Starting /dee2/code/volunteer_pipeline.sh ERR1806552 current disk space = 1523154210816 free memory = 1580382052 ERR1806552 SRAfilesize 3a2297792a126ed799c650c3f6e3ff81 ERR1806552.sra ERR1806552.sra file validated ERR1806552 is single end ERR1806552 is conventional basespace ERR1806552 read1 length is 8-243 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806552_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-243 %GC 49 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.90825 25.0 21.0 27.0 19.0 28.0 2 23.83725 25.0 21.0 27.0 18.0 28.0 3 23.707 25.0 21.0 27.0 17.0 28.0 4 23.798 25.0 21.0 27.0 17.0 28.0 5 23.67275 25.0 21.0 27.0 16.0 29.0 6 23.638 25.0 21.0 27.0 17.0 28.0 7 23.61225 25.0 21.0 27.0 17.0 28.0 8 23.5425 25.0 21.0 27.0 16.0 28.0 9 23.54725495111557 25.0 21.0 27.0 17.0 28.0 10-14 23.54483513252 25.0 21.0 27.0 16.4 28.0 15-19 23.815072144745706 25.0 21.0 27.0 17.4 28.0 20-24 23.983251391447187 25.8 21.0 27.0 18.0 28.0 25-29 24.057077704562168 25.6 21.4 27.0 18.0 28.0 30-34 23.965823673381266 25.2 21.0 27.0 18.0 28.0 35-39 23.952646307451623 25.2 21.0 27.0 18.0 28.0 40-44 23.976204661263292 25.0 21.2 27.0 18.0 28.0 45-49 23.91677439636246 25.0 21.0 27.0 18.0 28.0 50-54 23.955416065941872 25.0 21.2 27.0 18.0 28.0 55-59 23.99961500543995 25.0 21.0 27.0 18.0 28.0 60-64 23.943357076857108 25.0 21.2 27.0 18.2 28.0 65-69 23.848624132612088 25.0 21.0 27.0 18.2 28.0 70-74 23.859214773042456 25.0 21.0 27.0 18.0 28.0 75-79 23.760443649426385 25.0 21.0 27.0 18.0 28.0 80-84 23.831145579682623 25.0 21.2 27.0 18.0 28.0 85-89 23.7237506709864 25.0 21.0 27.0 18.0 28.0 90-94 23.734946822644226 25.0 21.2 26.6 18.0 27.8 95-99 23.80812941405925 25.0 21.2 27.0 18.0 28.0 100-104 23.600587764581658 25.0 21.0 26.4 18.0 27.6 105-109 23.56797686289739 25.0 21.0 26.2 18.0 27.6 110-114 23.52732545557643 25.0 21.0 26.0 17.6 27.4 115-119 23.533229966658457 25.0 21.0 26.0 17.8 27.6 120-124 23.389568689702898 24.6 21.0 26.0 17.8 27.0 125-129 23.350241531427532 25.0 20.8 26.0 17.2 27.0 130-134 23.194367008441777 24.8 20.6 26.0 16.6 27.0 135-139 23.038676916776407 24.2 20.6 26.0 16.4 27.2 140-144 22.615190078262355 24.0 19.8 26.0 15.6 27.0 145-149 22.706082396072247 24.0 20.0 26.0 16.2 27.0 150-154 22.528863039627034 23.4 20.0 25.8 16.4 27.0 155-159 22.216001438734686 23.4 19.6 25.6 14.8 27.0 160-164 22.15802494785465 23.2 19.6 25.0 15.6 26.0 165-169 22.054960999003445 22.666666666666668 19.666666666666668 25.0 16.0 26.666666666666668 170-174 21.538278692071366 NaN NaN NaN NaN NaN 175-179 21.091612661870016 NaN NaN NaN NaN NaN 180-184 20.691582773035737 NaN NaN NaN NaN NaN 185-189 20.17276056664054 NaN NaN NaN NaN NaN 190-194 20.360800865800865 NaN NaN NaN NaN NaN 195-199 20.114012252115703 NaN NaN NaN NaN NaN 200-204 20.695131733852964 NaN NaN NaN NaN NaN 205-209 20.31181818181818 NaN NaN NaN NaN NaN 210-214 19.69142857142857 NaN NaN NaN NaN NaN 215-219 18.986666666666665 NaN NaN NaN NaN NaN 220-224 17.133333333333333 NaN NaN