Starting /dee2/code/volunteer_pipeline.sh ERR1744563 current disk space = 1548135104512 free memory = 1603951112 ERR1744563 SRAfilesize f9ccbdfed9b8df697477e7dfa0067008 ERR1744563.sra ERR1744563.sra file validated ERR1744563 is paired end ERR1744563 is conventional basespace ERR1744563 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744563_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12525 34.0 33.0 34.0 32.0 34.0 2 33.22425 34.0 33.0 34.0 32.0 34.0 3 33.252 34.0 33.0 34.0 32.0 34.0 4 33.14425 34.0 33.0 34.0 32.0 34.0 5 33.17 34.0 33.0 34.0 32.0 34.0 6 36.72225 38.0 37.0 38.0 34.0 38.0 7 37.1145 38.0 38.0 38.0 36.0 38.0 8 37.3265 38.0 38.0 38.0 37.0 38.0 9 37.42775 38.0 38.0 38.0 37.0 38.0 10-11 37.39175 38.0 38.0 38.0 37.0 38.0 12-13 37.37375 38.0 38.0 38.0 37.0 38.0 14-15 37.411125 38.0 38.0 38.0 37.0 38.0 16-17 37.325125 38.0 38.0 38.0 37.0 38.0 18-19 37.3805 38.0 38.0 38.0 37.0 38.0 20-21 37.3395 38.0 38.0 38.0 37.0 38.0 22-23 37.38575 38.0 38.0 38.0 37.0 38.0 24-25 37.26275 38.0 38.0 38.0 37.0 38.0 26-27 37.222625 38.0 38.0 38.0 37.0 38.0 28-29 37.235375000000005 38.0 38.0 38.0 37.0 38.0 30-31 37.203375 38.0 38.0 38.0 36.5 38.0 32-33 37.249625 38.0 38.0 38.0 36.5 38.0 34-35 37.095375000000004 38.0 38.0 38.0 36.0 38.0 36-37 37.139125 38.0 38.0 38.0 36.5 38.0 38-39 37.063125 38.0 38.0 38.0 36.0 38.0 40-41 37.0025 38.0 38.0 38.0 36.0 38.0 42-43 37.057 38.0 38.0 38.0 36.0 38.0 44-45 36.900625000000005 38.0 38.0 38.0 35.5 38.0 46-47 36.913125 38.0 38.0 38.0 35.0 38.0 48-49 36.708 38.0 38.0 38.0 35.0 38.0 50-51 36.595625 38.0 38.0 38.0 33.5 38.0 52-53 36.348375000000004 38.0 38.0 38.0 33.5 38.0 54-55 36.265125 38.0 38.0 38.0 32.5 38.0 56-57 36.162375 38.0 37.5 38.0 32.5 38.0 58-59 35.681375 38.0 37.0 38.0 30.5 38.0 60-61 35.686875 38.0 37.0 38.0 30.5 38.0 62-63 35.70575 38.0 37.0 38.0 30.5 38.0 64-65 35.244125 38.0 37.0 38.0 29.0 38.0 66-67 35.27225 38.0 37.0 38.0 29.0 38.0 68-69 35.147499999999994 38.0 36.5 38.0 29.0 38.0 70-71 34.9195 38.0 36.0 38.0 28.0 38.0 72-73 34.576125 38.0 35.5 38.0 26.0 38.0 74-75 34.1425 38.0 34.5 38.0 23.5 38.0 76-77 34.0465 38.0 34.0 38.0 22.5 38.0 78-79 33.9895 38.0 34.0 38.0 24.0 38.0 80-81 33.39475 38.0 33.5 38.0 17.5 38.0 82-83 33.055125000000004 38.0 33.0 38.0 18.5 38.0 84-85 33.194875 38.0 33.0 38.0 19.5 38.0 86-87 32.79975 38.0 32.0 38.0 17.0 38.0 88-89 32.604625 38.0 32.0 38.0 14.0 38.0 90-91 32.032250000000005 37.0 30.5 38.0 14.0 38.0 92-93 31.54325 37.0 29.5 38.0 14.0 38.0 94-95 31.273625 37.0 29.0 38.0 14.0 38.0 96-97 31.502375 37.0 29.5 38.0 14.0 38.0 98-99 30.64525 36.5 28.0 38.0 12.5 38.0 100-101 29.99975 35.5 26.0 38.0 11.5 38.0 102-103 28.923375 34.5 22.5 38.0 11.0 38.0 104-105 28.253125 34.0 21.0 38.0 6.5 38.0 106-107 28.427750000000003 34.0 22.0 38.0 2.0 38.0 108-109 27.838 33.5 20.5 38.0 2.0 38.0 110-111 26.934375 33.0 18.0 38.0 2.0 38.0 112-113 26.416125 33.0 14.0 38.0 2.0 38.0 114-115 25.406 32.0 13.5 38.0 2.0 38.0 116-117 24.36525 30.0 12.0 37.5 2.0 38.0 118-119 23.758 30.0 6.5 37.0 2.0 38.0 120-121 22.9685 30.0 2.0 37.0 2.0 38.0 122-123 21.241750000000003 28.0 2.0 37.0 2.0 38.0 124-125 18.037750000000003 12.5 2.0 36.5 2.0 38.0 126 7.88 2.0 2.0 2.0 2.0 31.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 3.0 12 6.0 13 5.0 14 9.0 15 5.0 16 9.0 17 17.0 18 27.0 19 20.0 20 19.0 21 27.0 22 22.0 23 37.0 24 49.0 25 67.0 26 62.0 27 85.0 28 96.0 29 110.0 30 159.0 31 203.0 32 284.0 33 327.0 34 466.0 35 733.0 36 859.0 37 290.