Starting /dee2/code/volunteer_pipeline.sh ERR1744564 current disk space = 1548140122112 free memory = 1603264232 ERR1744564 SRAfilesize d099dee39ed712bab1fcc3922dc6eca7 ERR1744564.sra ERR1744564.sra file validated ERR1744564 is paired end ERR1744564 is conventional basespace ERR1744564 read1 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744564_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 48 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.86525 30.0 18.0 33.0 18.0 33.0 2 28.44475 31.0 27.0 33.0 18.0 33.0 3 31.43075 33.0 31.0 33.0 29.0 33.0 4 32.205 33.0 33.0 33.0 31.0 33.0 5 32.2355 33.0 33.0 33.0 31.0 34.0 6 36.32225 38.0 36.0 38.0 34.0 38.0 7 37.21875 38.0 38.0 38.0 36.0 38.0 8 37.411 38.0 38.0 38.0 37.0 38.0 9 37.5455 38.0 38.0 38.0 37.0 38.0 10-11 37.53625 38.0 38.0 38.0 38.0 38.0 12-13 37.499750000000006 38.0 38.0 38.0 38.0 38.0 14-15 37.5205 38.0 38.0 38.0 38.0 38.0 16-17 37.48425 38.0 38.0 38.0 37.5 38.0 18-19 37.489374999999995 38.0 38.0 38.0 37.5 38.0 20-21 37.494 38.0 38.0 38.0 37.5 38.0 22-23 37.4565 38.0 38.0 38.0 37.0 38.0 24-25 37.457625 38.0 38.0 38.0 37.0 38.0 26-27 37.406 38.0 38.0 38.0 37.0 38.0 28-29 37.426625 38.0 38.0 38.0 37.0 38.0 30-31 37.376625000000004 38.0 38.0 38.0 37.0 38.0 32-33 37.457375 38.0 38.0 38.0 37.0 38.0 34-35 37.3605 38.0 38.0 38.0 37.0 38.0 36-37 37.311875 38.0 38.0 38.0 37.0 38.0 38-39 37.2785 38.0 38.0 38.0 36.5 38.0 40-41 37.17725 38.0 38.0 38.0 36.0 38.0 42-43 37.24575 38.0 38.0 38.0 37.0 38.0 44-45 37.191874999999996 38.0 38.0 38.0 36.0 38.0 46-47 37.204875 38.0 38.0 38.0 36.5 38.0 48-49 37.140625 38.0 38.0 38.0 36.0 38.0 50-51 37.123374999999996 38.0 38.0 38.0 36.0 38.0 52-53 37.0745 38.0 38.0 38.0 36.0 38.0 54-55 36.953875 38.0 38.0 38.0 35.0 38.0 56-57 36.920874999999995 38.0 38.0 38.0 35.5 38.0 58-59 36.804375 38.0 38.0 38.0 35.0 38.0 60-61 36.784375 38.0 38.0 38.0 35.0 38.0 62-63 36.8375 38.0 38.0 38.0 35.0 38.0 64-65 36.788250000000005 38.0 38.0 38.0 34.5 38.0 66-67 36.673625 38.0 38.0 38.0 34.5 38.0 68-69 36.594125 38.0 38.0 38.0 34.5 38.0 70-71 36.481375 38.0 38.0 38.0 34.0 38.0 72-73 36.541 38.0 38.0 38.0 34.0 38.0 74-75 36.467625 38.0 38.0 38.0 34.0 38.0 76-77 36.410250000000005 38.0 38.0 38.0 34.0 38.0 78-79 36.206 38.0 37.5 38.0 33.0 38.0 80-81 36.015625 38.0 37.0 38.0 32.5 38.0 82-83 35.963375 38.0 37.0 38.0 31.0 38.0 84-85 36.06975 38.0 37.0 38.0 32.5 38.0 86-87 36.105000000000004 38.0 37.0 38.0 33.0 38.0 88-89 35.675124999999994 38.0 37.0 38.0 30.0 38.0 90-91 35.519625000000005 38.0 37.0 38.0 30.0 38.0 92-93 35.260625000000005 38.0 36.5 38.0 29.0 38.0 94-95 35.050625 38.0 36.0 38.0 28.5 38.0 96-97 34.921875 38.0 36.0 38.0 28.0 38.0 98-99 34.873125 38.0 36.0 38.0 27.5 38.0 100-101 34.936499999999995 38.0 36.0 38.0 28.0 38.0 102-103 34.536 38.0 35.0 38.0 26.0 38.0 104-105 34.28475 38.0 34.5 38.0 25.0 38.0 106-107 34.347375 38.0 34.5 38.0 24.5 38.0 108-109 34.227875 38.0 34.0 38.0 24.5 38.0 110-111 33.809375 38.0 33.5 38.0 22.0 38.0 112-113 34.059125 38.0 34.0 38.0 23.5 38.0 114-115 33.626 38.0 33.5 38.0 21.5 38.0 116-117 32.923625 38.0 33.0 38.0 14.0 38.0 118-119 32.8065 38.0 33.0 38.0 17.0 38.0 120-121 32.81525 38.0 33.0 38.0 16.0 38.0 122-123 31.7275 38.0 32.0 38.0 7.0 38.0 124-125 30.459125 38.0 31.5 38.0 2.0 38.0 126 17.3155 20.0 2.0 33.