NaN NaN NaN 225-229 15.9 NaN NaN NaN NaN NaN 230-234 15.9 NaN NaN NaN NaN NaN 235-239 18.0 NaN NaN NaN NaN NaN 240-243 19.5 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 2.0 11 5.0 12 8.0 13 11.0 14 11.0 15 29.0 16 61.0 17 83.0 18 94.0 19 130.0 20 145.0 21 188.0 22 292.0 23 528.0 24 940.0 25 1147.0 26 316.0 27 9.0 28 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.15 43.55 20.474999999999998 13.825000000000001 2 42.425000000000004 33.4 6.25 17.925 3 31.025000000000002 29.65 21.525 17.8 4 35.375 27.55 17.974999999999998 19.1 5 28.025 27.0 18.975 26.0 6 25.15 28.425 21.925 24.5 7 21.175 30.4 26.1 22.325 8 23.799999999999997 25.974999999999998 25.85 24.375 9 24.191526698420656 24.617698671346204 25.36976685886187 25.821007771371267 10-14 26.117029333064067 24.551926086737012 25.521280355429898 23.80976422476902 15-19 26.250448879084797 25.655363463807525 24.29077104601652 23.803416611091162 20-24 26.462786706194414 25.06891350704738 23.976699433088886 24.49160035366932 25-29 25.790754257907544 25.473394689516553 24.484290701364646 24.251560351211253 30-34 25.391088574819292 24.598122774840867 25.612255906786064 24.39853274355378 35-39 25.991701244813274 24.968188105117566 24.43706777316736 24.6030428769018 40-44 26.540094069060455 24.819318572903523 25.077434897327063 23.56315246070896 45-49 25.756484149855908 24.621757925072046 25.30019212295869 24.32156580211335 50-54 25.8842954213501 24.779323045659492 25.192100082555406 24.144281450435003 55-59 24.72583611470608 25.086846945030995 25.209454396839455 24.977862543423473 60-64 25.886893275938842 23.786551877690368 26.28024343179457 24.04631141457622 65-69 25.20478374836173 24.615006553079947 25.491480996068148 24.68872870249017 70-74 25.331383124600055 24.947435780235853 25.587348020842853 24.133833074321238 75-79 26.156069364161848 25.258051197357556 25.402559867877788 23.18331957060281 80-84 25.48767667328583 25.300782618852935 25.300782618852935 23.910758089008294 85-89 25.297340638781236 25.711612989442738 25.978885473740476 23.012160898035546 90-94 25.03105590062112 25.372670807453417 25.962732919254663 23.633540372670808 95-99 25.04906333630687 26.56556645851918 25.35236396074933 23.03300624442462 100-104 24.979440789473685 26.31578947368421 24.814967105263158 23.889802631578945 105-109 26.103555237413506 25.554760200429495 26.413743736578382 21.92794082557862 110-114 25.56179775280899 25.08426966292135 25.56179775280899 23.79213483146067 115-119 25.082726671078753 26.009265387160816 23.825281270681668 25.082726671078753 120-124 25.570599613152805 24.874274661508704 26.034816247582203 23.520309477756285 125-129 24.029237094563726 25.856555504796713 26.861580630424854 23.25262677021471 130-134 23.510292524377032 25.243770314192847 26.923076923076923 24.322860238353197 135-139 23.391812865497073 25.601039636127354 26.18583495776478 24.821312540610784 140-144 23.821138211382113 23.495934959349594 26.585365853658537 26.097560975609756 145-149 