 80-81 33.70525 38.0 35.0 38.0 20.0 38.0 82-83 33.534375 38.0 34.0 38.0 19.5 38.0 84-85 33.57025 38.0 35.0 38.0 19.0 38.0 86-87 33.543375 38.0 34.5 38.0 19.5 38.0 88-89 33.244875 38.0 34.0 38.0 16.0 38.0 90-91 32.88075 38.0 33.5 38.0 14.0 38.0 92-93 32.30075 38.0 33.0 38.0 13.0 38.0 94-95 32.054125 38.0 33.0 38.0 12.5 38.0 96-97 31.917 38.0 31.5 38.0 12.5 38.0 98-99 31.9685 38.0 33.0 38.0 12.0 38.0 100-101 31.756625 38.0 30.5 38.0 12.5 38.0 102-103 31.8 38.0 31.0 38.0 13.0 38.0 104-105 31.743375 38.0 31.5 38.0 12.0 38.0 106-107 31.390749999999997 38.0 30.5 38.0 11.0 38.0 108-109 30.881375 38.0 29.0 38.0 11.0 38.0 110-111 30.4385 37.0 28.5 38.0 6.5 38.0 112-113 29.740875000000003 36.5 26.5 38.0 2.0 38.0 114-115 29.291249999999998 36.0 25.5 38.0 2.0 38.0 116-117 29.357875 36.5 26.5 38.0 2.0 38.0 118-119 28.644 36.0 24.0 38.0 2.0 38.0 120-121 28.17675 35.5 22.5 38.0 2.0 38.0 122-123 27.22625 36.0 16.5 38.0 2.0 38.0 124-125 25.000500000000002 34.0 2.0 38.0 2.0 38.0 126 12.797 2.0 2.0 27.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 49.0 3 6.0 4 3.0 5 2.0 6 2.0 7 11.0 8 25.0 9 29.0 10 7.0 11 7.0 12 4.0 13 7.0 14 10.0 15 5.0 16 7.0 17 16.0 18 14.0 19 23.0 20 26.0 21 23.0 22 25.0 23 28.0 24 29.0 25 44.0 26 48.0 27 50.0 28 52.0 29 66.0 30 83.0 31 101.0 32 138.0 33 203.0 34 278.0 35 430.0 36 917.0 37 1232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.98230088495575 17.825537294563844 11.858407079646017 36.33375474083439 2 27.975 23.425 28.625 19.975 3 22.019038076152306 24.899799599198396 27.930861723446892 25.150300601202403 4 25.424999999999997 31.55 20.1 22.925 5 27.19959778783308 32.32780291603821 19.859225741578683 20.613373554550023 6 23.430749682337993 32.757306226175345 20.73697585768742 23.074968233799236 7 22.735391681551416 18.474100535850983 34.62618014799694 24.164327634600664 8 23.78640776699029 22.074603985692388 24.399591211037304 29.739397036280018 9 23.151950718685832 21.380903490759753 27.69507186858316 27.772073921971252 10-11 25.457376411054884 28.350849876735435 21.227455559880628 24.964318152329053 12-13 25.741151887162072 23.089983022071305 24.722476165600106 26.446388925166513 14-15 26.01647274153484 24.643744280298076 25.04902601647274 24.290756961694342 16-17 25.493528565825596 24.996731598901818 24.18616812655249 25.323571708720095 18-19 25.34640522875817 24.640522875816995 24.313725490196077 25.699346405228756 20-21 25.30767216548835 24.69232783451165 24.98036135113904 25.01963864886096 22-23 25.81319399085565 25.094709340300458 24.5199216198563 24.572175048987592 24-25 25.28002083876009 24.733003386298517 24.863245636884606 25.12373013805679 26-27 25.07505547578645 25.192533611800027 24.004699125440542 25.72771178697298 28-29 24.760689215060623 25.985960433950222 24.416081684747926 24.837268666241226 30-31 26.24605678233439 24.353312302839118 24.933753943217667 24.466876971608833 32-33 26.424349138473147 25.21695384228399 24.122751855112565 24.2359451641303 34-35 25.937578655927513 24.754593506166625 24.6161590737478 24.691668764158067 36-37 25.31677330322419 24.676953958098107 24.162589386526157 25.843683352151547 38-39 25.09730069052103 26.440677966101696 24.21845574387947 24.243565599497803 40-41 26.089687225222963 24.331114181635474 24.469287777917348 25.109910815224218 42-43 25.2625 24.337500000000002 25.1 25.3 44-45 25.849316785759058 25.347875141030464 24.370063933809703 24.43274413940078 46-47 25.474999999999998 25.825 23.7125 24.9875 48-49 25.541619156214367 25.085518814139114 24.274673761560877 25.098188268085647 50-51 26.068048094141727 24.814530570478382 24.008697876694807 25.108723458685084 52-53 26.269117080066827 25.382341601336588 23.634494280940753 24.714047037655828 54-55 25.91362126245847 24.469716330181445 