Starting /dee2/code/volunteer_pipeline.sh ERR1806551 current disk space = 1523210649600 free memory = 1605454584 ERR1806551 SRAfilesize d59cc13da6e91b9c0f731794b62074e7 ERR1806551.sra ERR1806551.sra file validated ERR1806551 is single end ERR1806551 is conventional basespace ERR1806551 read1 length is 8-254 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806551_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-254 %GC 50 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.107 24.0 21.0 26.0 17.0 28.0 2 23.0885 24.0 20.0 27.0 16.0 28.0 3 22.939 24.0 20.0 27.0 16.0 28.0 4 23.1565 24.0 20.0 27.0 16.0 28.0 5 22.97875 24.0 20.0 26.0 16.0 28.0 6 22.99225 24.0 20.0 26.0 16.0 28.0 7 22.75175 24.0 20.0 26.0 16.0 28.0 8 22.842 24.0 20.0 26.0 16.0 27.0 9 22.86315789473684 24.0 20.0 26.0 16.0 28.0 10-14 22.86284251016096 24.0 20.0 26.0 16.0 28.0 15-19 22.955098393640334 24.0 20.0 26.0 16.0 27.2 20-24 23.25045219109095 24.8 20.8 26.0 16.6 28.0 25-29 23.412277688954187 25.0 21.0 26.0 17.2 28.0 30-34 23.318956748406208 24.8 21.0 26.0 17.0 28.0 35-39 23.29964555681756 25.0 21.0 26.0 17.0 27.6 40-44 23.255308238341197 24.8 21.0 26.0 17.0 27.8 45-49 23.18710717483878 24.8 20.6 26.0 16.6 27.4 50-54 23.289870192234144 25.0 20.8 26.0 17.0 27.8 55-59 23.296335086451688 24.6 20.8 26.0 17.0 27.8 60-64 23.375829710790697 25.0 21.0 26.0 17.0 28.0 65-69 23.39029555835045 25.0 21.0 26.0 17.4 28.0 70-74 23.286693067916644 24.8 20.8 26.0 17.0 27.4 75-79 23.234314337990423 24.6 20.8 26.0 17.0 27.0 80-84 23.190833348437316 24.6 20.4 26.0 17.0 27.0 85-89 23.26350702770936 24.6 21.0 26.0 17.2 27.0 90-94 23.149417873777054 24.2 20.6 26.0 17.0 27.0 95-99 23.151772598580322 24.4 20.2 26.0 16.8 27.4 100-104 23.183574821674927 24.6 20.4 26.0 17.0 27.0 105-109 23.03219529139165 24.0 20.4 26.0 17.0 27.0 110-114 22.925315757620748 24.0 20.0 26.0 16.8 27.0 115-119 22.88245673185511 24.0 20.2 26.0 16.8 27.0 120-124 22.91196675260613 24.0 20.0 26.0 16.6 27.0 125-129 22.744007345104713 24.0 20.0 26.0 16.2 27.0 130-134 22.519600191488728 23.6 20.0 26.0 16.0 27.0 135-139 22.38472433290275 23.2 20.0 26.0 16.0 27.0 140-144 22.31357732544887 23.0 20.0 26.0 16.0 27.0 145-149 22.152864358528422 23.0 20.0 26.0 15.8 27.0 150-154 22.05630180800315 23.0 19.4 25.4 15.6 27.0 155-159 21.981147160349256 23.0 19.2 25.2 15.8 27.0 160-164 21.59405974692521 22.0 19.0 25.0 15.4 26.0 165-169 21.17666228628837 22.0 18.6 25.0 14.4 26.0 170-174 21.165654560145423 22.0 19.0 24.8 14.0 26.0 175-179 20.736235621725832 21.6 18.2 24.2 13.8 26.0 180-184 20.37960126338757 21.0 17.6 24.0 13.2 26.0 185-189 20.481156014610264 21.0 17.6 24.0 13.8 25.8 190-194 20.23939806834982 20.8 17.4 24.0 13.4 25.8 195-199 20.16935743273085 20.8 17.4 23.8 13.0 25.0 200-204 19.56546189442741 20.2 16.2 23.0 12.8 24.6 205-209 19.452934166021702 20.0 16.4 23.0 13.0 24.0 210-214 19.12882912392483 NaN NaN NaN NaN NaN 215-219 18.841178303832017 NaN NaN NaN NaN NaN 220-224 18.445199293064043 NaN NaN NaN NaN NaN 225-229 18.23332902528002 NaN NaN NaN NaN NaN 230-234 18.64387012987013 NaN NaN NaN NaN NaN 235-239 18.516998378298688 NaN NaN NaN NaN NaN 240-244 17.921666666666667 NaN NaN NaN NaN NaN 245-249 17.524761904761906 NaN NaN NaN NaN NaN 250-254 