23.50049164208456 26.64700098328417 24.582104228121928 25.27040314650934 150-154 21.34570765661253 26.102088167053367 27.37819025522042 25.17401392111369 155-159 22.563417890520697 24.699599465954606 29.10547396528705 23.63150867823765 160-164 24.613003095975234 23.374613003095977 26.160990712074305 25.851393188854487 165-169 26.436781609195403 24.137931034482758 26.436781609195403 22.988505747126435 170-174 27.628361858190708 23.4718826405868 29.095354523227385 19.80440097799511 175-179 24.78134110787172 24.489795918367346 28.86297376093295 21.865889212827987 180-184 24.642857142857146 28.57142857142857 24.642857142857146 22.142857142857142 185-189 25.97402597402597 24.675324675324674 25.108225108225106 24.242424242424242 190-194 26.744186046511626 26.744186046511626 29.069767441860467 17.441860465116278 195-199 18.248175182481752 35.03649635036496 28.467153284671532 18.248175182481752 200-204 22.22222222222222 23.232323232323232 28.28282828282828 26.262626262626267 205-209 21.53846153846154 30.76923076923077 23.076923076923077 24.615384615384617 210-214 24.444444444444443 33.33333333333333 17.77777777777778 24.444444444444443 215-219 26.08695652173913 34.78260869565217 17.391304347826086 21.73913043478261 220-224 13.333333333333334 53.333333333333336 20.0 13.333333333333334 225-229 42.857142857142854 28.57142857142857 14.285714285714285 14.285714285714285 230-234 20.0 20.0 10.0 50.0 235-239 50.0 16.666666666666664 0.0 33.33333333333333 240-243 25.0 25.0 25.0 25.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.5 15 2.0 16 2.0 17 3.5 18 5.0 19 5.5 20 6.0 21 5.5 22 5.0 23 3.5 24 3.5 25 6.5 26 11.0 27 13.5 28 14.5 29 15.5 30 18.5 31 31.833333333333336 32 37.333333333333336 33 39.5 34 53.0 35 71.5 36 92.83333333333334 37 114.83333333333333 38 137.5 39 168.5 40 182.83333333333331 41 192.83333333333331 42 219.33333333333334 43 246.83333333333334 44 283.33333333333337 45 296.33333333333337 46 292.83333333333337 47 287.33333333333337 48 289.1666666666667 49 287.8333333333333 50 249.16666666666669 51 229.5 52 224.66666666666669 53 208.0 54 213.5 55 203.5 56 182.0 57 175.0 58 165.0 59 154.0 60 144.5 61 141.0 62 132.33333333333334 63 128.0 64 114.0 65 99.5 66 104.0 67 93.0 68 75.0 69 65.5 70 65.0 71 62.0 72 56.0 73 49.0 74 40.0 75 30.0 76 22.5 77 19.5 78 16.0 79 12.0 80 9.5 81 8.0 82 6.5 83 6.5 84 7.0 85 5.0 86 3.0 87 2.5 88 1.5 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 1.0 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240-243 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 16.0 10-14 61.0 15-19 55.0 20-24 55.0 25-29 76.0 30-34 91.0 35-39 96.0 40-44 162.0 45-49 155.0 50-54 202.0 55-59 232.0 60-64 257.0 65-69 240.0 70-74 267.0 75-79 242.0 80-84 212.0 85-89 216.0 90-94 181.0 95-99 150.0 100-104 147.0 105-109 118.0 110-114 128.0 115-119 89.0 120-124 92.0 125-129 64.0 130-134 67.0 135-139 61.0 140-144 49.0 145-149 40.0 150-154 19.0 155-159 24.0 160-164 22.0 165-169 25.0 170-174 15.0 175-179 15.0 180-184 7.0 