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 1.0 14 0.0 15 1.0 16 2.0 17 2.0 18 4.0 19 5.0 20 7.0 21 13.0 22 10.0 23 9.0 24 4.0 25 14.0 26 18.0 27 27.0 28 37.0 29 38.0 30 57.0 31 73.0 32 109.0 33 166.0 34 295.0 35 450.0 36 1104.0 37 1550.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.528896672504374 13.234926194645984 7.355516637478108 40.88066049537153 2 23.075000000000003 16.400000000000002 39.675 20.849999999999998 3 20.549999999999997 23.3 25.4 30.75 4 25.75 28.449999999999996 22.15 23.65 5 24.575 32.6 23.375 19.45 6 19.0 33.675 23.775 23.549999999999997 7 17.224999999999998 22.25 40.275 20.25 8 18.125 22.400000000000002 30.4 29.075 9 19.55 20.625 32.75 27.075 10-11 24.2 29.725 21.9625 24.1125 12-13 22.875 22.55 26.9625 27.6125 14-15 22.6125 26.125 26.2875 24.975 16-17 23.0625 26.137500000000003 25.837500000000002 24.962500000000002 18-19 23.3875 25.337500000000002 25.412499999999998 25.8625 20-21 22.4375 26.2625 26.337500000000002 24.962500000000002 22-23 22.7 27.1 25.825 24.375 24-25 23.1625 25.924999999999997 24.575 26.337500000000002 26-27 23.075000000000003 26.424999999999997 25.587500000000002 24.9125 28-29 23.5625 26.0375 25.124999999999996 25.275 30-31 22.6375 25.6 26.025 25.7375 32-33 22.3125 26.337500000000002 25.874999999999996 25.474999999999998 34-35 22.5625 26.187500000000004 25.2 26.05 36-37 23.175 25.7875 25.662499999999998 25.374999999999996 38-39 22.1 26.0375 26.4625 25.4 40-41 22.675 26.9625 26.025 24.337500000000002 42-43 22.975 26.200000000000003 25.974999999999998 24.85 44-45 22.45 26.825 26.2125 24.5125 46-47 23.6875 26.387500000000003 25.724999999999998 24.2 48-49 23.175 26.137500000000003 25.324999999999996 25.362499999999997 50-51 22.9375 27.200000000000003 25.174999999999997 24.6875 52-53 23.4125 26.137500000000003 24.825 25.624999999999996 54-55 23.125 25.624999999999996 25.162499999999998 26.087500000000002 56-57 23.3875 26.174999999999997 25.25 25.1875 58-59 23.474999999999998 26.3125 25.35 24.8625 60-61 23.025000000000002 26.3125 25.2375 25.424999999999997 62-63 23.0875 26.025 25.5625 25.324999999999996 64-65 24.2625 26.6125 24.6625 24.462500000000002 66-67 23.0375 26.637499999999996 24.8 25.525 68-69 22.7625 27.0625 25.3125 24.8625 70-71 23.5625 25.837500000000002 25.15 25.45 72-73 23.05 25.4875 25.25 26.2125 74-75 23.200000000000003 25.874999999999996 25.3 25.624999999999996 76-77 23.2125 25.687500000000004 25.85 25.25 78-79 22.900000000000002 24.85 25.887500000000003 26.3625 80-81 22.975 26.174999999999997 25.55 25.3 82-83 24.125 25.5125 24.375 25.9875 84-85 23.5875 25.575 25.624999999999996 25.2125 86-87 23.8375 26.2125 24.325 25.624999999999996 88-89 23.87145179442291 26.447417781668126 24.934350381393024 24.746780042515944 90-91 24.85 24.962500000000002 24.45 25.7375 92-93 23.599999999999998 26.150000000000002 24.25 26.0 94-95 24.275 26.474999999999998 23.9125 25.337500000000002 96-97 23.200000000000003 26.05 24.337500000000002 26.4125 98-99 23.5375 26.5 25.374999999999996 24.587500000000002 100-101 24.337500000000002 26.224999999999998 23.6375 25.8 102-103 24.353044130516317 26.20327540942618 23.97799724965621 25.465683210401302 104-105 23.25 26.200000000000003 25.275 25.275 106-107 24.99687382768538 25.70964111541828 23.658872077028885 25.63461297986745 