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.718859429714854 6.953476738369184 9.079539769884942 46.24812406203102 2 27.425 9.9 30.025000000000002 32.65 3 26.525 14.325 21.675 37.475 4 30.75 22.0 18.975 28.275 5 28.625 27.05 22.475 21.85 6 24.875 29.849999999999998 24.25 21.025 7 19.3 22.175 39.475 19.05 8 22.025 22.400000000000002 29.775000000000002 25.8 9 20.05 20.45 33.900000000000006 25.6 10-11 23.7125 29.775000000000002 24.587500000000002 21.925 12-13 23.724999999999998 24.212500000000002 28.0625 24.0 14-15 23.5 25.087500000000002 26.325 25.087500000000002 16-17 24.3875 24.762500000000003 25.5375 25.3125 18-19 23.5625 25.85 25.3 25.2875 20-21 23.9375 25.35 25.224999999999998 25.4875 22-23 23.8625 25.137500000000003 25.55 25.45 24-25 24.099999999999998 25.05 25.5 25.35 26-27 23.5625 25.0625 25.674999999999997 25.7 28-29 23.875 24.7375 24.962500000000002 26.424999999999997 30-31 24.5 24.8125 25.025 25.662499999999998 32-33 23.5875 25.624999999999996 25.074999999999996 25.7125 34-35 23.962500000000002 24.85 24.7 26.487500000000004 36-37 22.8 25.4875 25.674999999999997 26.0375 38-39 23.4375 25.387500000000003 25.0375 26.137500000000003 40-41 24.474999999999998 24.425 24.65 26.450000000000003 42-43 23.5125 25.15 25.5 25.837500000000002 44-45 24.7875 24.775 24.85 25.587500000000002 46-47 23.7375 25.0375 25.900000000000002 25.324999999999996 48-49 24.4 24.4375 25.275 25.887500000000003 50-51 23.95 24.4375 25.587500000000002 26.025 52-53 25.162499999999998 24.15 25.424999999999997 25.2625 54-55 23.849999999999998 25.112499999999997 25.112499999999997 25.924999999999997 56-57 23.7 24.55 25.45 26.3 58-59 23.337515683814303 25.583437892095358 25.972396486825595 25.10664993726474 60-61 23.9647577092511 25.5254877281309 25.059786028949027 25.449968533668976 62-63 23.829894313034725 24.57221942627076 26.00654252642174 25.591343734272776 64-65 24.60746137419922 25.097349579198593 24.632583846250473 25.662605200351713 66-67 23.87647501883003 25.345217172985183 24.905849861913133 25.872457946271656 68-69 24.591605931138478 25.182206584568988 25.106810756471475 25.11937672782106 70-71 24.959114354006793 24.707510378663983 24.317524216882628 26.0158510504466 72-73 24.493392070484582 24.556324732536186 23.989930774071745 26.96035242290749 74-75 24.171392564587272 24.574669187145556 25.381222432262128 25.872715816005044 76-77 25.220347519516494 24.213044573155376 25.409216821959202 25.157391085368925 78-79 23.718352437334676 24.826804383423607 25.343242221942308 26.11160095729941 80-81 24.430459408432977 25.03461296412838 24.59408432976715 25.94084329767149 82-83 25.179132620993087 24.3997485857951 24.78944060339409 25.631678189817723 84-85 24.46394984326019 24.12539184952978 25.178683385579937 26.231974921630098 86-87 24.592629731762347 24.266733517172224 25.47004261719729 25.670594133868136 88-89 25.13161193281524 24.204061168212583 24.542491852594637 26.12183504637754 90-91 24.943623152092208 24.53019293410173 24.95615134051616 25.570032573289904 92-93 24.523809523809522 24.87468671679198 25.225563909774433 25.375939849624064 94-95 24.952978056426332 24.890282131661444 23.97492163009404 26.181818181818183 96-97 24.71206810215323 25.463194792188283 24.44917376064096 