Starting /dee2/code/volunteer_pipeline.sh ERR1806553 current disk space = 1523133349888 free memory = 1580364384 ERR1806553 SRAfilesize b5e0f4537372387195a37dcf99bec3c3 ERR1806553.sra ERR1806553.sra file validated ERR1806553 is single end ERR1806553 is conventional basespace ERR1806553 read1 length is 8-226 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806553_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-226 %GC 52 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.1915 25.0 22.0 27.0 19.0 28.0 2 23.99325 26.0 21.0 27.0 17.0 29.0 3 23.676 25.0 21.0 27.0 17.0 29.0 4 23.838 25.0 21.0 27.0 17.0 29.0 5 23.74425 25.0 21.0 27.0 17.0 28.0 6 23.72475 25.0 21.0 27.0 17.0 28.0 7 23.67525 25.0 21.0 27.0 17.0 28.0 8 23.79625 25.0 21.0 27.0 17.0 28.0 9 23.74643304130163 25.0 21.0 27.0 17.0 28.0 10-14 23.718809835383503 25.0 21.0 27.0 17.2 28.0 15-19 23.93087167135078 25.0 21.0 27.0 18.0 28.0 20-24 24.001842673045918 26.0 21.2 27.0 18.0 28.0 25-29 24.026922981321015 25.4 21.4 27.0 18.2 28.0 30-34 24.022901581927194 25.4 21.4 27.0 18.0 28.0 35-39 24.0546725370408 25.4 21.2 27.0 18.0 28.0 40-44 24.032661578474723 25.0 21.6 27.0 18.2 28.0 45-49 23.9720987950471 25.0 21.4 27.0 18.0 28.0 50-54 23.964126331331887 25.0 21.0 27.0 18.0 28.0 55-59 24.025727121825632 25.0 21.6 27.0 18.0 28.0 60-64 24.032205498549786 25.0 21.6 27.0 18.6 28.0 65-69 24.006569784369017 25.0 21.4 27.0 18.2 28.0 70-74 23.91134763946471 25.0 21.2 27.0 18.0 28.0 75-79 23.93775427268713 25.0 21.2 27.0 18.2 28.0 80-84 23.81972044631838 25.0 21.2 27.0 18.0 28.0 85-89 23.782258168679295 25.0 21.0 27.0 18.0 28.0 90-94 23.776169055501327 25.0 21.0 27.0 18.0 28.0 95-99 23.67952818288897 25.0 21.0 26.8 17.8 27.8 100-104 23.63734659247991 25.0 21.0 26.6 17.8 27.6 105-109 23.466024945685078 25.0 21.0 26.2 17.2 27.2 110-114 23.446350508978135 25.0 20.8 26.0 17.8 27.2 115-119 23.400626696247144 25.0 21.0 26.0 17.8 27.0 120-124 23.28893614949828 25.0 20.8 26.0 17.2 27.0 125-129 23.203776657238528 24.4 20.4 26.0 17.2 27.0 130-134 23.169369630121913 24.0 20.4 26.0 17.4 27.0 135-139 22.702094293701997 24.0 20.2 26.0 15.6 27.0 140-144 22.51154155938585 23.6 20.0 26.0 16.2 27.0 145-149 22.451339846113786 23.2 20.0 26.0 15.8 27.0 150-154 22.449842449452007 23.4 20.2 25.6 16.4 26.6 155-159 22.647031324310284 23.6 20.2 25.8 16.4 27.0 160-164 22.114495095704246 23.4 19.2 25.0 15.2 26.0 165-169 21.84821346347767 23.0 19.0 25.0 15.2 26.2 170-174 21.47139755383794 NaN NaN NaN NaN NaN 175-179 21.09742363380431 NaN NaN NaN NaN NaN 180-184 20.567750246849755 NaN NaN NaN NaN NaN 185-189 20.889445618980503 NaN NaN NaN NaN NaN 190-194 21.065287147634972 NaN NaN NaN NaN NaN 195-199 21.35565124933546 NaN NaN NaN NaN NaN 200-204 20.71247086247086 NaN NaN NaN NaN NaN 205-209 19.808051948051947 NaN NaN NaN NaN NaN 210-214 18.18 NaN NaN NaN NaN NaN 215-219 15.183333333333334 NaN NaN NaN NaN NaN 220-224 12.433333333333334 NaN NaN NaN NaN NaN 225-226 14.5 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 11 1.0 12 7.0 13 8.0 14 12.0 15 22.0 16 34.0 17 67.0 18 94.0 19 104.0 20 157.0 21 183.0 22 327.0 23 558.0 24 1062.0 25 1135.0 26 227.0 27 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.150000000000002 44.7 17.05 15.1 2 43.425000000000004 34.300000000000004 5.6000000000000005 16.675 3 33.675 31.15 18.099999999999998 17.075000000000003 4 36.125 28.575 15.85 19.45 5 30.65 25.825 16.35 27.175 6 26.674999999999997 28.525 18.8 26.0 7 22.725 31.724999999999998 23.1 22.45 8 27.825 24.2 22.875 25.1 9 