185-189 12.0 190-194 10.0 195-199 7.0 200-204 7.0 205-209 5.0 210-214 5.0 215-219 3.0 220-224 0.0 225-229 1.0 230-234 0.0 235-239 1.0 240-244 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54659949622166 98.8 2 0.30226700251889166 0.6 3 0.05037783375314861 0.15 4 0.05037783375314861 0.2 5 0.05037783375314861 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGAAGAAGCTCACTGCCGAGGCTTATGACTGCAACAATACGGTTGAGC 5 0.125 No Hit ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-229 0.0 0.0 0.0 0.0 0.0 230-231 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGCACGA 5 4.1689182E-4 3134.5002 175-179 AATTTTG 10 0.0 3134.5002 180-181 CTGAGAA 10 0.0016675673 1567.2501 165-169 TAATACT 5 0.0025008188 1567.2501 160-164 ATTTTGG 10 0.0016675673 1567.2501 180-181 TGCAAAA 5 0.0062507177 1044.8334 175-179 GCAAAAT 5 0.0062507177 1044.8334 175-179 AAAATTT 5 0.0062507177 1044.8334 175-179 CAAAATT 5 0.0062507177 1044.8334 175-179 TGCTATG 15 0.0037520267 1044.8333 170-174 GATGTTC 15 0.0020344357 208.96666 105-109 >>END_MODULE Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395437 spots for ERR1806552.sra Written 395437 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra Read 395425 spots for ERR1806552.sra Written 395425 spots for ERR1806552.sra SRR ids: ['ERR1806552.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9f5crz55 ERR1806552.sra spots: 7908512 blocks: [[1, 395425], [395426, 790850], [790851, 1186275], [1186276, 1581700], [1581701, 1977125], [1977126, 2372550], [2372551, 2767975], [2767976, 3163400], [3163401, 3558825], [3558826, 3954250], [3954251, 4349675], [4349676, 4745100], [4745101, 5140525], [5140526, 5535950], [5535951, 5931375], [5931376, 6326800], [6326801, 6722225], [6722226, 7117650], [7117651, 7513075], [7513076, 7908512]] ERR1806552 file size 1535891 ERR1806552 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806552 ERR1806552_1.fastq Input file: ERR1806552_1.fastq trimmed: ERR1806552-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:07:03 2024 >> started Mon Dec 9 16:07:07 2024 >> done (4.221s) 7908512 reads processed; of these: 276011 ( 3.49%) short reads filtered out after trimming by size control 38 ( 0.00%) empty reads filtered out after trimming by size control 7632463 (96.51%) reads available; of these: 94021 ( 1.23%) trimmed reads available after processing 7538442 (98.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 23864 0.31% 19 22950 0.30% 20 23203 0.30% 21 24302 0.32% 22 24663 0.32% 23 25039 0.33% 24 27266 0.36% 25 26846 0.35% 26 28374 0.37% 27 30803 0.40% 28 31895 0.42% 29 32399 0.42% 30 35359 0.46% 31 34996 0.46% 32 36623 0.48% 33 41187 0.54% 34 42653 0.56% 35 42589 0.56% 36 46769 0.61% 37 45303 0.59% 38 47907 0.63% 39 53781 0.70% 40 51906 0.68% 41 54921 0.72% 42 62106 0.81% 43 58844 0.77% 44 61427 0.80% 45 67477 0.88% 46 66564 0.87% 47 67784 0.89% 48 73025 0.96% 49 72763 0.95% 50 74916 0.98% 51 79231 1.04% 52 78847 1.03% 53 80319 1.05% 54 85507 1.12% 55 85370 