25.375563345017525 98-99 25.244667503136764 24.80552070263488 25.332496863237143 24.617314930991217 100-101 24.636226793778224 25.388861013547416 25.263421976919215 24.711490215755145 102-103 24.39483255988963 25.00940674777374 25.473472971278067 25.122287721058573 104-105 23.93086918127917 24.15794121357386 25.924057020310332 25.987132584836637 106-107 24.319213313161875 25.126071608673726 24.8613212304589 25.693393847705497 108-109 25.192672141503476 25.47062539481996 23.81554011370815 25.521162349968414 110-111 24.46024892049784 24.5999491998984 25.222250444500887 25.71755143510287 112-113 24.689322850621352 24.942936850114126 24.866852650266296 25.500887648998226 114-115 24.82233502538071 24.911167512690355 24.403553299492387 25.862944162436545 116-117 25.250348586639625 24.40106477373558 24.058816073013055 26.289770566611736 118-119 25.0 25.82571138211382 23.653455284552845 25.520833333333332 120-121 24.86631016042781 26.54698242933537 23.898650369238606 24.688057040998217 122-123 25.050942435048395 24.88537952114111 24.13397860417728 25.929699439633215 124-125 25.995434948009127 25.767182348465635 23.116916053766168 25.120466649759067 126 26.632782719186785 20.609911054637866 24.80304955527319 27.95425667090216 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.5 25 4.0 26 3.0 27 1.5 28 3.5 29 6.0 30 10.5 31 14.5 32 17.5 33 21.5 34 29.5 35 41.5 36 50.5 37 65.5 38 80.5 39 91.0 40 110.0 41 153.0 42 173.5 43 173.5 44 188.0 45 183.5 46 173.5 47 166.0 48 175.5 49 167.5 50 137.0 51 126.5 52 124.5 53 116.5 54 89.5 55 78.5 56 87.0 57 89.5 58 96.5 59 94.0 60 78.5 61 78.0 62 82.5 63 73.0 64 64.0 65 59.0 66 65.5 67 70.5 68 54.5 69 43.0 70 37.0 71 31.5 72 27.5 73 22.0 74 19.5 75 15.0 76 11.5 77 8.0 78 4.0 79 3.5 80 2.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.375 60-61 0.6875 62-63 0.65 64-65 0.4875 66-67 0.42500000000000004 68-69 0.525 70-71 0.6375 72-73 0.6875 74-75 0.8125 76-77 0.7250000000000001 78-79 0.7625 80-81 0.6875 82-83 0.5625 84-85 0.3125 86-87 0.27499999999999997 88-89 0.27499999999999997 90-91 0.22499999999999998 92-93 0.25 94-95 0.3125 96-97 0.15 98-99 0.375 100-101 0.35000000000000003 102-103 0.3375 104-105 0.9125 106-107 0.8500000000000001 108-109 1.0625 110-111 1.575 112-113 1.425 114-115 1.5 116-117 1.3875 118-119 1.6 120-121 1.825 122-123 1.8499999999999999 124-125 1.425 126 1.625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93617021276596 97.65 2 0.8611955420466059 1.7000000000000002 3 0.1773049645390071 0.525 4 0.0 0.0 5 0.025329280648429587 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCGGAGTTTATATTACATGCCCCTCTCCCAACGATAGTTGTAGTACTCTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.7875000000000001 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.7999999999999998 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.2375 0.0 0.0 0.0 0.0 110-111 3.9375 0.0 0.0 0.0 0.0 112-113 4.6625 0.0 0.0 0.0 0.0 114 5.225 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744563 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744563_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 50 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.527 33.0 33.0 34.0 32.0 34.0 2 32.76625 34.0 33.0 34.0 32.0 34.0 3 32.757 34.0 33.0 34.0 32.0 34.0 4 32.751 34.0 33.0 34.0 32.0 34.0 5 32.614 34.0 33.0 34.0 31.0 34.0 6 36.41725 