Starting /dee2/code/volunteer_pipeline.sh ERR1806554 current disk space = 1515202465792 free memory = 1602939592 ERR1806554 SRAfilesize 34c5e028d416b974e2e5562e1e4251ae ERR1806554.sra ERR1806554.sra file validated ERR1806554 is single end ERR1806554 is conventional basespace ERR1806554 read1 length is 8-240 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename ERR1806554_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 8-240 %GC 51 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 23.3555 24.0 21.0 26.0 19.0 27.0 2 23.1695 24.0 20.0 26.0 16.0 28.0 3 23.0325 24.0 20.0 26.0 16.0 28.0 4 23.33825 25.0 21.0 27.0 17.0 28.0 5 23.19 25.0 20.0 27.0 16.0 28.0 6 23.166 24.0 20.0 26.0 16.0 28.0 7 23.15225 24.0 20.0 26.0 16.0 28.0 8 23.082 24.0 20.0 27.0 16.0 28.0 9 23.13520280420631 24.0 20.0 27.0 16.0 28.0 10-14 23.274464370218293 24.8 20.4 27.0 16.4 28.0 15-19 23.411771660476482 25.0 21.0 27.0 17.0 28.0 20-24 23.597273456266368 25.0 21.0 27.0 17.4 28.0 25-29 23.60597717778337 25.0 21.0 27.0 17.6 28.0 30-34 23.570439724844263 25.0 21.0 27.0 17.2 28.0 35-39 23.689314295242006 25.0 21.0 27.0 18.0 28.0 40-44 23.71227086273992 25.0 21.0 27.0 17.6 28.0 45-49 23.57299017916903 25.0 21.0 27.0 17.6 28.0 50-54 23.562553045951983 25.0 21.0 27.0 17.0 28.0 55-59 23.632991319433657 25.0 21.0 27.0 18.0 28.0 60-64 23.60714295044108 25.0 21.0 27.0 18.0 28.0 65-69 23.62021354848005 25.0 21.0 26.8 18.0 28.0 70-74 23.615763701515892 25.0 21.0 26.8 17.6 28.0 75-79 23.558215980637517 25.0 21.0 27.0 17.8 28.0 80-84 23.520358297658124 25.0 21.0 26.6 17.4 28.0 85-89 23.560045290304533 25.0 21.0 26.0 17.8 28.0 90-94 23.477696308183827 25.0 21.0 26.2 17.4 28.0 95-99 23.46957587194208 25.0 21.0 26.2 17.4 27.8 100-104 23.45502670159891 25.0 21.0 26.0 17.6 27.6 105-109 23.4195787059087 25.0 21.0 26.0 17.8 27.8 110-114 23.314599029529333 24.6 21.0 26.0 17.4 27.0 115-119 23.268925916853068 24.8 20.6 26.0 17.2 27.0 120-124 23.240774999300598 24.4 20.8 26.0 17.2 27.0 125-129 23.101920585612714 24.4 20.2 26.0 16.8 27.0 130-134 22.99542863476817 24.0 20.2 26.0 17.0 27.2 135-139 22.699498214422572 23.6 20.0 26.0 16.4 27.0 140-144 22.3451930721347 23.2 19.8 26.0 16.2 27.0 145-149 22.33879292377829 23.4 20.0 26.0 16.0 27.0 150-154 22.09038618968137 22.8 19.6 25.4 15.8 26.8 155-159 21.898100089531344 22.8 19.2 25.0 15.0 26.4 160-164 21.683116738778295 22.4 19.2 25.2 14.8 26.6 165-169 21.33374243340049 22.0 19.0 24.8 14.0 26.2 170-174 21.469503603565254 21.8 18.8 24.8 15.4 26.0 175-179 21.18228230581679 22.0 19.0 25.0 14.5 26.0 180-184 20.901416873084386 NaN NaN NaN NaN NaN 185-189 20.51752892644817 NaN NaN NaN NaN NaN 190-194 20.557649572649574 NaN NaN NaN NaN NaN 195-199 19.567308613904096 NaN NaN NaN NaN NaN 200-204 20.084180819180823 NaN NaN NaN NaN NaN 205-209 19.690750773993805 NaN NaN NaN NaN NaN 210-214 18.314761904761905 NaN NaN NaN NaN NaN 215-219 17.34 NaN NaN NaN NaN NaN 220-224 17.5 NaN NaN NaN NaN NaN 225-229 17.4 NaN NaN NaN NaN NaN 230-234 19.383333333333333 NaN NaN NaN NaN NaN 