1.12% 56 86407 1.13% 57 90096 1.18% 58 88374 1.16% 59 91977 1.21% 60 97106 1.27% 61 96645 1.27% 62 93378 1.22% 63 103205 1.35% 64 95608 1.25% 65 94825 1.24% 66 96537 1.26% 67 94841 1.24% 68 96226 1.26% 69 98285 1.29% 70 97488 1.28% 71 95507 1.25% 72 97761 1.28% 73 93329 1.22% 74 92844 1.22% 75 94303 1.24% 76 92129 1.21% 77 96826 1.27% 78 96064 1.26% 79 89757 1.18% 80 88918 1.16% 81 88001 1.15% 82 94977 1.24% 83 88308 1.16% 84 85344 1.12% 85 83773 1.10% 86 79657 1.04% 87 80077 1.05% 88 79087 1.04% 89 77096 1.01% 90 78528 1.03% 91 73581 0.96% 92 72203 0.95% 93 74991 0.98% 94 68924 0.90% 95 66814 0.88% 96 66847 0.88% 97 63428 0.83% 98 62573 0.82% 99 61591 0.81% 100 60381 0.79% 101 58127 0.76% 102 57854 0.76% 103 58509 0.77% 104 53703 0.70% 105 52771 0.69% 106 50311 0.66% 107 49203 0.64% 108 48740 0.64% 109 48735 0.64% 110 45622 0.60% 111 44301 0.58% 112 44227 0.58% 113 40914 0.54% 114 40962 0.54% 115 39660 0.52% 116 38164 0.50% 117 37356 0.49% 118 36331 0.48% 119 34623 0.45% 120 34856 0.46% 121 32529 0.43% 122 31850 0.42% 123 31164 0.41% 124 29707 0.39% 125 28657 0.38% 126 27834 0.36% 127 27169 0.36% 128 26170 0.34% 129 25793 0.34% 130 24767 0.32% 131 23861 0.31% 132 23230 0.30% 133 22442 0.29% 134 22098 0.29% 135 21194 0.28% 136 20117 0.26% 137 19615 0.26% 138 19630 0.26% 139 18986 0.25% 140 18072 0.24% 141 17385 0.23% 142 16807 0.22% 143 16145 0.21% 144 15658 0.21% 145 15154 0.20% 146 14566 0.19% 147 14556 0.19% 148 13938 0.18% 149 13330 0.17% 150 13253 0.17% 151 12553 0.16% 152 12103 0.16% 153 11617 0.15% 154 11650 0.15% 155 11156 0.15% 156 10736 0.14% 157 10418 0.14% 158 9738 0.13% 159 9604 0.13% 160 9293 0.12% 161 8959 0.12% 162 8794 0.12% 163 8411 0.11% 164 8115 0.11% 165 7786 0.10% 166 7579 0.10% 167 7418 0.10% 168 7061 0.09% 169 6814 0.09% 170 6605 0.09% 171 6430 0.08% 172 6146 0.08% 173 5787 0.08% 174 5608 0.07% 175 5400 0.07% 176 5191 0.07% 177 5029 0.07% 178 4983 0.07% 179 4890 0.06% 180 4479 0.06% 181 4378 0.06% 182 4287 0.06% 183 4017 0.05% 184 3812 0.05% 185 3731 0.05% 186 3665 0.05% 187 3445 0.05% 188 3433 0.04% 189 3185 0.04% 190 3101 0.04% 191 3000 0.04% 192 2939 0.04% 193 2802 0.04% 194 2654 0.03% 195 2567 0.03% 196 2407 0.03% 197 2335 0.03% 198 2239 0.03% 199 2128 0.03% 200 2068 0.03% 201 1983 0.03% 202 1854 0.02% 203 1774 0.02% 204 1667 0.02% 205 1595 0.02% 206 1582 0.02% 207 1440 0.02% 208 1451 0.02% 209 1362 0.02% 210 1321 0.02% 211 1192 0.02% 212 1106 0.01% 213 1072 0.01% 214 1046 0.01% 215 925 0.01% 216 873 0.01% 217 952 0.01% 218 850 0.01% 219 809 0.01% 220 708 0.01% 221 651 0.01% 222 625 0.01% 223 582 0.01% 224 579 0.01% 225 565 0.01% 226 503 0.01% 227 456 0.01% 228 440 0.01% 229 411 0.01% 230 368 0.00% 231 330 0.00% 232 314 0.00% 233 325 0.00% 234 277 0.00% 235 223 0.00% 236 241 0.00% 237 207 0.00% 238 218 0.00% 239 181 0.00% 240 183 0.00% 241 148 0.00% 242 161 0.00% 243 149 0.00% 244 121 0.00% 245 110 0.00% 246 95 0.00% 247 67 0.00% 248 67 0.00% 249 63 0.00% 250 69 0.00% 251 49 0.00% 252 62 