14.4 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 5.0 12 3.0 13 7.0 14 16.0 15 37.0 16 53.0 17 85.0 18 145.0 19 197.0 20 263.0 21 347.0 22 483.0 23 694.0 24 924.0 25 637.0 26 97.0 27 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.549999999999997 42.725 19.1 14.625 2 43.475 34.325 5.8500000000000005 16.35 3 31.7 31.825 19.625 16.85 4 37.4 27.1 16.45 19.05 5 28.449999999999996 27.150000000000002 18.625 25.775 6 26.650000000000002 28.075 20.3 24.975 7 22.525000000000002 30.8 25.775 20.9 8 25.3 26.55 24.0 24.15 9 25.36340852130326 23.408521303258144 25.764411027568922 25.46365914786967 10-14 26.32988128315231 24.72846678454155 25.19323061379136 23.748421318514776 15-19 27.584620104305145 24.598629716739953 24.184476940382453 23.632273238572452 20-24 28.008052444123265 24.528983637020595 23.682444639446654 23.780519279409486 25-29 26.455854727614277 25.020872469213106 24.06595700271342 24.457315800459195 30-34 27.441664027029883 24.374406081723155 23.93094710167881 24.252982789568158 35-39 26.45785450852531 24.849003153562457 24.314501042279115 24.37864129563312 40-44 26.250339397230523 24.615802335052948 24.501764865598695 24.63209340211784 45-49 26.370108725647114 24.52673988630719 25.139356476626745 23.963794911418955 50-54 26.427809288482056 24.338743190879992 24.41736395799405 24.816083562643904 55-59 25.62712646329508 25.061991811314225 24.981258289602675 24.329623435788015 60-64 27.003247711839386 24.050782403306762 24.777088869205787 24.168881015648065 65-69 26.967253176930594 24.18743890518084 24.82282502443793 24.022482893450636 70-74 26.030163437874677 24.427336404366756 25.02050861361772 24.521991544140846 75-79 26.66184496022092 24.774804392136236 24.37372608324019 24.189624564402656 80-84 26.725675861122543 24.578015644298066 24.591738712776177 24.10456978180321 85-89 26.33475034224368 24.230852366885223 24.785647380935224 24.648749909935873 90-94 26.51618787049704 24.289405684754524 24.996200030399756 24.198206414348686 95-99 25.548324897565678 24.40748774805174 25.77327870169519 24.270908652687396 100-104 26.61772238347277 24.62864947925559 25.166467474816457 23.58716066245518 105-109 25.965940303973632 24.336202160776416 25.28840871635232 24.409448818897637 110-114 26.124175932303455 23.831545803404506 24.9139033749877 25.130374889304342 115-119 26.289587967376338 24.48893125728207 24.340641881156657 24.880838894184937 120-124 26.405587999541968 24.596358639642734 24.53910454597504 24.458948814840262 125-129 25.516464254413425 24.915487667459622 25.87955427569801 23.688493802428948 130-134 25.370472008781558 24.464873765093305 25.590010976948406 24.574643249176727 135-139 25.101032779524026 24.69690166142793 24.966322406825327 25.235743152222724 140-144 26.938304190036295 23.622566809633785 25.057736720554274 24.381392279775653 145-149 26.189164370982553 24.536271808999082 24.462809917355372 24.811753902662996 150-154 25.036390101892287 24.079850280723644 26.11769598669162 24.76606363069245 155-159 25.422116527942922 25.517241379310345 24.328180737217597 24.732461355529132 160-164 24.870466321243523 24.843196073084265 25.497682028906464 24.78865557676575 165-169 24.913276568905708 25.386313465783665 25.82781456953642 23.872595395774205 