38.0 38.0 38.0 36.0 38.0 7 36.30775 38.0 38.0 38.0 36.0 38.0 8 36.30475 38.0 38.0 38.0 35.0 38.0 9 36.142 38.0 38.0 38.0 34.0 38.0 10-11 35.90325 38.0 38.0 38.0 34.5 38.0 12-13 35.567125000000004 38.0 38.0 38.0 33.0 38.0 14-15 35.524125 38.0 38.0 38.0 33.0 38.0 16-17 35.551125 38.0 38.0 38.0 33.0 38.0 18-19 35.450125 38.0 38.0 38.0 33.0 38.0 20-21 35.2595 38.0 38.0 38.0 31.0 38.0 22-23 35.454375 38.0 38.0 38.0 32.0 38.0 24-25 35.508875 38.0 38.0 38.0 33.0 38.0 26-27 35.56975 38.0 38.0 38.0 33.5 38.0 28-29 35.962 38.0 38.0 38.0 34.0 38.0 30-31 36.284000000000006 38.0 38.0 38.0 33.5 38.0 32-33 36.492999999999995 38.0 38.0 38.0 35.0 38.0 34-35 36.510999999999996 38.0 38.0 38.0 35.0 38.0 36-37 36.4195 38.0 38.0 38.0 35.0 38.0 38-39 36.29625 38.0 38.0 38.0 34.5 38.0 40-41 36.40675 38.0 38.0 38.0 35.0 38.0 42-43 36.44499999999999 38.0 38.0 38.0 35.0 38.0 44-45 36.4935 38.0 38.0 38.0 35.5 38.0 46-47 36.396375000000006 38.0 38.0 38.0 35.0 38.0 48-49 36.149249999999995 38.0 38.0 38.0 34.0 38.0 50-51 35.886250000000004 38.0 38.0 38.0 34.0 38.0 52-53 35.627750000000006 38.0 38.0 38.0 33.0 38.0 54-55 35.706125 38.0 38.0 38.0 33.5 38.0 56-57 35.70375 38.0 38.0 38.0 33.5 38.0 58-59 35.498875 38.0 38.0 38.0 32.5 38.0 60-61 35.463750000000005 38.0 38.0 38.0 32.5 38.0 62-63 35.377875 38.0 38.0 38.0 31.0 38.0 64-65 35.1 38.0 38.0 38.0 29.0 38.0 66-67 35.150375 38.0 38.0 38.0 30.0 38.0 68-69 34.994125 38.0 37.5 38.0 30.0 38.0 70-71 34.80275 38.0 37.0 38.0 28.0 38.0 72-73 34.6875 38.0 37.0 38.0 26.0 38.0 74-75 34.587375 38.0 37.0 38.0 27.5 38.0 76-77 34.50175 38.0 37.0 38.0 25.5 38.0 78-79 34.4755 38.0 37.0 38.0 26.0 38.0 80-81 34.268375000000006 38.0 36.0 38.0 25.0 38.0 82-83 33.931625 38.0 36.0 38.0 21.0 38.0 84-85 34.04275 38.0 35.5 38.0 22.5 38.0 86-87 33.977000000000004 38.0 36.0 38.0 22.5 38.0 88-89 33.970875 38.0 36.0 38.0 22.0 38.0 90-91 33.514125 38.0 35.0 38.0 17.5 38.0 92-93 33.121625 38.0 34.0 38.0 14.0 38.0 94-95 32.752125 38.0 33.0 38.0 14.0 38.0 96-97 32.694125 38.0 33.0 38.0 14.0 38.0 98-99 32.842625 38.0 33.5 38.0 14.0 38.0 100-101 32.606125 38.0 33.0 38.0 14.0 38.0 102-103 32.666624999999996 38.0 33.0 38.0 14.0 38.0 104-105 32.332875 38.0 33.0 38.0 13.0 38.0 106-107 32.27325 38.0 33.0 38.0 13.0 38.0 108-109 31.87725 38.0 31.0 38.0 12.5 38.0 110-111 31.371125 38.0 30.5 38.0 11.5 38.0 112-113 30.797625 37.0 29.0 38.0 11.0 38.0 114-115 30.374375 37.0 28.0 38.0 11.0 38.0 116-117 30.384 37.0 28.0 38.0 2.0 38.0 118-119 29.890875 36.5 27.5 38.0 2.0 38.0 120-121 29.278624999999998 36.0 26.5 38.0 2.0 38.0 122-123 28.633625000000002 36.0 24.5 38.0 2.0 38.0 124-125 26.77825 36.0 11.5 38.0 2.0 38.0 126 13.1865 2.0 2.0 28.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 30.0 3 10.0 4 8.0 5 0.0 6 4.0 7 7.0 8 30.0 9 27.0 10 10.0 11 6.0 12 3.0 13 12.0 14 6.0 15 12.0 16 9.0 17 9.0 18 7.0 19 14.0 20 13.0 21 12.0 22 15.0 23 22.0 24 26.0 25 36.0 26 32.0 27 47.0 28 45.0 29 68.0 30 80.0 31 88.0 32 124.0 33 152.0 34 251.0 35 435.0 36 937.0 37 1413.