24.71249680552006 24.90416560184002 56-57 25.983236621534495 24.38426821405545 25.325596389426174 24.306898774983882 58-59 26.842443729903536 24.385852090032152 23.781350482315112 24.990353697749196 60-61 26.197836166924265 24.896960329726944 24.3946419371458 24.510561566202988 62-63 25.965138799225308 24.144609425435764 24.45448676565526 25.43576500968367 64-65 26.572164948453608 23.801546391752577 24.716494845360828 24.90979381443299 66-67 25.969994826694258 24.612002069322298 25.051733057423693 24.36627004655975 68-69 26.41509433962264 25.18738692168519 24.243990695270096 24.153528043422074 70-71 26.48395895570853 24.392778282893882 24.366800883231587 24.756461878165993 72-73 25.37197567602536 24.66037003493337 24.065208953292792 25.90244533574848 74-75 26.163391933815927 24.53464322647363 24.87073422957601 24.431230610134435 76-77 26.05535008289759 24.69072822344089 24.754495600051012 24.49942609361051 78-79 26.25283303953664 24.61596575169982 24.729287333165452 24.401913875598087 80-81 26.021559288042116 25.24442216094259 24.254199047380297 24.479819503634996 82-83 25.47738693467337 24.798994974874372 24.108040201005025 25.615577889447238 84-85 25.691200605984093 24.78222446660775 24.756975129402853 24.769599798005302 86-87 26.20593101692758 24.602265495736287 24.907725595010817 24.284077892325314 88-89 26.501221550726502 24.45673138742446 25.498264112125497 23.543782949723543 90-91 26.822950395026552 23.99948193239218 24.31032249708587 24.867245175495402 92-93 26.50273224043716 24.928441321883945 24.134790528233154 24.434035909445743 94-95 25.87421711899791 24.830375782881003 25.065240083507305 24.23016701461378 96-97 25.57355800388853 25.340246273493193 23.940375891121192 25.145819831497086 98-99 25.86251621271077 25.680933852140075 23.98184176394293 24.474708171206224 100-101 26.184346035015448 25.025746652935116 23.596807415036043 25.193099897013386 102-103 26.557293001794413 24.64752627531402 24.327095616508586 24.46808510638298 104-105 25.807278318810866 25.29472065607381 24.46181445412609 24.436186570989236 106-107 26.554321460487678 25.303204391676243 24.052087322864804 24.090386824971276 108-109 26.685393258426966 24.029622063329928 24.616956077630235 24.66802860061287 110-111 25.817577925396012 24.667858967807867 24.271844660194176 25.24271844660194 112-113 27.09102482495226 24.684914067472945 23.793761935073203 24.43029917250159 114-115 26.996825396825397 24.355555555555554 23.35238095238095 25.295238095238094 116-117 26.245089342288686 25.30731212774046 23.609175009504497 24.838423520466353 118-119 27.181378784024425 25.413380819129994 22.894937674891885 24.5103027219537 120-121 26.33708433430269 25.704893159691487 24.010620811733467 23.947401694272347 122-123 26.890228585782467 25.169555388093446 23.637277066063803 24.302938960060285 124-125 27.839195979899493 24.87437185929648 22.902010050251256 24.384422110552766 126 28.24504142606076 22.596033140848608 22.847100175746924 26.311825257343713 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.5 4 3.0 5 5.5 6 5.5 7 3.5 8 2.0 9 1.0 10 3.5 11 5.5 12 4.0 13 5.0 14 8.0 15 7.5 16 5.5 17 6.5 18 7.0 19 6.5 20 4.0 21 4.0 22 5.0 23 3.5 24 6.0 25 7.0 26 7.5 27 7.0 28 8.5 29 11.0 30 10.0 31 13.5 32 20.0 33 22.5 34 32.5 35 47.0 36 51.5 37 55.0 38 72.0 39 85.0 40 101.5 41 127.0 42 141.0 43 154.5 44 161.5 45 172.0 46 179.5 47 163.0 48 158.5 49 153.5 50 134.5 51 126.0 52 113.0 53 117.0 54 109.0 55 88.5 56 91.0 57 83.0 58 86.5 59 97.5 60 85.0 61 79.0 62 79.5 63 82.0 64 81.0 65 68.5 66 63.0 67 61.0 68 56.0 69 48.5 70 43.0 71 37.5 72 34.0 73 28.5 74 16.0 75 4.5 76 4.5 77 6.0 78 3.5 79 2.5 80 1.