170-174 25.07363770250368 24.153166421207658 26.141384388807072 24.631811487481592 175-179 25.37313432835821 25.37313432835821 23.96588486140725 25.28784648187633 180-184 24.574083634486318 26.690758905524003 23.180175529168817 25.55498193082086 185-189 26.7632241813602 24.87405541561713 24.370277078085643 23.992443324937028 190-194 24.560061208875286 24.33052792654935 24.636572302983932 26.472838561591434 195-199 22.45885769603098 24.975798644724104 25.653436592449175 26.91190706679574 200-204 21.025641025641026 27.05128205128205 25.128205128205128 26.794871794871796 205-209 23.898305084745765 26.779661016949152 24.40677966101695 24.91525423728814 210-214 25.272331154684096 25.925925925925924 22.004357298474943 26.797385620915033 215-219 28.65671641791045 25.671641791044774 22.08955223880597 23.582089552238806 220-224 22.857142857142858 23.26530612244898 22.857142857142858 31.020408163265305 225-229 22.727272727272727 26.136363636363637 26.136363636363637 25.0 230-234 35.77235772357724 25.203252032520325 16.260162601626014 22.76422764227642 235-239 31.818181818181817 28.40909090909091 17.045454545454543 22.727272727272727 240-244 10.416666666666668 27.083333333333332 31.25 31.25 245-249 13.043478260869565 34.78260869565217 34.78260869565217 17.391304347826086 250-254 25.0 50.0 0.0 25.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 2.0 7 2.0 8 2.0 9 2.0 10 2.0 11 2.0 12 2.0 13 2.5 14 3.0 15 2.5 16 2.0 17 2.0 18 3.0 19 4.5 20 5.0 21 6.0 22 7.0 23 7.0 24 7.0 25 8.0 26 9.5 27 13.0 28 17.0 29 16.5 30 14.0 31 18.5 32 26.0 33 29.5 34 36.0 35 41.50000000000001 36 53.50000000000001 37 68.16666666666666 38 78.66666666666667 39 97.16666666666667 40 126.99999999999999 41 153.16666666666669 42 170.50000000000003 43 180.8333333333334 44 185.16666666666674 45 197.83333333333337 46 214.00000000000006 47 246.3333333333334 48 255.6666666666667 49 227.66666666666677 50 216.00000000000003 51 220.1666666666667 52 213.66666666666669 53 212.49999999999997 54 218.50000000000003 55 206.50000000000003 56 181.16666666666669 57 159.00000000000003 58 153.83333333333337 59 158.16666666666666 60 151.16666666666669 61 137.83333333333331 62 117.99999999999999 63 112.83333333333333 64 97.5 65 80.0 66 83.0 67 78.5 68 65.5 69 57.0 70 47.5 71 39.5 72 33.0 73 24.0 74 19.0 75 14.5 76 12.0 77 12.0 78 12.0 79 9.0 80 4.5 81 3.0 82 3.0 83 3.0 84 3.0 85 1.5 86 0.0 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240-244 0.0 245-249 0.0 250-254 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 15.0 10-14 61.0 15-19 36.0 20-24 38.0 25-29 43.0 30-34 44.0 35-39 62.0 40-44 52.0 45-49 64.0 50-54 80.0 55-59 82.0 60-64 107.0 65-69 91.0 70-74 132.0 75-79 127.0 80-84 131.0 85-89 148.0 90-94 142.0 95-99 133.0 100-104 171.0 105-109 144.0 110-114 158.0 115-119 129.0 120-124 153.0 125-129 141.0 130-134 132.0 135-139 122.0 140-144 125.0 145-149 120.0 150-154 134.0 155-159 110.0 160-164 98.0 165-169 103.0 170-174 72.0 175-179 81.0 180-184 77.0 185-189 62.0 190-194 46.0 195-199 60.0 200-204 40.0 205-209 35.0 210-214 22.0 215-219 21.0 220-224 16.0 225-229 12.0 230-234 7.0 235-239 9.0 240-244 5.0 245-249 5.0 250-254 2.