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.836528758829463 17.15438950554995 13.799192734611504 37.20988900100908 2 30.875000000000004 22.825 27.700000000000003 18.6 3 23.517638228671505 25.66925193895422 26.019514635976982 24.7935951963973 4 26.581645411352838 30.332583145786447 19.4048512128032 23.680920230057513 5 28.224392687202602 32.632106185825194 19.30879038317055 19.834710743801654 6 23.307126553385746 34.795840730408315 20.542733958914532 21.354298757291403 7 23.836174001526327 17.67997964894429 34.87662172475197 23.60722462477741 8 25.127291242362524 22.428716904276985 24.618126272912424 27.825865580448067 9 23.631713554987215 22.327365728900254 28.43989769820972 25.60102301790281 10-11 26.877012234385063 27.443657437218288 20.37347070186735 25.305859626529298 12-13 25.67129329355299 23.102866779089375 25.191334803476455 26.03450512388118 14-15 25.428348909657323 25.661993769470403 23.909657320872274 25.0 16-17 26.667531793407733 24.708019724889695 23.695821437840646 24.928627043861926 18-19 26.330132364391385 24.46145860368544 24.409550999221384 24.79885803270179 20-21 25.4294638209266 25.871941697032796 24.479437792816242 24.21915668922436 22-23 26.701231367465976 24.43292287751134 24.484769928710303 24.38107582631238 24-25 26.23755977769161 25.69471371332558 24.415147990177072 23.65257851880574 26-27 25.168481078278905 25.842405391394507 24.19647485743909 24.792638672887506 28-29 26.7293997965412 24.020854526958292 24.46592065106816 24.78382502543235 30-31 25.336181978132462 25.10996606761342 24.192534874952873 25.361317079301244 32-33 26.832936458202784 25.341521493921544 24.476751472615614 23.348790575260058 34-35 26.567201604814443 23.796389167502507 24.536108324974926 25.100300902708124 36-37 24.55262169941184 25.591290201476664 23.97697409585784 25.87911400325366 38-39 25.819774718397998 26.12015018773467 23.76720901126408 24.292866082603254 40-41 25.810895428929243 26.03631809643081 23.393863494051345 24.758922980588604 42-43 25.7375 25.924999999999997 24.425 23.9125 44-45 25.95095095095095 25.312812812812812 24.14914914914915 24.587087087087088 46-47 27.700000000000003 25.1 23.05 24.15 48-49 25.491927346115034 25.20181634712412 24.70988900100908 24.596367305751766 50-51 25.841836734693878 24.910714285714285 25.408163265306122 23.839285714285715 52-53 26.96586114307633 24.331926863572434 24.728295614371564 23.97391637897967 54-55 25.359826773659407 25.04139600050949 24.45548337791364 25.143293847917462 56-57 26.135927300652757 25.521566619736337 23.85767310892103 24.484832970689876 58-59 26.298286006651317 24.354054745459198 24.162189818367867 25.185469429521618 60-61 25.518831667947733 25.441967717140663 24.686138867537792 24.353061747373815 62-63 26.64102564102564 25.051282051282055 23.692307692307693 24.615384615384617 64-65 26.25032059502437 24.211336240061556 25.08335470633496 24.454988458579123 66-67 25.98870056497175 24.87159732922445 24.845916795069336 24.293785310734464 68-69 25.077002053388092 24.743326488706366 24.987166324435318 25.192505133470227 70-71 26.59533324738945 24.90653603197112 24.081474796957586 24.416655923681834 72-73 25.67428718212176 24.813768302080657 24.41561777549448 25.09632674030311 74-75 26.7735728030789 25.298268120590123 24.0795381654907 23.848620910840282 76-77 26.121774501080463 24.58370408033558 24.90148722511758 24.393034193466377 78-79 25.075263421976917 25.551931761164077 24.786753637732062 24.586051179126944 80-81 25.666374671505444 25.36603679139031 24.465023151044925 24.502565386059317 82-83 26.93463561232156 24.931129476584022 23.86676684197345 24.267468069120962 84-85 25.43054682589566 24.68887492143306 25.355122564424892 24.525455688246385 