108-109 23.474999999999998 26.224999999999998 24.4125 25.887500000000003 110-111 24.425 26.275 24.8125 24.4875 112-113 23.73029772329247 26.307230422817113 23.755316487365523 26.207155366524894 114-115 23.939962476547844 26.441525953721072 24.47779862414009 25.14071294559099 116-117 23.371264224084033 27.38526947605352 23.858947105164436 25.38451919469801 118-119 24.718679669917478 26.506626656664167 23.080770192548137 25.693923480870218 120-121 23.4125 26.700000000000003 23.5375 26.35 122-123 23.575 27.0 23.775 25.650000000000002 124-125 23.3375 27.187499999999996 23.4875 25.9875 126 23.974999999999998 25.775 23.925 26.325 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 5.5 28 8.0 29 7.0 30 10.5 31 14.5 32 23.0 33 34.0 34 44.5 35 51.5 36 62.5 37 85.0 38 103.0 39 121.0 40 133.5 41 148.5 42 172.0 43 185.0 44 187.5 45 184.0 46 192.5 47 188.0 48 193.0 49 188.5 50 147.5 51 125.5 52 114.5 53 97.0 54 92.0 55 96.0 56 77.0 57 74.5 58 82.0 59 75.0 60 76.0 61 69.5 62 55.0 63 50.0 64 54.0 65 56.0 66 50.0 67 42.5 68 43.0 69 42.5 70 35.0 71 29.5 72 23.0 73 15.5 74 8.0 75 4.5 76 3.5 77 3.0 78 3.5 79 1.5 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0375 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100-101 0.0 102-103 0.0125 104-105 0.0 106-107 0.0375 108-109 0.0 110-111 0.0 112-113 0.075 114-115 0.0625 116-117 0.0375 118-119 0.025 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49736114601659 98.97500000000001 2 0.4775069112842423 0.95 3 0.025131942699170642 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2375 0.0 0.0 0.0 0.0 66-67 0.35 0.0 0.0 0.0 0.0 68-69 0.475 0.0 0.0 0.0 0.0 70-71 0.55 0.0 0.0 0.0 0.0 72-73 0.6125 0.0 0.0 0.0 0.0 74-75 0.8625 0.0 0.0 0.0 0.0 76-77 1.25 0.0 0.0 0.0 0.0 78-79 1.5 0.0 0.0 0.0 0.0 80-81 1.95 0.0 0.0 0.0 0.0 82-83 2.525 0.0 0.0 0.0 0.0 84-85 3.025 0.0 0.0 0.0 0.0 86-87 3.5125 0.0 0.0 0.0 0.0 88-89 4.0625 0.0 0.0 0.0 0.0 90-91 4.699999999999999 0.0 0.0 0.0 0.0 92-93 5.2625 0.0 0.0 0.0 0.0 94-95 6.0375 0.0 0.0 0.0 0.0 96-97 6.8375 0.0 0.0 0.0 0.0 98-99 7.612500000000001 0.0 0.0 0.0 0.0 100-101 8.475000000000001 0.0 0.0 0.0 0.0 102-103 9.524999999999999 0.0 0.0 0.0 0.0 104-105 10.525 0.0 0.0 0.0 0.0 106-107 11.625 0.0 0.0 0.0 0.0 108-109 12.75 0.0 0.0 0.0 0.0 110-111 13.7375 0.0 0.0 0.0 0.0 112-113 14.8125 0.0 0.0 0.0 0.0 114 15.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE ERR1744564 read2 length is 126 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1744564_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 126 %GC 49 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.88475 33.0 33.0 34.0 32.0 34.0 2 33.05575 34.0 33.0 34.0 32.0 34.0 3 33.04375 34.0 33.0 34.0 33.0 34.0 4 33.03675 34.0 33.0 34.0 33.0 34.0 5 33.13125 34.0 33.0 34.0 33.0 34.0 6 37.10125 38.0 38.0 38.0 37.0 38.0 7 37.105 38.0 38.0 38.0 37.0 38.0 8 36.87725 38.0 38.0 38.0 37.0 38.0 9 37.139 38.0 38.0 38.0 37.0 38.0 10-11 37.1165 38.0 38.0 38.0 37.0 38.0 12-13 37.162875 38.0 38.0 38.0 37.0 38.0 14-15 37.185625 38.0 38.0 38.0 37.0 38.0 16-17 37.12025 38.0 38.0 38.0 37.0 38.0 18-19 37.151875000000004 38.0 38.0 38.0 36.5 38.0 20-21 37.180875 38.0 38.0 38.0 37.0 38.0 22-23 37.13725 38.0 38.0 38.0 37.0 38.0 24-25 37.1515 38.0 38.0 38.0 37.0 38.0 26-27 37.158375 38.0 38.0 38.0 37.0 38.0 