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.08629441624366 97.6 2 0.7106598984771574 1.4000000000000001 3 0.07614213197969542 0.22499999999999998 4 0.050761421319796954 0.2 5 0.050761421319796954 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025380710659898477 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGATAATCATACCCCGTTCGAGGAGAGCAAGGCGATCGACATCAACCCGG 13 0.325 No Hit ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 5 0.125 No Hit GAGACGCTGTCGATGCCGCTGCTGGTTAGCGGCAGCAACAACGACGTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-229 0.0 0.0 0.0 0.0 0.0 230-234 0.0 0.0 0.0 0.0 0.0 235-239 0.0 0.0 0.0 0.0 0.0 240-242 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTGA 10 0.0 4226.5 215-218 TATCTTC 10 9.171876E-4 2113.25 200-204 AATGACA 10 9.171876E-4 2113.25 210-214 ATCTGAC 15 0.002063672 1408.8334 215-218 ATCTTCT 10 0.0055013895 1056.625 200-204 CTGCAAT 10 0.0055013895 1056.625 205-209 GTGCTGC 10 0.0055013895 1056.625 190-194 TCTGACT 15 0.006189551 939.22217 215-218 GTACCCA 10 0.009167536 845.30005 180-184 CGTCTGT 10 0.009167536 845.30005 185-189 TAGCTGC 15 0.006121281 148.29825 145-149 >>END_MODULE Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311869 spots for ERR1806551.sra Written 311869 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra Read 311854 spots for ERR1806551.sra Written 311854 spots for ERR1806551.sra SRR ids: ['ERR1806551.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_433670ss ERR1806551.sra spots: 6237095 blocks: [[1, 311854], [311855, 623708], [623709, 935562], [935563, 1247416], [1247417, 1559270], [1559271, 1871124], [1871125, 2182978], [2182979, 2494832], [2494833, 2806686], [2806687, 3118540], [3118541, 3430394], [3430395, 3742248], [3742249, 4054102], [4054103, 4365956], [4365957, 4677810], [4677811, 4989664], [4989665, 5301518], [5301519, 5613372], [5613373, 5925226], [5925227, 6237095]] ERR1806551 file size 1635467 ERR1806551 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806551 ERR1806551_1.fastq Input file: ERR1806551_1.fastq trimmed: ERR1806551-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:05:47 2024 >> started Mon Dec 9 16:06:20 2024 >> done (32.845s) 6237095 reads processed; of these: 188580 ( 3.02%) short reads filtered out after trimming by size control 17 ( 0.00%) empty reads filtered out after trimming by size control 6048498 (96.98%) reads available; of these: 125939 ( 2.08%) trimmed reads available after processing 5922559 (97.92%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14732 0.24% 19 14407 0.24% 20 13763 0.23% 21 13795 0.23% 22 13310 0.22% 23 13469 0.22% 24 15042 0.25% 25 13464 0.22% 26 13433 0.22% 27 13974 0.23% 28 13883 0.23% 29 13865 0.23% 30 14743 0.24% 31 14465 0.24% 32 14786 0.24% 33 15435 0.26% 34 15555 0.26% 35 15666 0.26% 36 16278 0.27% 37 16012 0.26% 38 16199 0.27% 39 17605 0.29% 40 17176 0.28% 41 17433 0.29% 42 19319 0.32% 43 18385 0.30% 44 18935 0.31% 45 20120 0.33% 46 19926 0.33% 47 20187 0.33% 48 21436 0.35% 49 21504 0.36% 50 21790 0.36% 51 23159 0.38% 52 23680 0.39% 53 23192 0.38% 54 24881 0.41% 55 25182 0.42% 56 25467 0.42% 57 27186 0.45% 58 26866 0.44% 59 27923 0.46% 60 29569 0.49% 61 29729 0.49% 62 29694 0.49% 63 32478 0.54% 64 31310 0.52% 65 31442 0.52% 66 32246 0.53% 67 32654 0.54% 68 33213 0.55% 69 34748 