86-87 25.562190318892135 25.066700546309235 25.003176216490914 24.367932918307712 88-89 26.286153058612747 25.825441515229073 24.37931917071922 23.509086255438955 90-91 25.520699408588328 24.08074055026999 25.662123939316018 24.736436101825664 92-93 26.394628099173556 25.426136363636363 24.71590909090909 23.46332644628099 94-95 26.677026677026678 24.864024864024863 23.78917378917379 24.669774669774668 96-97 26.37334362536987 24.8166730991895 24.237746043998456 24.57223723144217 98-99 25.499034127495168 25.51191242755956 25.48615582743078 23.50289761751449 100-101 26.21943413135322 25.848162847266675 23.710152349251057 24.222250672129046 102-103 25.85920531493548 25.309824964865214 24.019419956560622 24.811549763638688 104-105 26.48862765141835 25.32583695374393 24.763608484538718 23.421926910299003 106-107 26.1656050955414 25.65605095541401 24.53503184713376 23.643312101910826 108-109 26.98917886696372 24.20114576702737 25.499681731381287 23.309993634627627 110-111 25.71028156453051 26.805962542999108 23.327812460186014 24.155943432284367 112-113 26.514285714285712 24.698412698412696 24.08888888888889 24.698412698412696 114-115 26.405063291139243 25.126582278481013 24.139240506329113 24.32911392405063 116-117 27.736396919580862 25.665951268779196 23.26726423431385 23.330387577326096 118-119 26.364559532876363 25.945671490225948 23.813150545823813 23.876618431073876 120-121 27.455919395465994 25.717884130982366 22.858942065491185 23.967254408060455 122-123 27.566349524286434 26.389584376564844 23.109664496745115 22.934401602403607 124-125 27.38199574308251 26.68085639163641 22.86215099536747 23.074996869913612 126 29.233870967741936 23.941532258064516 23.084677419354836 23.739919354838708 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 1.0 4 2.0 5 1.0 6 1.0 7 1.0 8 1.5 9 2.5 10 3.0 11 3.5 12 4.0 13 5.0 14 7.0 15 9.5 16 7.5 17 6.0 18 5.0 19 3.5 20 4.5 21 5.0 22 4.0 23 3.5 24 4.0 25 6.5 26 9.0 27 6.0 28 7.0 29 9.5 30 7.0 31 11.0 32 17.0 33 25.5 34 32.0 35 35.5 36 56.0 37 74.5 38 79.5 39 96.0 40 116.0 41 131.0 42 150.5 43 163.5 44 167.0 45 164.5 46 157.0 47 158.0 48 153.0 49 144.0 50 143.0 51 125.0 52 105.5 53 100.5 54 106.0 55 95.0 56 84.0 57 90.5 58 107.5 59 110.5 60 86.0 61 74.5 62 79.0 63 76.5 64 62.0 65 62.5 66 71.0 67 66.5 68 58.0 69 52.5 70 43.0 71 40.5 72 35.5 73 22.5 74 15.0 75 9.0 76 6.0 77 4.0 78 2.0 79 1.5 80 0.5 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8999999999999999 2 0.0 3 0.075 4 0.025 5 0.17500000000000002 6 1.425 7 1.725 8 1.7999999999999998 9 2.25 10-11 2.9375 12-13 3.6374999999999997 14-15 3.6999999999999997 16-17 3.675 18-19 3.675 20-21 3.95 22-23 3.5624999999999996 24-25 3.2875 26-27 3.55 28-29 1.7000000000000002 30-31 0.5375 32-33 0.2625 34-35 0.3 36-37 0.11249999999999999 38-39 0.125 40-41 0.1875 42-43 0.0 44-45 0.1 46-47 0.0 48-49 0.8999999999999999 50-51 2.0 52-53 2.2375 54-55 1.8624999999999998 56-57 2.3375 58-59 2.275 60-61 2.4250000000000003 62-63 2.5 64-65 2.5250000000000004 66-67 2.65 68-69 2.6 70-71 3.0375 72-73 2.675 74-75 2.5625 76-77 1.6625 78-79 0.35000000000000003 80-81 0.11249999999999999 82-83 0.17500000000000002 84-85 0.5625 86-87 1.6125 88-89 2.325 90-91 2.775 92-93 3.2 94-95 3.4750000000000005 96-97 2.8375 98-99 2.9375 100-101 2.3625 102-103 2.1624999999999996 104-105 2.175 106-107 1.875 108-109 1.8124999999999998 