28-29 37.013000000000005 38.0 38.0 38.0 37.0 38.0 30-31 37.011625 38.0 38.0 38.0 37.0 38.0 32-33 37.027125 38.0 38.0 38.0 36.5 38.0 34-35 37.004625000000004 38.0 38.0 38.0 36.5 38.0 36-37 36.680375 38.0 38.0 38.0 36.0 38.0 38-39 36.708375000000004 38.0 38.0 38.0 36.0 38.0 40-41 36.7055 38.0 38.0 38.0 36.0 38.0 42-43 36.583 38.0 38.0 38.0 35.5 38.0 44-45 36.567499999999995 38.0 38.0 38.0 35.5 38.0 46-47 36.696124999999995 38.0 38.0 38.0 36.0 38.0 48-49 36.7325 38.0 38.0 38.0 35.5 38.0 50-51 36.522125 38.0 38.0 38.0 35.0 38.0 52-53 36.567875 38.0 38.0 38.0 35.5 38.0 54-55 36.54975 38.0 38.0 38.0 35.0 38.0 56-57 36.711875 38.0 38.0 38.0 35.0 38.0 58-59 36.719625 38.0 38.0 38.0 35.5 38.0 60-61 36.7535 38.0 38.0 38.0 35.0 38.0 62-63 36.704 38.0 38.0 38.0 35.5 38.0 64-65 36.607625 38.0 38.0 38.0 35.0 38.0 66-67 36.627 38.0 38.0 38.0 35.0 38.0 68-69 36.542125 38.0 38.0 38.0 34.5 38.0 70-71 36.400000000000006 38.0 38.0 38.0 34.0 38.0 72-73 36.523625 38.0 38.0 38.0 34.5 38.0 74-75 36.379125 38.0 38.0 38.0 34.0 38.0 76-77 36.39675 38.0 38.0 38.0 34.0 38.0 78-79 36.409625 38.0 38.0 38.0 34.0 38.0 80-81 36.3555 38.0 38.0 38.0 34.0 38.0 82-83 36.09162499999999 38.0 38.0 38.0 33.5 38.0 84-85 36.108375 38.0 38.0 38.0 33.0 38.0 86-87 36.00775 38.0 38.0 38.0 32.0 38.0 88-89 35.982625 38.0 38.0 38.0 32.0 38.0 90-91 36.010999999999996 38.0 38.0 38.0 32.5 38.0 92-93 35.77825 38.0 37.5 38.0 31.5 38.0 94-95 35.675250000000005 38.0 37.5 38.0 31.0 38.0 96-97 35.2175 38.0 37.0 38.0 29.0 38.0 98-99 35.212 38.0 37.0 38.0 29.0 38.0 100-101 35.122 38.0 37.0 38.0 29.0 38.0 102-103 35.060874999999996 38.0 37.0 38.0 28.5 38.0 104-105 34.79875 38.0 36.0 38.0 28.0 38.0 106-107 34.65112499999999 38.0 36.0 38.0 26.5 38.0 108-109 34.339375000000004 38.0 35.5 38.0 25.0 38.0 110-111 34.5015 38.0 36.0 38.0 26.0 38.0 112-113 34.103750000000005 38.0 35.0 38.0 23.5 38.0 114-115 33.831875 38.0 34.0 38.0 21.5 38.0 116-117 33.880624999999995 38.0 35.0 38.0 23.0 38.0 118-119 33.218125 38.0 33.5 38.0 19.0 38.0 120-121 33.293625000000006 38.0 34.0 38.0 19.0 38.0 122-123 32.527125 38.0 33.0 38.0 12.5 38.0 124-125 31.2885 38.0 33.0 38.0 2.0 38.0 126 20.1345 25.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 0.0 4 0.0 5 3.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 2.0 12 3.0 13 2.0 14 0.0 15 4.0 16 5.0 17 5.0 18 9.0 19 3.0 20 10.0 21 13.0 22 17.0 23 12.0 24 16.0 25 20.0 26 14.0 27 33.0 28 30.0 29 35.0 30 57.0 31 69.0 32 91.0 33 121.0 34 191.0 35 302.0 36 714.0 37 2210.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.412474849094565 19.13983903420523 10.588531187122737 34.859154929577464 2 27.35 23.325000000000003 31.6 17.724999999999998 3 20.974999999999998 25.874999999999996 27.35 25.8 4 26.125 32.475 19.525000000000002 21.875 5 27.6 32.925 20.0 19.475 6 21.586345381526105 35.09036144578313 20.632530120481928 22.690763052208833 7 21.10691823899371 16.855345911949684 38.893081761006286 23.144654088050316 8 20.646954763709882 22.340156684356835 25.827647207480414 31.18524134445287 9 22.040713747172656 21.36215129429505 29.47976878612717 27.117366172405127 10-11 25.670594133868136 28.515918776635747 21.910253196289798 23.90323389320632 12-13 26.738369184592298 22.098549274637318 24.337168584292147 26.825912956478238 14-15 24.706176544136035 