235-239 21.5 NaN NaN NaN NaN NaN 240 22.0 NaN NaN NaN NaN NaN >>END_MODULE >>Per sequence quality scores warn #Quality Count 10 1.0 11 2.0 12 9.0 13 3.0 14 10.0 15 18.0 16 44.0 17 80.0 18 109.0 19 131.0 20 196.0 21 273.0 22 401.0 23 724.0 24 1028.0 25 844.0 26 122.0 27 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.175 44.800000000000004 18.625 12.4 2 42.0 34.925 6.6000000000000005 16.475 3 31.324999999999996 30.9 19.475 18.3 4 36.15 27.200000000000003 16.150000000000002 20.5 5 28.375 29.175 17.575 24.875 6 25.35 28.675 20.3 25.674999999999997 7 23.799999999999997 30.325000000000003 22.925 22.95 8 24.275 26.85 24.7 24.175 9 25.838758137205808 23.610415623435152 23.059589384076116 27.491236855282924 10-14 25.88809499849049 25.09308644460099 24.489282479621615 24.529536077286906 15-19 27.257933279088693 24.87286411716843 22.88445890968267 24.98474369406021 20-24 27.303946694003074 24.59764223475141 22.716555612506404 25.381855458739107 25-29 27.159537094441 25.3151477578012 23.264104153750775 24.261210994007026 30-34 27.13607182003236 24.677697165822853 23.706874053969415 24.479356960175373 35-39 26.769117025771017 24.56696239966202 23.67448246725813 24.98943810730883 40-44 26.767812148179914 24.366053717900606 23.80850265372862 25.057631480190857 45-49 27.119015047879618 24.284541723666212 23.863201094391247 24.733242134062927 50-54 27.134112409571507 24.151363383416804 23.383416805787423 25.331107401224262 55-59 26.221563373054334 24.8246764353726 23.54752266377787 25.4062375277952 60-64 26.670989036897325 24.101143463397385 24.39585052457857 24.832016975126724 65-69 26.8748463240718 23.955003688222277 23.893533316941234 25.27661667076469 70-74 26.173366996827863 24.393086036123517 24.43840227875963 24.99514468828899 75-79 25.789400472944777 24.62790374182779 24.767005146751984 24.81569063847545 80-84 26.50657000453104 24.69415496148618 24.45249962241353 24.34677541156925 85-89 25.29821073558648 24.204771371769386 25.579854208084825 24.91716368455931 90-94 25.409534327259344 24.544450579790173 24.728510951592124 25.317504141358366 95-99 25.964222934546584 24.506255816358184 24.74408023989246 24.78544100920277 100-104 25.528930450029225 24.523670368205728 24.757451782583285 25.18994739918177 105-109 26.073453956251686 24.210099918984607 24.62867944909533 25.087766675668377 110-114 25.573560083426923 24.257981710251887 25.942563773463824 24.225894432857373 115-119 24.851844771554195 25.71210093672338 25.40623207799656 24.029822213725865 120-124 25.605924596050265 24.169658886894073 24.75314183123878 25.471274685816876 125-129 24.860557768924302 24.621513944223107 25.657370517928285 24.860557768924302 130-134 25.296319401122897 24.610106051154084 24.73487211478478 25.35870243293824 135-139 25.380899293942772 22.482348569305092 26.049795615013004 26.08695652173913 140-144 27.91228871630882 23.526724531749657 25.216994061215164 23.34399269072636 145-149 25.0 25.376344086021508 25.483870967741932 24.13978494623656 150-154 24.219247928616955 24.72912683237731 