0.57% 70 35340 0.58% 71 35135 0.58% 72 36988 0.61% 73 36143 0.60% 74 37231 0.62% 75 38531 0.64% 76 38419 0.64% 77 40996 0.68% 78 41943 0.69% 79 40300 0.67% 80 40396 0.67% 81 41218 0.68% 82 44053 0.73% 83 43086 0.71% 84 43261 0.72% 85 42905 0.71% 86 42273 0.70% 87 43555 0.72% 88 43900 0.73% 89 44312 0.73% 90 45829 0.76% 91 44340 0.73% 92 44587 0.74% 93 46830 0.77% 94 45335 0.75% 95 44624 0.74% 96 46211 0.76% 97 45329 0.75% 98 45719 0.76% 99 46518 0.77% 100 46806 0.77% 101 46566 0.77% 102 47091 0.78% 103 53545 0.89% 104 46248 0.76% 105 47106 0.78% 106 45233 0.75% 107 45854 0.76% 108 46361 0.77% 109 48353 0.80% 110 46188 0.76% 111 46240 0.76% 112 48488 0.80% 113 45317 0.75% 114 46894 0.78% 115 45766 0.76% 116 45029 0.74% 117 45326 0.75% 118 44527 0.74% 119 44315 0.73% 120 44945 0.74% 121 44537 0.74% 122 43229 0.71% 123 43329 0.72% 124 43158 0.71% 125 42494 0.70% 126 43155 0.71% 127 42573 0.70% 128 41837 0.69% 129 42476 0.70% 130 42185 0.70% 131 41039 0.68% 132 41838 0.69% 133 41167 0.68% 134 41684 0.69% 135 40682 0.67% 136 39538 0.65% 137 39451 0.65% 138 40418 0.67% 139 39602 0.65% 140 40720 0.67% 141 38518 0.64% 142 37362 0.62% 143 36934 0.61% 144 37160 0.61% 145 37024 0.61% 146 36133 0.60% 147 36647 0.61% 148 36004 0.60% 149 35282 0.58% 150 35914 0.59% 151 35312 0.58% 152 34614 0.57% 153 34640 0.57% 154 34310 0.57% 155 34878 0.58% 156 33287 0.55% 157 33218 0.55% 158 31782 0.53% 159 32108 0.53% 160 31435 0.52% 161 31007 0.51% 162 31363 0.52% 163 30857 0.51% 164 30140 0.50% 165 29585 0.49% 166 29052 0.48% 167 28577 0.47% 168 28398 0.47% 169 27777 0.46% 170 27315 0.45% 171 27079 0.45% 172 26769 0.44% 173 25918 0.43% 174 25471 0.42% 175 24924 0.41% 176 24517 0.41% 177 24030 0.40% 178 23527 0.39% 179 23123 0.38% 180 23009 0.38% 181 22387 0.37% 182 21895 0.36% 183 21587 0.36% 184 20975 0.35% 185 20537 0.34% 186 20205 0.33% 187 19712 0.33% 188 18994 0.31% 189 18748 0.31% 190 18101 0.30% 191 17609 0.29% 192 17379 0.29% 193 16665 0.28% 194 16373 0.27% 195 16038 0.27% 196 15400 0.25% 197 15027 0.25% 198 14434 0.24% 199 14325 0.24% 200 13734 0.23% 201 13493 0.22% 202 12972 0.21% 203 12717 0.21% 204 12217 0.20% 205 11877 0.20% 206 11215 0.19% 207 10979 0.18% 208 10489 0.17% 209 10247 0.17% 210 9704 0.16% 211 9142 0.15% 212 9097 0.15% 213 8504 0.14% 214 8184 0.14% 215 7966 0.13% 216 7415 0.12% 217 7147 0.12% 218 6928 0.11% 219 6526 0.11% 220 6284 0.10% 221 5992 0.10% 222 5683 0.09% 223 5167 0.09% 224 5031 0.08% 225 4837 0.08% 226 4468 0.07% 227 4219 0.07% 228 4004 0.07% 229 3756 0.06% 230 3656 0.06% 231 3352 0.06% 232 3111 0.05% 233 2872 0.05% 234 2746 0.05% 235 2469 0.04% 236 2338 0.04% 237 2142 0.04% 238 1995 0.03% 239 1847 0.03% 240 1736 0.03% 241 1605 0.03% 242 1445 0.02% 243 1338 0.02% 244 1217 0.02% 245 1179 0.02% 246 1023 0.02% 247 935 0.02% 248 861 0.01% 249 733 0.01% 250 773 0.01% 251 636 0.01% 252 559 0.01% 253 574 0.01% 254 506 0.01% 255 433 0.01% 256 430 0.01% 257 334 0.01% 258 337 0.01% 259 298 0.00% 260 296 0.00% 261 248 0.00% 262 232 0.00% 263 205 0.00% 264 157 0.00% 265 136 0.00% 266 137 0.00% 267 115 0.00% 268 116 0.00% 269 81 0.00% 270 98 0.00% 271 79 0.00% 272 58 0.00% 273 50 0.00% 274 44 0.00% 275 49 0.00% 276 33 0.00% 277 28 0.00% 278 20 0.00% 279 29 0.00% 