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.125 2 0.0 3 0.2 4 0.0 5 0.5499999999999999 6 1.625 7 2.025 8 2.15 9 2.6 10-11 3.6624999999999996 12-13 4.2875000000000005 14-15 4.387499999999999 16-17 4.387499999999999 18-19 4.375 20-21 4.5249999999999995 22-23 4.3125 24-25 4.025 26-27 4.237500000000001 28-29 2.0625 30-31 0.9375 32-33 0.6125 34-35 0.675 36-37 0.36250000000000004 38-39 0.43750000000000006 40-41 0.4875 42-43 0.0 44-45 0.2875 46-47 0.0 48-49 1.3375 50-51 2.275 52-53 2.7375 54-55 2.175 56-57 3.0625 58-59 2.8125 60-61 2.9499999999999997 62-63 3.1875 64-65 3.0 66-67 3.35 68-69 3.2750000000000004 70-71 3.7624999999999997 72-73 3.3875 74-75 3.3000000000000003 76-77 1.9875 78-79 0.7250000000000001 80-81 0.27499999999999997 82-83 0.5 84-85 0.9875 86-87 1.7874999999999999 88-89 2.7875 90-91 3.4875000000000003 92-93 3.925 94-95 4.2 96-97 3.5624999999999996 98-99 3.6249999999999996 100-101 2.9000000000000004 102-103 2.475 104-105 2.45 106-107 2.0875 108-109 2.1 110-111 2.15 112-113 1.8124999999999998 114-115 1.5625 116-117 1.3625 118-119 1.725 120-121 1.1375 122-123 0.475 124-125 0.5 126 0.42500000000000004 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.4785894206549119 0.95 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACGTCTCACTCTTGGAGAACACAGGACACCTCCGGTCTTAGCAGCGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.5125 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.4124999999999996 0.0 0.0 0.0 0.0 114 2.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910927 spots for ERR1744562.sra Written 910927 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra Read 910925 spots for ERR1744562.sra Written 910925 spots for ERR1744562.sra SRR ids: ['ERR1744562.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u5fcj9ji ERR1744562.sra spots: 18218502 blocks: [[1, 910925], [910926, 1821850], [1821851, 2732775], [2732776, 3643700], [3643701, 4554625], [4554626, 5465550], [5465551, 6376475], [6376476, 7287400], [7287401, 8198325], [8198326, 9109250], [9109251, 10020175], [10020176, 10931100], [10931101, 11842025], [11842026, 12752950], [12752951, 13663875], [13663876, 14574800], [14574801, 15485725], [15485726, 16396650], [16396651, 17307575], [17307576, 18218502]] ERR1744562 file size 5262376 ERR1744562 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744562 ERR1744562_1.fastq ERR1744562_2.fastq Input file: ERR1744562_1.fastq Paired file: ERR1744562_2.fastq trimmed: ERR1744562-trimmed-pair1.fastq, ERR1744562-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:56:01 2024 >> started Sat Dec 7 00:56:20 2024 >> done (18.815s) 18218502 read pairs processed; of these: 23413 ( 0.13%) short read pairs filtered out after trimming by size control 25525 ( 0.14%) empty read pairs filtered out after trimming by size control 18169564 (99.73%) read pairs available; of these: 15795370 (86.93%) trimmed read pairs available after processing 2374194 (13.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 11 0.00% 20 9 0.00% 21 20 0.00% 22 26 0.00% 23 19 0.00% 24 34 0.00% 25 22 0.00% 26 40 0.00% 27 40 0.00% 28 47 0.00% 29 82 0.00% 30 79 0.00% 31 99 0.00% 32 106 0.00% 33 148 0.00% 34 157 0.00% 35 172 0.00% 36 210 0.00% 37 253 0.00% 38 317 0.00% 39 375 0.00% 40 442 0.00% 41 511 0.00% 42 504 0.00% 43 599 0.00% 44 732 0.00% 45 733 0.00% 46 887 0.00% 47 1002 0.01% 48 1117 0.01% 49 1213 0.01% 50 1305 0.01% 51 1516 0.01% 52 1683 0.01% 53 1851 0.01% 54 2163 0.01% 55 2200 0.01% 56 2382 0.01% 57 2645 0.01% 58 2895 0.02% 59 3194 0.02% 60 3523 0.02% 61 3786 0.02% 62 4316 0.02% 63 4789 0.03% 64 5008 0.03% 65 5566 0.03% 66 6017 0.03% 67 6658 0.04% 68 7369 0.04% 69 8157 0.04% 70 9080 0.05% 71 9879 0.05% 72 11182 0.06% 73 11709 0.06% 74 12673 0.07% 75 13303 0.07% 76 14211 0.08% 77 15341 0.08% 78 15833 0.09% 79 17162 0.09% 80 18012 0.10% 81 19326 0.11% 82 20602 0.11% 83 22342 