25.743935983995996 25.406351587896975 24.143535883970994 16-17 27.061178531214814 24.82171900412861 23.845865131990493 24.271237332666082 18-19 25.006251562890725 25.468867216804203 23.818454613653415 25.70642660665166 20-21 25.3125 25.4375 24.775 24.474999999999998 22-23 26.99862379582134 24.75916426873514 24.846740898286 23.395471037157513 24-25 25.35633908477119 24.468617154288573 25.331332833208304 24.843710927731934 26-27 25.447490299161345 24.946801852547253 25.57266241081487 24.03304543747653 28-29 25.549278091650972 25.825486503452606 24.14312617702448 24.48210922787194 30-31 24.27513493159282 25.706037404292708 24.1747207229823 25.84410694113217 32-33 24.937311935807422 26.115847542627886 25.050150451354064 23.89669007021063 34-35 24.915275511484875 25.442450106690096 25.618174971758506 24.024099410066523 36-37 25.31982267257758 24.572514249525014 25.142495250158326 24.965167827739077 38-39 25.925925925925924 25.571988370623185 24.09303501453672 24.40905068891417 40-41 26.057765391436533 25.6650620724601 24.398277172536105 23.878895363567267 42-43 25.88459099556119 24.730500951173113 25.478757133798354 23.906150919467343 44-45 26.08695652173913 24.98415515274433 24.73063759665357 24.198250728862973 46-47 25.564668769716086 24.681388012618296 25.539432176656153 24.214511041009466 48-49 25.471460900176012 24.867990947950716 25.836057329645463 23.82449082222781 50-51 26.26518218623482 25.01265182186235 25.164473684210524 23.557692307692307 52-53 26.581477732793523 25.240384615384613 24.11437246963563 24.063765182186234 54-55 25.878190548395246 25.031589588071775 24.930502906242104 24.15971695729088 56-57 25.398618957940993 24.99686126804771 25.66227244193346 23.94224733207784 58-59 25.70462232243517 24.076161843918324 25.71714894150069 24.50206689214581 60-61 25.087500000000002 25.775 25.3 23.8375 62-63 25.93194896172129 26.53239929947461 23.642732049036777 23.892919689767325 64-65 26.259714214088742 24.968663825520178 24.95612935572825 23.815492604662822 66-67 25.576441102756892 25.0 26.052631578947366 23.370927318295738 68-69 26.068965517241377 25.66771159874608 24.852664576802507 23.41065830721003 70-71 25.897114178168128 23.927227101631114 25.307402760351316 24.868255959849435 72-73 25.453635339757223 25.028156676260792 25.716430984857965 23.801776999124012 74-75 25.219023779724658 25.431789737171464 25.556946182728414 23.792240300375468 76-77 25.69888429234048 24.533032468346498 26.150181772596216 23.617901466716813 78-79 26.61492238357536 24.18627941912869 26.22684026039059 22.97195793690536 80-81 25.819364523392547 24.956217162872154 25.31898924193145 23.90542907180385 82-83 27.660372639739904 25.584594222833562 23.521320495185694 23.23371264224084 84-85 26.39739902463424 25.347005126922596 25.09691134175316 23.158684506690008 86-87 25.525 26.087500000000002 25.1 23.2875 88-89 26.375 26.0375 23.875 23.7125 90-91 26.50994122796049 25.70964111541828 24.92184569213455 22.858571964486682 92-93 25.362499999999997 26.387500000000003 25.15 23.1 94-95 27.400000000000002 24.8125 24.887500000000003 22.900000000000002 96-97 27.316033596590195 25.924533032468343 24.382599974927917 22.37683339601354 98-99 26.9125 25.937500000000004 24.587500000000002 22.5625 100-101 27.275 25.924999999999997 23.225 23.575 102-103 