25.940089228808162 25.111536010197575 155-159 24.560061208875286 25.784238714613615 24.560061208875286 25.095638867635806 160-164 27.516158818097875 25.20775623268698 24.284395198522624 22.99168975069252 165-169 24.771689497716896 26.027397260273972 24.65753424657534 24.54337899543379 170-174 24.40828402366864 26.77514792899408 24.85207100591716 23.964497041420117 175-179 28.1496062992126 22.63779527559055 23.818897637795274 25.393700787401574 180-184 24.8062015503876 28.165374677002585 25.839793281653744 21.188630490956072 185-189 21.602787456445995 25.087108013937282 24.738675958188153 28.57142857142857 190-194 29.850746268656714 24.378109452736318 21.393034825870647 24.378109452736318 195-199 27.450980392156865 20.915032679738562 24.18300653594771 27.450980392156865 200-204 28.31858407079646 29.20353982300885 19.469026548672566 23.008849557522122 205-209 24.719101123595504 32.58426966292135 15.730337078651685 26.96629213483146 210-214 26.666666666666668 29.333333333333332 21.333333333333336 22.666666666666664 215-219 29.78723404255319 14.893617021276595 23.404255319148938 31.914893617021278 220-224 32.142857142857146 21.428571428571427 28.57142857142857 17.857142857142858 225-229 20.0 20.0 20.0 40.0 230-234 5.263157894736842 47.368421052631575 15.789473684210526 31.57894736842105 235-239 27.27272727272727 27.27272727272727 18.181818181818183 27.27272727272727 240 100.0 0.0 0.0 0.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 2.0 15 2.5 16 2.5 17 2.5 18 3.5 19 5.5 20 7.0 21 6.5 22 5.5 23 5.5 24 7.5 25 11.5 26 15.0 27 16.5 28 20.0 29 22.0 30 20.5 31 22.0 32 26.5 33 29.5 34 32.0 35 41.5 36 53.0 37 61.5 38 81.5 39 104.16666666666667 40 115.83333333333334 41 132.0 42 148.83333333333334 43 168.5 44 187.0 45 200.83333333333331 46 217.83333333333337 47 219.33333333333334 48 215.66666666666666 49 226.33333333333334 50 230.5 51 222.33333333333334 52 227.66666666666669 53 213.16666666666666 54 187.83333333333331 55 181.5 56 168.5 57 147.0 58 148.0 59 149.83333333333334 60 139.33333333333334 61 153.33333333333334 62 159.83333333333331 63 137.16666666666666 64 110.0 65 93.0 66 90.0 67 86.5 68 76.0 69 66.5 70 57.0 71 49.5 72 40.0 73 27.0 74 19.5 75 14.5 76 11.0 77 9.5 78 8.5 79 6.5 80 3.5 81 2.0 82 2.0 83 2.0 84 2.0 85 1.0 86 0.0 87 0.0 88 0.5 89 1.0 90 1.0 91 1.0 92 1.0 93 1.0 94 1.0 95 1.0 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-154 0.0 155-159 0.0 160-164 0.0 165-169 0.0 170-174 0.0 175-179 0.0 180-184 0.0 185-189 0.0 190-194 0.0 195-199 0.0 200-204 0.0 205-209 0.0 210-214 0.0 215-219 0.0 220-224 0.0 225-229 0.0 230-234 0.0 235-239 0.0 240 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 5-9 8.0 10-14 43.0 15-19 38.0 20-24 26.0 25-29 36.0 30-34 45.0 35-39 44.0 40-44 75.0 45-49 71.0 50-54 64.0 55-59 109.0 60-64 129.0 65-69 149.0 70-74 196.0 75-79 229.0 80-84 222.0 85-89 249.0 90-94 238.0 95-99 226.0 100-104 231.0 105-109 230.0 110-114 225.0 115-119 169.0 120-124 141.0 125-129 124.0 130-134 102.0 135-139 109.0 140-144 78.0 145-149 62.0 150-154 47.0 155-159 57.0 160-164 33.0 165-169 44.0 170-174 35.0 175-179 33.0 180-184 15.0 185-189 23.0 190-194 11.0 195-199 8.0 200-204 7.0 205-209 3.0 210-214 4.0 215-219 6.0 220-224 2.0 225-229 0.0 230-234 1.0 235-239 2.0 240-241 1.