0.12% 84 23674 0.13% 85 25803 0.14% 86 27781 0.15% 87 30107 0.17% 88 32335 0.18% 89 35145 0.19% 90 41384 0.23% 91 47062 0.26% 92 42422 0.23% 93 44407 0.24% 94 48386 0.27% 95 50388 0.28% 96 53978 0.30% 97 57818 0.32% 98 61861 0.34% 99 66758 0.37% 100 71825 0.40% 101 77534 0.43% 102 83848 0.46% 103 91241 0.50% 104 97843 0.54% 105 105962 0.58% 106 114149 0.63% 107 121218 0.67% 108 131222 0.72% 109 141552 0.78% 110 154861 0.85% 111 168589 0.93% 112 187161 1.03% 113 208753 1.15% 114 229501 1.26% 115 254619 1.40% 116 283955 1.56% 117 324084 1.78% 118 376134 2.07% 119 439822 2.42% 120 533347 2.94% 121 664235 3.66% 122 859008 4.73% 123 1212028 6.67% 124 2077687 11.43% 125 5798182 31.91% 126 2374194 13.07% 18169564 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=26 prefix-density=0.45 prefix-fanout=2.0 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=29 fanout-score=27.40 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.5 sequence=GCCATCTCCATCCCGCCGGAGCTCGCCTTGTGGGCGGGGGTGGCGACGACGAGGAGGCTGGAGGTCTGGACCTCGGCTTCAGGGTACATGTTGCAGCCGTTGCAGCCGCTGCCGCACTTGCAGGATGACCCGCAGTTGCAGTTTCCTCCGCAGCAAGACATCT criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=27 prefix-density=0.35 prefix-fanout=2.1 sequence=GAAGATGTCTTGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=163.71 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.0 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTT ERR1744562 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:56:58 Started mapping on | Dec 07 00:56:58 Finished on | Dec 07 00:58:25 Mapping speed, Million of reads per hour | 751.84 Number of input reads | 18169564 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 17380160 Uniquely mapped reads % | 95.66% Average mapped length | 239.62 Number of splices: Total | 13749972 Number of splices: Annotated (sjdb) | 12784497 Number of splices: GT/AG | 13544482 Number of splices: GC/AG | 158212 Number of splices: AT/AC | 5470 Number of splices: Non-canonical | 41808 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.76 Insertion rate per base | 0.02% Insertion average length | 2.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 306841 % of reads mapped to multiple loci | 1.69% Number of reads mapped to too many loci | 26520 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.89% % of reads unmapped: other | 0.62% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 496701 496701 496701 N_multimapping 306841 306841 306841 N_noFeature 955396 16893421 1095327 N_ambiguous 404393 2641 57850 UnstrandedReadsAssigned:16020371 PositiveStrandReadsAssigned:484098 NegativeStrandReadsAssigned:16226983 Dataset is classified negative stranded MeadianReadLen=123 20thPercentileLength=110 echo kmer=105 ERR1744562 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744562-trimmed-pair1.fastq ERR1744562-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,169,564 reads, 16,289,014 reads pseudoaligned [quant] estimated average fragment length: 204.92 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52973 ERR1744562.ke.tsv 35125 ERR1744562.se.tsv 88098 total ==> ERR1744562.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 732.273 0 0 PNS24247 1044 840.08 62.1931 6.53353 PNS24249 1928 1724.08 98.3594 5.03483 PNS24246 1044 840.08 62.1931 6.53353 PNS24248 1044 840.08 62.1931 6.53353 PNS24244 1471 1267.08 131.061 9.12845 PNS24243 293 107.699 0 0 KQK14069 1603 1399.08 10361.1 653.569 KQK14071 474 273.336 411.835 132.97 ==> ERR1744562.se.tsv <== BRADI_1g14170v3 12955 BRADI_1g53295v3 692 BRADI_1g59795v3 156 BRADI_1g07683v3 0 BRADI_1g00485v3 21 BRADI_1g20270v3 635 BRADI_1g74790v3 172 BRADI_1g09890v3 0 BRADI_1g77505v3 269 BRADI_1g48960v3 0 ERR1744562 completed mapping pipeline successfully