110-111 1.8875 112-113 1.5625 114-115 1.25 116-117 0.9875 118-119 1.525 120-121 0.75 122-123 0.15 124-125 0.1625 126 0.8 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24261550113607 98.275 2 0.555415299166877 1.0999999999999999 3 0.17672304973491543 0.525 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.8125 0.0 0.0 0.0 0.0 104-105 2.275 0.0 0.0 0.0 0.0 106-107 2.675 0.0 0.0 0.0 0.0 108-109 3.2625 0.0 0.0 0.0 0.0 110-111 4.0 0.0 0.0 0.0 0.0 112-113 4.699999999999999 0.0 0.0 0.0 0.0 114 5.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912897 spots for ERR1744563.sra Written 912897 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra Read 912888 spots for ERR1744563.sra Written 912888 spots for ERR1744563.sra SRR ids: ['ERR1744563.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3lcmd75f ERR1744563.sra spots: 18257769 blocks: [[1, 912888], [912889, 1825776], [1825777, 2738664], [2738665, 3651552], [3651553, 4564440], [4564441, 5477328], [5477329, 6390216], [6390217, 7303104], [7303105, 8215992], [8215993, 9128880], [9128881, 10041768], [10041769, 10954656], [10954657, 11867544], [11867545, 12780432], [12780433, 13693320], [13693321, 14606208], [14606209, 15519096], [15519097, 16431984], [16431985, 17344872], [17344873, 18257769]] ERR1744563 file size 5273765 ERR1744563 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744563 ERR1744563_1.fastq ERR1744563_2.fastq Input file: ERR1744563_1.fastq Paired file: ERR1744563_2.fastq trimmed: ERR1744563-trimmed-pair1.fastq, ERR1744563-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:56:39 2024 >> started Sat Dec 7 00:56:56 2024 >> done (17.458s) 18257769 read pairs processed; of these: 20847 ( 0.11%) short read pairs filtered out after trimming by size control 25811 ( 0.14%) empty read pairs filtered out after trimming by size control 18211111 (99.74%) read pairs available; of these: 15965426 (87.67%) trimmed read pairs available after processing 2245685 (12.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 6 0.00% 21 2 0.00% 22 12 0.00% 23 15 0.00% 24 22 0.00% 25 16 0.00% 26 30 0.00% 27 33 0.00% 28 40 0.00% 29 35 0.00% 30 51 0.00% 31 67 0.00% 32 86 0.00% 33 88 0.00% 34 88 0.00% 35 131 0.00% 36 127 0.00% 37 171 0.00% 38 202 0.00% 39 217 0.00% 40 260 0.00% 41 309 0.00% 42 359 0.00% 43 394 0.00% 44 428 0.00% 45 517 0.00% 46 578 0.00% 47 633 0.00% 48 745 0.00% 49 794 0.00% 50 874 0.00% 51 960 0.01% 52 1061 0.01% 53 1214 0.01% 54 1359 0.01% 55 1560 0.01% 56 1620 0.01% 57 1738 0.01% 58 1971 0.01% 59 2146 0.01% 60 2380 0.01% 61 2667 0.01% 62 2956 0.02% 63 3344 0.02% 64 3538 0.02% 65 3958 0.02% 66 4339 0.02% 67 4905 0.03% 68 5450 0.03% 69 6068 0.03% 70 8285 0.05% 71 7978 0.04% 72 8511 0.05% 73 9185 0.05% 74 9936 0.05% 75 10558 0.06% 76 11078 0.06% 77 12098 0.07% 78 13088 0.07% 79 13658 0.07% 80 14744 0.08% 81 16099 0.09% 82 17605 0.10% 83 19163 0.11% 84 20724 0.11% 85 22258 0.12% 86 24128 0.13% 87 26593 0.15% 88 29013 0.16% 89 31142 0.17% 90 37308 0.20% 91 43542 0.24% 92 39031 0.21% 93 41229 0.23% 94 45028 0.25% 95 48551 0.27% 96 51509 0.28% 97 56165 0.31% 98 60746 0.33% 99 64645 0.35% 100 70179 0.39% 101 76070 0.42% 102 82302 0.45% 103 90172 0.50% 104 97518 0.54% 105 106020 0.58% 106 115477 0.63% 107 123529 0.68% 108 133660 0.73% 109 145274 0.80% 110 158398 0.87% 111 174649 0.96% 112 193559 