26.032540675844807 22.828535669586984 23.2540675844806 27.88485607008761 10-14 26.77826371085306 24.752425476298196 23.244357311617154 25.22495350123159 15-19 27.863620244186638 24.5098535893409 22.49354070621612 25.132985460256346 20-24 28.45017129416577 24.349337833000973 22.206882446182952 24.993608426650304 25-29 27.54237288135593 24.40574617610583 23.098387763538653 24.953493178999587 30-34 27.46640275028649 23.43473278466507 23.148244608813417 25.950619856235026 35-39 26.940687332245673 24.114520288405874 22.593547708015368 26.351244671333085 40-44 27.562120081049375 23.872240588674416 23.285699050869148 25.27994027940706 45-49 28.223751964876143 24.20185375901133 22.678735974849584 24.89565830126294 50-54 27.42857142857143 23.373092926490983 23.17891816920943 26.019417475728158 55-59 26.455572764297596 23.553031606722882 23.598921585498765 26.392474043480757 60-64 27.132154629907102 24.027569673359306 23.554090500449508 25.286185196284087 65-69 27.075399847677073 23.184818481848186 23.616400101548614 26.123381568926124 70-74 26.202185792349724 23.510928961748633 24.23497267759563 26.05191256830601 75-79 26.80481783496671 24.530560335153737 23.93207151941348 24.732550310466074 80-84 27.26586102719033 23.590130916414903 23.892245720040282 25.25176233635448 85-89 25.971331572991325 24.858543945680875 23.576009053187477 25.594115428140324 90-94 25.94101876675603 24.536193029490615 24.139410187667558 25.38337801608579 95-99 26.049382716049386 24.28395061728395 23.938271604938272 25.728395061728392 100-104 25.38340260857102 24.83875591228322 24.781424681095025 24.99641679805074 105-109 25.65017848036716 25.021247662757094 24.47730749617542 24.851266360700322 110-114 25.161681487469682 25.26273241713824 24.878738884397738 24.696847210994342 115-119 25.765124555160142 25.24317912218268 25.005931198102015 23.98576512455516 120-124 25.57610241820768 25.376955903271693 24.15362731152205 24.893314366998577 125-129 25.444596443228455 22.19562243502052 26.949384404924757 25.410396716826266 130-134 25.25709584533114 25.25709584533114 23.035787741670095 26.450020567667625 135-139 26.25383828045036 24.56499488229273 24.462640736949847 24.718526100307063 140-144 24.846248462484624 24.108241082410824 24.600246002460025 26.44526445264453 145-149 21.788990825688074 25.840978593272173 27.675840978593275 24.694189602446485 150-154 24.809885931558938 25.475285171102662 24.23954372623574 25.475285171102662 155-159 23.831242873432153 25.65564424173318 24.401368301026224 26.111744583808438 160-164 26.13941018766756 26.541554959785525 22.92225201072386 24.396782841823057 165-169 25.806451612903224 22.07130730050934 23.089983022071305 29.03225806451613 170-174 29.587155963302752 23.165137614678898 24.770642201834864 22.477064220183486 175-179 24.539877300613497 23.31288343558282 27.300613496932513 24.846625766871167 180-184 25.609756097560975 26.01626016260163 25.609756097560975 22.76422764227642 185-189 29.18918918918919 28.10810810810811 18.37837837837838 24.324324324324326 190-194 25.984251968503933 24.409448818897637 29.133858267716533 20.47244094488189 195-199 26.31578947368421 23.157894736842106 26.31578947368421 24.210526315789473 200-204 25.806451612903224 22.58064516129032 33.87096774193548 17.741935483870968 205-209 14.583333333333334 35.41666666666667 16.666666666666664 33.33333333333333 210-214 17.391304347826086 30.434782608695656 26.08695652173913 26.08695652173913 215-219 15.789473684210526 26.31578947368421 15.789473684210526 42.10526315789473 220-224 12.5 12.5 37.5 37.5 225-226 50.0 50.0 0.0 0.