27.070302727045288 25.99449587190393 24.68101075806855 22.254190642982234 104-105 26.456949492417596 26.156159919789445 24.577014663491667 22.80987592430129 106-107 27.53441802252816 25.71964956195244 23.9549436795995 22.7909887359199 108-109 27.73951158422041 26.70006261740764 23.494051346274265 22.066374452097683 110-111 28.4375 25.7625 24.349999999999998 21.45 112-113 28.000000000000004 26.437500000000004 23.4375 22.125 114-115 27.6625 26.700000000000003 24.8125 20.825 116-117 28.262500000000003 26.3125 24.4375 20.9875 118-119 28.353353353353356 26.876876876876878 23.81131131131131 20.95845845845846 120-121 28.1125 26.775 23.925 21.1875 122-123 29.099999999999998 25.924999999999997 23.9 21.075 124-125 28.025 26.0 24.2625 21.712500000000002 126 29.5 23.875 24.375 22.25 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.0 23 1.5 24 1.0 25 2.0 26 3.0 27 4.0 28 9.5 29 12.5 30 12.5 31 16.0 32 19.5 33 25.5 34 32.5 35 42.5 36 65.0 37 73.5 38 73.0 39 85.0 40 111.5 41 133.0 42 147.0 43 179.0 44 190.0 45 185.0 46 174.0 47 178.5 48 176.5 49 151.0 50 156.0 51 159.5 52 138.5 53 119.0 54 104.0 55 93.5 56 89.5 57 87.5 58 85.0 59 74.5 60 74.5 61 77.0 62 75.0 63 73.5 64 66.5 65 63.5 66 58.5 67 50.0 68 44.5 69 42.5 70 37.0 71 31.5 72 29.0 73 21.0 74 13.5 75 8.0 76 3.5 77 3.5 78 4.0 79 2.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.6 2 0.0 3 0.0 4 0.0 5 0.0 6 0.4 7 0.625 8 1.075 9 0.525 10-11 0.27499999999999997 12-13 0.05 14-15 0.025 16-17 0.08750000000000001 18-19 0.025 20-21 0.0 22-23 0.08750000000000001 24-25 0.025 26-27 0.13749999999999998 28-29 0.43750000000000006 30-31 0.41250000000000003 32-33 0.3 34-35 0.41250000000000003 36-37 1.3125 38-39 1.1125 40-41 1.325 42-43 1.4375 44-45 1.3875 46-47 0.9375 48-49 0.575 50-51 1.2 52-53 1.2 54-55 1.075 56-57 0.43750000000000006 58-59 0.21250000000000002 60-61 0.0 62-63 0.075 64-65 0.27499999999999997 66-67 0.25 68-69 0.3125 70-71 0.375 72-73 0.11249999999999999 74-75 0.125 76-77 0.2875 78-79 0.15 80-81 0.075 82-83 0.0375 84-85 0.0375 86-87 0.0 88-89 0.0 90-91 0.0375 92-93 0.0 94-95 0.0 96-97 0.2875 98-99 0.0 100-101 0.0 102-103 0.075 104-105 0.2625 106-107 0.125 108-109 0.1875 110-111 0.0 112-113 0.0 114-115 0.0 116-117 0.0 118-119 0.1 120-121 0.0 122-123 0.0 124-125 0.0 126 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 126 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52213279678068 98.925 2 0.3772635814889336 0.75 3 0.07545271629778671 0.22499999999999998 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.0625 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.0875 0.0 0.0 0.0 0.0 62-63 0.16249999999999998 0.0 0.0 0.0 0.0 64-65 0.2375 0.0 0.0 0.0 0.0 66-67 0.3375 0.0 0.0 0.0 0.0 68-69 0.44999999999999996 0.0 0.0 0.0 0.0 70-71 0.525 0.0 0.0 0.0 0.0 72-73 0.6125 0.0 0.0 0.0 0.0 74-75 0.8625 0.0 0.0 0.0 0.0 76-77 1.25 0.0 0.0 0.0 0.0 78-79 1.525 0.0 0.0 0.0 0.0 80-81 1.975 0.0 0.0 0.0 0.0 82-83 2.5374999999999996 0.0 0.0 0.0 0.0 84-85 3.0625 0.0 0.0 0.0 0.0 86-87 3.5625 0.0 0.0 0.0 0.0 88-89 4.112500000000001 0.0 0.0 0.0 0.0 90-91 4.775 0.0 0.0 0.0 0.0 92-93 5.2875 0.0 0.0 0.0 0.0 94-95 6.1 0.0 0.0 0.0 0.0 96-97 6.9125 0.0 0.0 0.0 0.0 98-99 7.7625 0.0 0.0 0.0 0.0 100-101 8.6375 0.0 0.0 0.0 0.0 102-103 9.675 0.0 0.0 0.0 0.0 104-105 10.65 0.0 0.0 0.0 0.0 106-107 11.75 0.0 0.0 0.0 0.0 108-109 12.8375 0.0 0.0 0.0 0.0 110-111 13.837499999999999 0.0 0.0 0.0 0.0 112-113 14.8625 0.0 0.0 0.0 0.0 114 15.