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.18884664131812 97.82499999999999 2 0.7097591888466414 1.4000000000000001 3 0.025348542458808618 0.075 4 0.025348542458808618 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025348542458808618 0.22499999999999998 >10 0.025348542458808618 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ACTCCAAGATCATCAACGACAGGGAGACTGGCCGTTCCCGCGGGTTCGGC 15 0.375 No Hit GGATAATCATACCCCGTTCGAGGAGAGCAAGGCGATCGACATCAACCCGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-14 0.0 0.0 0.0 0.0 0.0 15-19 0.0 0.0 0.0 0.0 0.0 20-24 0.0 0.0 0.0 0.0 0.0 25-29 0.0 0.0 0.0 0.0 0.0 30-34 0.0 0.0 0.0 0.0 0.0 35-39 0.0 0.0 0.0 0.0 0.0 40-44 0.0 0.0 0.0 0.0 0.0 45-49 0.0 0.0 0.0 0.0 0.0 50-54 0.0 0.0 0.0 0.0 0.0 55-59 0.0 0.0 0.0 0.0 0.0 60-64 0.0 0.0 0.0 0.0 0.0 65-69 0.0 0.0 0.0 0.0 0.0 70-74 0.0 0.0 0.0 0.0 0.0 75-79 0.0 0.0 0.0 0.0 0.0 80-84 0.0 0.0 0.0 0.0 0.0 85-89 0.0 0.0 0.0 0.0 0.0 90-94 0.0 0.0 0.0 0.0 0.0 95-99 0.0 0.0 0.0 0.0 0.0 100-104 0.0 0.0 0.0 0.0 0.0 105-109 0.0 0.0 0.0 0.0 0.0 110-114 0.0 0.0 0.0 0.0 0.0 115-119 0.0 0.0 0.0 0.0 0.0 120-124 0.0 0.0 0.0 0.0 0.0 125-129 0.0 0.0 0.0 0.0 0.0 130-134 0.0 0.0 0.0 0.0 0.0 135-139 0.0 0.0 0.0 0.0 0.0 140-144 0.0 0.0 0.0 0.0 0.0 145-149 0.0 0.0 0.0 0.0 0.0 150-154 0.0 0.0 0.0 0.0 0.0 155-159 0.0 0.0 0.0 0.0 0.0 160-164 0.0 0.0 0.0 0.0 0.0 165-169 0.0 0.0 0.0 0.0 0.0 170-174 0.0 0.0 0.0 0.0 0.0 175-179 0.0 0.0 0.0 0.0 0.0 180-184 0.0 0.0 0.0 0.0 0.0 185-189 0.0 0.0 0.0 0.0 0.0 190-194 0.0 0.0 0.0 0.0 0.0 195-199 0.0 0.0 0.0 0.0 0.0 200-204 0.0 0.0 0.0 0.0 0.0 205-209 0.0 0.0 0.0 0.0 0.0 210-214 0.0 0.0 0.0 0.0 0.0 215-219 0.0 0.0 0.0 0.0 0.0 220-224 0.0 0.0 0.0 0.0 0.0 225-228 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAACGG 10 0.0 3743.5002 205 GAGTAGT 10 0.0 3743.5002 190-194 TTTTCAT 5 0.0017533884 1871.7501 180-184 CTGAGTA 5 0.002922054 1497.4001 185-189 TAGTGAG 5 0.002922054 1497.4001 190-194 TGAAGCA 5 0.002922054 1497.4001 200-204 GCTGAGT 5 0.002922054 1497.4001 185-189 AGTGAGC 5 0.002922054 1497.4001 190-194 AGCTGAG 5 0.002922054 1497.4001 185-189 AAGCAAC 5 0.002922054 1497.4001 200-204 AGCCAGC 15 0.002630551 1247.8334 165-169 GAAGCAA 10 0.0035067769 1247.8334 200-204 GTTTTCA 15 0.002630551 1247.8334 180-184 GAGCAAC 10 0.0035067769 1247.8334 160-164 TCCACAT 10 0.0035067769 1247.8334 150-154 TCTGCAA 20 0.0046765353 935.87506 180-184 AGCACTT 10 0.007012305 935.87506 145-149 GCTCACT 10 0.007012305 935.87506 145-149 >>END_MODULE Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra Read 363532 spots for ERR1806554.sra Written 363532 spots for ERR1806554.sra SRR ids: ['ERR1806554.