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.5 20 2.0 21 2.0 22 2.0 23 2.0 24 1.5 25 1.0 26 1.5 27 3.0 28 6.5 29 10.0 30 12.0 31 17.0 32 22.5 33 25.5 34 32.0 35 47.5 36 63.0 37 73.83333333333333 38 78.5 39 82.33333333333334 40 105.33333333333333 41 115.83333333333334 42 124.83333333333333 43 147.16666666666669 44 162.33333333333334 45 187.5 46 218.5 47 221.0 48 208.5 49 202.16666666666669 50 209.16666666666669 51 214.33333333333331 52 197.33333333333331 53 202.33333333333334 54 194.83333333333334 55 186.83333333333331 56 180.33333333333331 57 164.83333333333331 58 172.0 59 172.0 60 165.33333333333331 61 163.33333333333331 62 161.0 63 147.5 64 141.83333333333331 65 133.83333333333331 66 112.0 67 102.0 68 92.0 69 81.0 70 71.0 71 57.5 72 44.5 73 37.0 74 31.0 75 22.0 76 15.5 77 12.5 78 9.5 79 5.5 80 3.0 81 1.5 82 1.5 83 2.5 84 3.0 85 3.0 86 3.5 87 4.0 88 3.5 89 2.5 90 2.0 91 1.5 92 1.0 93 1.0 94 1.0 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-226 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 11.0 10-14 25.0 15-19 40.0 20-24 38.0 25-29 34.0 30-34 39.0 35-39 40.0 40-44 53.0 45-49 79.0 50-54 104.0 55-59 129.0 60-64 175.0 65-69 208.0 70-74 237.0 75-79 292.0 80-84 267.0 85-89 259.0 90-94 256.0 95-99 225.0 100-104 222.0 105-109 217.0 110-114 151.0 115-119 148.0 120-124 121.0 125-129 104.0 130-134 100.0 135-139 81.0 140-144 59.0 145-149 57.0 150-154 44.0 155-159 25.0 160-164 30.0 165-169 30.0 170-174 27.0 175-179 19.0 180-184 11.0 185-189 15.0 190-194 6.0 195-199 9.0 200-204 2.0 205-209 6.0 210-214 1.0 215-219 1.0 220-224 2.0 225-227 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.475 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06067529829906 97.55 2 0.787001777100787 1.55 3 0.07616146230007616 0.22499999999999998 4 0.05077430820005078 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02538715410002539 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 19 0.475 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGCA 10 0.0 3385.9998 180-184 AAAGCAG 10 0.0014290456 1692.9999 180-184 TTGGAGA 20 0.0 1692.9999 175-179 GGAGAAA 5 0.0035715587 1354.3999 175-179 GAGAAAG 5 0.0035715587 1354.3999 175-179 TCATGGC 5 0.0035715587 1354.3999 155-159 AAGTTCA 15 0.003215352 1128.6667 165-169 AAGCAGA 10 0.0042862925 1128.6666 180-184 GTGCCAA 10 0.0042862925 1128.6666 160-164 ACCTGGT 5 0.007498797 967.4286 145-149 TGGTAGA 5 0.009997412 846.49994 170-174 GTTGGTA 5 0.009997412 846.49994 170-174 TTGGTAG 5 0.009997412 846.49994 170-174 TGGAGAA 25 0.008931533 677.2 175-179 >>END_MODULE Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244566 spots for ERR1806553.sra Written 244566 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra Read 244561 spots for ERR1806553.sra Written 244561 spots for ERR1806553.sra SRR ids: ['ERR1806553.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4_f_wus7 ERR1806553.sra spots: 4891225 blocks: [[1, 244561], [244562, 489122], [489123, 733683], [733684, 978244], [978245, 1222805], [1222806, 1467366], [1467367, 1711927], [1711928, 1956488], [1956489, 2201049], [2201050, 2445610], [2445611, 2690171], [2690172, 2934732], [2934733, 3179293], [3179294, 3423854], [3423855, 3668415], [3668416, 3912976], [3912977, 4157537], [4157538, 4402098], [4402099, 4646659], [4646660, 4891225]] ERR1806553 file size 1069422 ERR1806553 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806553 ERR1806553_1.fastq Input file: ERR1806553_1.fastq trimmed: ERR1806553-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Mon Dec 9 16:09:21 2024 >> started Mon Dec 9 16:09:24 2024 >> done (2.682s) 4891225 reads processed; of these: 95357 ( 1.95%) short reads filtered out after trimming by size control 11 ( 0.00%) empty reads filtered out after trimming by size control 4795857 (98.05%) reads available; of these: 68657 ( 1.43%) trimmed reads available after processing 4727200 (98.57%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8608 0.18% 19 8635 0.18% 20 8080 0.17% 21 8324 0.17% 22 8011 0.17% 23 7827 0.16% 24 8833 0.18% 25 8284 0.17% 26 8362 0.17% 27 8634 0.18% 28 8788 0.18% 29 8659 0.18% 30 9431 0.20% 31 9518 0.20% 32 9518 0.20% 33 10116 0.21% 34 10427 0.22% 35 10363 0.22% 36 11249 0.23% 37 11348 0.24% 38 11807 0.25% 39 13053 0.27% 40 12994 0.27% 41 13503 0.28% 42 15922 0.33% 43 15416 0.32% 44 16035 0.33% 45 18224 0.38% 46 17958 0.37% 47 18908 0.39% 48 20976 0.44% 49 22097 0.46% 50 22452 0.47% 51 25643 0.53% 52 25842 0.54% 53 26577 0.55% 54 30031 0.63% 55 30666 0.64% 56 31971 0.67% 57 34830 0.73% 58 35538 0.74% 59 38086 0.79% 60 42249 0.88% 61 43117 0.90% 62 42746 0.89% 63 48236 1.01% 64 47575 0.99% 65 47355 0.99% 66 49928 1.04% 67 51298 1.07% 68 52567 1.10% 69 56058 1.17% 70 56087 1.17% 71 56521 1.18% 72 61499 1.28% 73 58346 1.22% 74 61331 1.28% 75 62339 1.30% 76 63286 1.32% 77 71532 1.49% 78 74858 1.56% 79 63729 1.33% 80 63355 1.32% 81 64524 1.35% 82 67005 1.40% 83 65739 1.37% 84 65405 1.36% 85 64927 1.35% 86 62827 1.31% 87 64297 1.34% 88 63378 1.32% 89 61754 1.29% 90 63798 1.33% 91 59768 1.25% 92 59542 1.24% 93 62896 1.31% 94 58856 1.23% 95 57815 1.21% 96 58073 1.21% 97 55120 1.15% 98 54779 1.14% 99 55634 1.16% 100 53536 1.12% 101 52391 1.09% 102 51784 1.08% 103 53784 1.12% 104 48744 1.02% 105 47949 1.00% 106 45816 0.96% 107 45851 0.96% 108 44694 0.93% 109 43754 0.91% 110 41536 0.87% 111 41777 0.87% 112 41072 0.86% 113 38939 0.81% 114 38213 0.80% 115 36660 0.76% 116 35747 0.75% 117 34976 0.73% 118 33811 0.71% 119 32729 0.68% 120 32286 0.67% 121 31739 0.66% 122 29578 0.62% 123 29018 0.61% 124 27661 0.58% 125 27108 0.57% 126 26848 0.56% 127 25205 0.53% 128 24158 0.50% 129 24041 0.50% 130 22835 0.48% 131 22093 0.46% 132 21589 0.45% 133 20694 0.43% 134 20616 0.43% 135 19596 0.41% 136 18522 0.39% 137 17880 0.37% 138 17980 0.37% 139 17050 0.36% 140 16663 0.35% 141 15850 0.33% 142 14948 0.31% 143 14460 0.30% 144 14393 0.30% 145 13774 0.29% 146 13314 0.28% 147 13206 0.28% 148 12289 0.26% 149 11694 0.24% 150 11551 0.24% 151 11258 0.23% 152 10860 0.23% 153 10732 0.22% 154 10106 0.21% 155 9918 0.21% 156 9339 0.19% 157 9265 0.19% 158 8594 0.18% 159 8326 0.17% 160 7915 0.17% 161 7784 0.16% 162 7472 0.16% 163 7315 0.15% 164 6957 0.15% 165 6702 0.14% 166 6646 0.14% 167 6174 0.13% 168 5879 0.12% 169 5585 0.12% 170 5631 0.12% 171 5215 0.11% 172 4969 0.10% 173 4961 0.10% 174 4705 0.10% 175 4480 0.09% 176 4308 0.09% 177 4279 0.09% 178 4021 0.08% 179 3817 0.08% 180 3616 0.08% 181 3602 0.08% 182 3523 0.07% 183 3303 0.07% 184 3323 0.07% 185 2958 0.06% 186 2829 0.06% 187 2841 0.06% 188 2605 0.05% 189 2573 0.05% 190 2450 0.05% 191 2397 0.05% 192 2196 0.05% 193 2162 0.05% 194 1955 0.04% 195 1958 0.04% 196 1815 0.04% 197 1819 0.04% 198 1682 0.04% 199 1720 0.04% 200 1472 0.03% 201 1495 0.03% 202 1420 0.03% 203 1341 0.03% 204 1197 0.02% 205 1225 0.03% 206 1142 0.02% 207 1082 0.02% 208 1059 0.02% 209 1035 0.02% 210 965 0.02% 211 870 0.02% 212 866 0.02% 213 782 0.02% 214 747 0.02% 215 706 0.01% 216 647 0.01% 217 630 0.01% 218 