0.00% 253 48 0.00% 254 56 0.00% 255 41 0.00% 256 38 0.00% 257 29 0.00% 258 31 0.00% 259 31 0.00% 260 25 0.00% 261 21 0.00% 262 25 0.00% 263 20 0.00% 264 16 0.00% 265 11 0.00% 266 12 0.00% 267 4 0.00% 268 6 0.00% 269 13 0.00% 270 7 0.00% 271 9 0.00% 272 4 0.00% 273 5 0.00% 274 0 0.00% 275 4 0.00% 276 5 0.00% 277 2 0.00% 278 2 0.00% 279 0 0.00% 280 2 0.00% 281 3 0.00% 282 2 0.00% 283 0 0.00% 284 0 0.00% 285 1 0.00% 286 0 0.00% 287 0 0.00% 288 0 0.00% 289 1 0.00% 7632463 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.35 fanout-score-rank=16 prefix-density=0.18 prefix-fanout=3.5 sequence=GGCAAGACCATCAC criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=35.48 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=9.1 sequence=GTGGAGAAGAAGGAC Started job on | Dec 09 16:07:34 Started mapping on | Dec 09 16:07:34 Finished on | Dec 09 16:07:49 Mapping speed, Million of reads per hour | 1831.79 Number of input reads | 7632463 Average input read length | 76 UNIQUE READS: Uniquely mapped reads number | 6157357 Uniquely mapped reads % | 80.67% Average mapped length | 71.40 Number of splices: Total | 1422733 Number of splices: Annotated (sjdb) | 1341892 Number of splices: GT/AG | 1393264 Number of splices: GC/AG | 15664 Number of splices: AT/AC | 1167 Number of splices: Non-canonical | 12638 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.12% Deletion average length | 1.09 Insertion rate per base | 0.11% Insertion average length | 1.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264320 % of reads mapped to multiple loci | 3.46% Number of reads mapped to too many loci | 119821 % of reads mapped to too many loci | 1.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.08% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1210786 1210786 1210786 N_multimapping 264320 264320 264320 N_noFeature 230762 279966 6023167 N_ambiguous 97421 12685 636 UnstrandedReadsAssigned:5829174 PositiveStrandReadsAssigned:5864706 NegativeStrandReadsAssigned:133554 Dataset is classified positive stranded MeadianReadLen=72 20thPercentileLength=47 echo kmer=43 ERR1806552 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806552-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,632,463 reads, 5,820,208 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,013 rounds 52973 ERR1806552.ke.tsv 35125 ERR1806552.se.tsv 88098 total ==> ERR1806552.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 90.1201 29.815 PNS24247 1044 945 21.8666 6.40749 PNS24249 1928 1829 43.7565 6.62473 PNS24246 1044 945 21.8666 6.40749 PNS24248 1044 945 21.8666 6.40749 PNS24244 1471 1372 63.5237 12.821 PNS24243 293 194 0 0 KQK14069 1603 1504 969.288 178.461 KQK14071 474 375 46.2212 34.131 ==> ERR1806552.se.tsv <== BRADI_1g14170v3 1112 BRADI_1g53295v3 46 BRADI_1g59795v3 158 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 665 BRADI_1g74790v3 135 BRADI_1g09890v3 0 BRADI_1g77505v3 124 BRADI_1g48960v3 1 ERR1806552 completed mapping pipeline successfully