280 14 0.00% 281 15 0.00% 282 6 0.00% 283 6 0.00% 284 9 0.00% 285 5 0.00% 286 1 0.00% 287 4 0.00% 288 1 0.00% 289 0 0.00% 290 5 0.00% 291 2 0.00% 292 4 0.00% 293 2 0.00% 294 1 0.00% 295 1 0.00% 296 0 0.00% 297 1 0.00% 298 2 0.00% 299 1 0.00% 300 0 0.00% 301 0 0.00% 302 1 0.00% 303 0 0.00% 304 0 0.00% 305 1 0.00% 306 0 0.00% 307 0 0.00% 308 1 0.00% 309 0 0.00% 310 1 0.00% 311 1 0.00% 312 1 0.00% 313 2 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 0 0.00% 334 0 0.00% 335 0 0.00% 336 0 0.00% 337 0 0.00% 338 0 0.00% 339 0 0.00% 340 1 0.00% 341 0 0.00% 342 0 0.00% 343 0 0.00% 344 0 0.00% 345 0 0.00% 346 0 0.00% 347 0 0.00% 348 0 0.00% 349 1 0.00% 350 2 0.00% 351 0 0.00% 352 2 0.00% 6048498 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.50 fanout-score-rank=27 prefix-density=0.32 prefix-fanout=3.3 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=131.25 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=15.2 sequence=AGAAGAAGGACCCAACCGGCGCCAAGGTCACCAAGCGGCTGCCAAGA Started job on | Dec 09 16:10:07 Started mapping on | Dec 09 16:10:07 Finished on | Dec 09 16:10:25 Mapping speed, Million of reads per hour | 1209.70 Number of input reads | 6048498 Average input read length | 116 UNIQUE READS: Uniquely mapped reads number | 4330264 Uniquely mapped reads % | 71.59% Average mapped length | 103.24 Number of splices: Total | 1452529 Number of splices: Annotated (sjdb) | 1362705 Number of splices: GT/AG | 1419016 Number of splices: GC/AG | 15402 Number of splices: AT/AC | 1132 Number of splices: Non-canonical | 16979 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.18% Deletion average length | 1.10 Insertion rate per base | 0.14% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 143926 % of reads mapped to multiple loci | 2.38% Number of reads mapped to too many loci | 72976 % of reads mapped to too many loci | 1.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 24.42% % of reads unmapped: other | 0.40% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1574308 1574308 1574308 N_multimapping 143926 143926 143926 N_noFeature 131016 166385 4228361 N_ambiguous 77288 11067 422 UnstrandedReadsAssigned:4121960 PositiveStrandReadsAssigned:4152812 NegativeStrandReadsAssigned:101481 Dataset is classified positive stranded MeadianReadLen=113 20thPercentileLength=73 echo kmer=69 ERR1806551 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806551-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,048,498 reads, 4,517,675 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,044 rounds 52973 ERR1806551.ke.tsv 35125 ERR1806551.se.tsv 88098 total ==> ERR1806551.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 57.3289 22.5708 PNS24247 1044 945 12.798 4.46281 PNS24249 1928 1829 17.2499 3.10794 PNS24246 1044 945 12.798 4.46281 PNS24248 1044 945 12.798 4.46281 PNS24244 1471 1372 75.0272 18.0203 PNS24243 293 194 0 0 KQK14069 1603 1504 716.549 156.999 KQK14071 474 375 35.0007 30.7569 ==> ERR1806551.se.tsv <== BRADI_1g14170v3 737 BRADI_1g53295v3 45 BRADI_1g59795v3 76 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 456 BRADI_1g74790v3 83 BRADI_1g09890v3 0 BRADI_1g77505v3 106 BRADI_1g48960v3 0 ERR1806551 completed mapping pipeline successfully