1.06% 113 214995 1.18% 114 241718 1.33% 115 268598 1.47% 116 298429 1.64% 117 341625 1.88% 118 399237 2.19% 119 468301 2.57% 120 568177 3.12% 121 710965 3.90% 122 906678 4.98% 123 1272915 6.99% 124 2144683 11.78% 125 5688124 31.23% 126 2245685 12.33% 18211111 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=30 prefix-density=0.72 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCG criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=19.58 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=4.0 sequence=TTCAAAATCTGACAATCTTTTGTTCATAAGATCCTCGTAATTAATTTACATCATCATCGTGGTAGTACAAGTGAAACCAGCTACACACACTTGGTCGCGAGCATAGTCGATTTGCATATACACATGTGCCTCTCATTGACACCTTACTTGCCGGGA criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=8.30 fanout-score-rank=11 prefix-density=1.04 prefix-fanout=4.0 sequence=GAGCTCAAGGTGAAGGAGATCAAGAACGGCCGCCTCGCCATGTTCTCCATGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=120.26 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=AAGAAGCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGT ERR1744563 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:57:34 Started mapping on | Dec 07 00:57:34 Finished on | Dec 07 00:58:50 Mapping speed, Million of reads per hour | 862.63 Number of input reads | 18211111 Average input read length | 240 UNIQUE READS: Uniquely mapped reads number | 17360617 Uniquely mapped reads % | 95.33% Average mapped length | 239.95 Number of splices: Total | 13165834 Number of splices: Annotated (sjdb) | 12246139 Number of splices: GT/AG | 12968836 Number of splices: GC/AG | 151806 Number of splices: AT/AC | 5261 Number of splices: Non-canonical | 39931 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.51 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 361133 % of reads mapped to multiple loci | 1.98% Number of reads mapped to too many loci | 38636 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.62% % of reads unmapped: other | 0.85% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 502429 502429 502429 N_multimapping 361133 361133 361133 N_noFeature 923478 16852895 1058928 N_ambiguous 427340 2352 56191 UnstrandedReadsAssigned:16009799 PositiveStrandReadsAssigned:505370 NegativeStrandReadsAssigned:16245498 Dataset is classified negative stranded MeadianReadLen=123 20thPercentileLength=112 echo kmer=107 ERR1744563 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744563-trimmed-pair1.fastq ERR1744563-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,211,111 reads, 16,304,081 reads pseudoaligned [quant] estimated average fragment length: 180.227 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52973 ERR1744563.ke.tsv 35125 ERR1744563.se.tsv 88098 total ==> ERR1744563.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 756.932 0 0 PNS24247 1044 864.773 60.4446 5.97438 PNS24249 1928 1748.77 96.7576 4.72922 PNS24246 1044 864.773 60.4446 5.97438 PNS24248 1044 864.773 60.4446 5.97438 PNS24244 1471 1291.77 101.909 6.74314 PNS24243 293 121.446 2 1.40761 KQK14069 1603 1423.77 13242.2 794.983 KQK14071 474 296.643 372.54 107.344 ==> ERR1744563.se.tsv <== BRADI_1g14170v3 15876 BRADI_1g53295v3 648 BRADI_1g59795v3 158 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 199 BRADI_1g74790v3 102 BRADI_1g09890v3 0 BRADI_1g77505v3 322 BRADI_1g48960v3 1 ERR1744563 completed mapping pipeline successfully