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATCAA 15 0.003905777 60.165607 70-71 >>END_MODULE Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779906 spots for ERR1744564.sra Written 779906 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra Read 779892 spots for ERR1744564.sra Written 779892 spots for ERR1744564.sra SRR ids: ['ERR1744564.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_7xa0o4cb ERR1744564.sra spots: 15597854 blocks: [[1, 779892], [779893, 1559784], [1559785, 2339676], [2339677, 3119568], [3119569, 3899460], [3899461, 4679352], [4679353, 5459244], [5459245, 6239136], [6239137, 7019028], [7019029, 7798920], [7798921, 8578812], [8578813, 9358704], [9358705, 10138596], [10138597, 10918488], [10918489, 11698380], [11698381, 12478272], [12478273, 13258164], [13258165, 14038056], [14038057, 14817948], [14817949, 15597854]] ERR1744564 file size 4502286 ERR1744564 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1744564 ERR1744564_1.fastq ERR1744564_2.fastq Input file: ERR1744564_1.fastq Paired file: ERR1744564_2.fastq trimmed: ERR1744564-trimmed-pair1.fastq, ERR1744564-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 00:57:37 2024 >> started Sat Dec 7 00:57:53 2024 >> done (15.931s) 15597854 read pairs processed; of these: 17262 ( 0.11%) short read pairs filtered out after trimming by size control 18276 ( 0.12%) empty read pairs filtered out after trimming by size control 15562316 (99.77%) read pairs available; of these: 10294671 (66.15%) trimmed read pairs available after processing 5267645 (33.85%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 127 0.00% 19 129 0.00% 20 99 0.00% 21 97 0.00% 22 97 0.00% 23 90 0.00% 24 99 0.00% 25 90 0.00% 26 63 0.00% 27 66 0.00% 28 92 0.00% 29 93 0.00% 30 93 0.00% 31 110 0.00% 32 146 0.00% 33 149 0.00% 34 137 0.00% 35 141 0.00% 36 142 0.00% 37 202 0.00% 38 206 0.00% 39 242 0.00% 40 324 0.00% 41 365 0.00% 42 403 0.00% 43 497 0.00% 44 483 0.00% 45 588 0.00% 46 633 0.00% 47 812 0.01% 48 924 0.01% 49 988 0.01% 50 1211 0.01% 51 1324 0.01% 52 1642 0.01% 53 1903 0.01% 54 2058 0.01% 55 2308 0.01% 56 2611 0.02% 57 2961 0.02% 58 3333 0.02% 59 3833 0.02% 60 4324 0.03% 61 5104 0.03% 62 5638 0.04% 63 6690 0.04% 64 7289 0.05% 65 8148 0.05% 66 9282 0.06% 67 10114 0.06% 68 11194 0.07% 69 12672 0.08% 70 14249 0.09% 71 16178 0.10% 72 18322 0.12% 73 21057 0.14% 74 22940 0.15% 75 25784 0.17% 76 30200 0.19% 77 31828 0.20% 78 31924 0.21% 79 34145 0.22% 80 36384 0.23% 81 38716 0.25% 82 41809 0.27% 83 44331 0.28% 84 47466 0.31% 85 50890 0.33% 86 52907 0.34% 87 55395 0.36% 88 58340 0.37% 89 60025 0.39% 90 62480 0.40% 91 63751 0.41% 92 66082 0.42% 93 69003 0.44% 94 72173 0.46% 95 74257 0.48% 96 75813 0.49% 97 79542 0.51% 98 80467 0.52% 99 81638 0.52% 100 84272 0.54% 101 85228 0.55% 102 87516 0.56% 103 89679 0.58% 104 91526 0.59% 105 93673 0.60% 106 98471 0.63% 107 99917 0.64% 108 102471 0.66% 109 105506 0.68% 110 106566 0.68% 111 109256 0.70% 112 112549 0.72% 113 115473 0.74% 114 119877 0.77% 115 125824 0.81% 116 132291 0.85% 117 140621 0.90% 118 151332 0.97% 119 167255 1.07% 120 188730 1.21% 121 223131 1.43% 122 287505 1.85% 