600 0.01% 219 603 0.01% 220 517 0.01% 221 512 0.01% 222 491 0.01% 223 455 0.01% 224 413 0.01% 225 359 0.01% 226 358 0.01% 227 341 0.01% 228 295 0.01% 229 320 0.01% 230 295 0.01% 231 246 0.01% 232 250 0.01% 233 223 0.00% 234 181 0.00% 235 160 0.00% 236 168 0.00% 237 137 0.00% 238 148 0.00% 239 142 0.00% 240 139 0.00% 241 95 0.00% 242 90 0.00% 243 96 0.00% 244 85 0.00% 245 92 0.00% 246 61 0.00% 247 66 0.00% 248 64 0.00% 249 58 0.00% 250 34 0.00% 251 57 0.00% 252 35 0.00% 253 34 0.00% 254 28 0.00% 255 35 0.00% 256 36 0.00% 257 21 0.00% 258 26 0.00% 259 18 0.00% 260 15 0.00% 261 13 0.00% 262 19 0.00% 263 14 0.00% 264 16 0.00% 265 13 0.00% 266 5 0.00% 267 9 0.00% 268 4 0.00% 269 5 0.00% 270 6 0.00% 271 4 0.00% 272 6 0.00% 273 3 0.00% 274 3 0.00% 275 1 0.00% 276 2 0.00% 277 2 0.00% 278 3 0.00% 279 3 0.00% 280 3 0.00% 281 1 0.00% 282 1 0.00% 283 1 0.00% 284 0 0.00% 285 0 0.00% 286 0 0.00% 287 2 0.00% 288 1 0.00% 289 0 0.00% 290 0 0.00% 291 0 0.00% 292 1 0.00% 293 0 0.00% 294 1 0.00% 4795857 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=4.90 fanout-score-rank=21 prefix-density=0.26 prefix-fanout=3.9 sequence=GGCAAGACCATCACCCTTGAGGT criterion=fanout-score sequence-density=0.06 sequence-density-rank=21 fanout-score=154.20 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=14.2 sequence=AGAAGAAGGACCCAACCGGCGCCAAGGTCACCAAGCGGCTGCCAAGA Started job on | Dec 09 16:09:43 Started mapping on | Dec 09 16:09:44 Finished on | Dec 09 16:09:53 Mapping speed, Million of reads per hour | 1918.34 Number of input reads | 4795857 Average input read length | 92 UNIQUE READS: Uniquely mapped reads number | 3948622 Uniquely mapped reads % | 82.33% Average mapped length | 87.54 Number of splices: Total | 1101458 Number of splices: Annotated (sjdb) | 1034912 Number of splices: GT/AG | 1079357 Number of splices: GC/AG | 11982 Number of splices: AT/AC | 882 Number of splices: Non-canonical | 9237 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.14% Deletion average length | 1.09 Insertion rate per base | 0.11% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 110768 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 68154 % of reads mapped to too many loci | 1.42% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.70% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 736467 736467 736467 N_multimapping 110768 110768 110768 N_noFeature 110804 147698 3855733 N_ambiguous 63643 7924 342 UnstrandedReadsAssigned:3774175 PositiveStrandReadsAssigned:3793000 NegativeStrandReadsAssigned:92547 Dataset is classified positive stranded MeadianReadLen=89 20thPercentileLength=66 echo kmer=61 ERR1806553 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806553-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 4,795,857 reads, 3,931,136 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 985 rounds 52973 ERR1806553.ke.tsv 35125 ERR1806553.se.tsv 88098 total ==> ERR1806553.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 88.2072 39.4631 PNS24247 1044 945 5.83333 2.31152 PNS24249 1928 1829 50.782 10.397 PNS24246 1044 945 5.83333 2.31152 PNS24248 1044 945 5.83333 2.31152 PNS24244 1471 1372 34.5108 9.41921 PNS24243 293 194 0 0 KQK14069 1603 1504 966.152 240.553 KQK14071 474 375 117.154 116.987 ==> ERR1806553.se.tsv <== BRADI_1g14170v3 1106 BRADI_1g53295v3 40 BRADI_1g59795v3 58 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 337 BRADI_1g74790v3 106 BRADI_1g09890v3 0 BRADI_1g77505v3 108 BRADI_1g48960v3 2 ERR1806553 completed mapping pipeline successfully