123 428669 2.75% 124 841381 5.41% 125 4535490 29.14% 126 5267645 33.85% 15562316 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.10 fanout-score-rank=13 prefix-density=0.63 prefix-fanout=2.1 sequence=CCGAACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTTCACCTTGAGCTCAGCGAACGC criterion=fanout-score sequence-density=0.14 sequence-density-rank=13 fanout-score=17.84 fanout-score-rank=1 prefix-density=0.31 prefix-fanout=7.9 sequence=CCTTGATCTTCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=5.48 fanout-score-rank=11 prefix-density=0.58 prefix-fanout=3.9 sequence=AAGGAGCTGGAGGAGGTGAAGAAGGAGTACCCTGACGCCTATGTCCGCATCATCGGCTTCGACAACACCAGGCAAGTGCAGTGCATCAGCTTCATCGCCTTCAAGCCACCGGGTTGTGAGGAGTCCGGCAAGGCCTAAGCAAGTTGATTTCTTATAATACAAGAACGGGTCACACCGATTTTATTTACCTTTTTCACACGTTTGTTTCATGTTGTATTTATGCATGTGATCTCTCCCAACAACCCGGATTAACTGTATTCATGAGTACTACTATTATAAGAGTACTACAACTATCGTTGGGAGAGGGGCATGTAATATAAACTCCGGTTATACATATTAAGATAAGTATATTTTGTAAAAGAATATCAAATTCGTCGACAAATTCTGATTATGAT criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=96.11 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=16.9 sequence=GCCGCCGCCGCC ERR1744564 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 00:58:37 Started mapping on | Dec 07 00:58:37 Finished on | Dec 07 00:59:46 Mapping speed, Million of reads per hour | 811.95 Number of input reads | 15562316 Average input read length | 238 UNIQUE READS: Uniquely mapped reads number | 14933648 Uniquely mapped reads % | 95.96% Average mapped length | 237.73 Number of splices: Total | 10689461 Number of splices: Annotated (sjdb) | 9884941 Number of splices: GT/AG | 10518507 Number of splices: GC/AG | 128354 Number of splices: AT/AC | 4102 Number of splices: Non-canonical | 38498 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228785 % of reads mapped to multiple loci | 1.47% Number of reads mapped to too many loci | 26689 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411517 411517 411517 N_multimapping 228785 228785 228785 N_noFeature 902391 14389962 1093775 N_ambiguous 403889 2245 53567 UnstrandedReadsAssigned:13627368 PositiveStrandReadsAssigned:541441 NegativeStrandReadsAssigned:13786306 Dataset is classified negative stranded MeadianReadLen=125 20thPercentileLength=114 echo kmer=109 ERR1744564 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: ERR1744564-trimmed-pair1.fastq ERR1744564-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,562,316 reads, 13,843,575 reads pseudoaligned [quant] estimated average fragment length: 198.987 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,140 rounds 52973 ERR1744564.ke.tsv 35125 ERR1744564.se.tsv 88098 total ==> ERR1744564.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 738.333 0 0 PNS24247 1044 846.013 40.5633 4.95377 PNS24249 1928 1730.01 30.6903 1.83287 PNS24246 1044 846.013 40.5633 4.95377 PNS24248 1044 846.013 40.5633 4.95377 PNS24244 1471 1273.01 98.62 8.0041 PNS24243 293 131.014 0 0 KQK14069 1603 1405.01 10619.3 780.899 KQK14071 474 286.387 304.479 109.846 ==> ERR1744564.se.tsv <== BRADI_1g14170v3 14053 BRADI_1g53295v3 607 BRADI_1g59795v3 146 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 235 BRADI_1g74790v3 106 BRADI_1g09890v3 0 BRADI_1g77505v3 284 BRADI_1g48960v3 0 ERR1744564 completed mapping pipeline successfully