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hpg0v4m9 ERR1806554.sra spots: 7270640 blocks: [[1, 363532], [363533, 727064], [727065, 1090596], [1090597, 1454128], [1454129, 1817660], [1817661, 2181192], [2181193, 2544724], [2544725, 2908256], [2908257, 3271788], [3271789, 3635320], [3635321, 3998852], [3998853, 4362384], [4362385, 4725916], [4725917, 5089448], [5089449, 5452980], [5452981, 5816512], [5816513, 6180044], [6180045, 6543576], [6543577, 6907108], [6907109, 7270640]] ERR1806554 file size 1670092 ERR1806554 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o ERR1806554 ERR1806554_1.fastq Input file: ERR1806554_1.fastq trimmed: ERR1806554-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Dec 12 03:12:15 2024 >> started Thu Dec 12 03:12:19 2024 >> done (4.194s) 7270640 reads processed; of these: 124816 ( 1.72%) short reads filtered out after trimming by size control 3 ( 0.00%) empty reads filtered out after trimming by size control 7145821 (98.28%) reads available; of these: 110095 ( 1.54%) trimmed reads available after processing 7035726 (98.46%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12536 0.18% 19 12346 0.17% 20 12083 0.17% 21 12316 0.17% 22 12199 0.17% 23 12068 0.17% 24 13494 0.19% 25 12588 0.18% 26 12765 0.18% 27 13304 0.19% 28 13129 0.18% 29 13331 0.19% 30 14417 0.20% 31 14168 0.20% 32 14471 0.20% 33 15319 0.21% 34 15578 0.22% 35 15431 0.22% 36 16514 0.23% 37 16132 0.23% 38 16612 0.23% 39 18321 0.26% 40 17781 0.25% 41 18498 0.26% 42 21115 0.30% 43 20427 0.29% 44 20750 0.29% 45 23293 0.33% 46 23390 0.33% 47 23714 0.33% 48 26009 0.36% 49 26979 0.38% 50 27382 0.38% 51 30124 0.42% 52 30987 0.43% 53 32014 0.45% 54 35048 0.49% 55 36163 0.51% 56 37536 0.53% 57 40599 0.57% 58 41445 0.58% 59 44194 0.62% 60 48330 0.68% 61 49222 0.69% 62 50104 0.70% 63 54684 0.77% 64 55152 0.77% 65 56191 0.79% 66 59597 0.83% 67 59965 0.84% 68 63158 0.88% 69 66693 0.93% 70 67175 0.94% 71 68673 0.96% 72 73784 1.03% 73 72143 1.01% 74 74879 1.05% 75 76787 1.07% 76 78573 1.10% 77 86085 1.20% 78 89743 1.26% 79 81528 1.14% 80 81050 1.13% 81 83250 1.17% 82 87931 1.23% 83 85145 1.19% 84 86152 1.21% 85 84979 1.19% 86 84431 1.18% 87 87620 1.23% 88 88077 1.23% 89 87480 1.22% 90 91599 1.28% 91 86017 1.20% 92 86494 1.21% 93 91299 1.28% 94 86527 1.21% 95 85571 1.20% 96 86430 1.21% 97 83689 1.17% 98 83756 1.17% 99 84794 1.19% 100 84690 1.19% 101 83486 1.17% 102 81882 1.15% 103 90667 1.27% 104 78949 1.10% 105 77380 1.08% 106 75010 1.05% 107 74263 1.04% 108 74285 1.04% 109 73975 1.04% 110 70410 0.99% 111 71780 1.00% 112 70021 0.98% 113 66277 0.93% 114 67802 0.95% 115 64291 0.90% 116 61850 0.87% 117 62070 0.87% 118 59973 0.84% 119 58472 0.82% 120 58163 0.81% 121 55675 0.78% 122 54103 0.76% 123 52076 0.73% 124 51274 0.72% 125 49808 0.70% 126 48537 0.68% 127 46846 0.66% 128 44942 0.63% 129 44850 0.63% 130 43085 0.60% 131 41702 0.58% 132 40974 0.57% 133 39245 0.55% 134 39006 0.55% 135 37553 0.53% 136 35285 0.49% 137 34612 0.48% 138 35043 0.49% 139 32916 0.46% 140 32113 0.45% 141 30888 0.43% 142 29391 0.41% 143 28575 0.40% 144 27877 0.39% 145 27037 0.38% 146 25842 0.36% 147 25480 0.36% 148 24444 0.34% 149 23278 0.33% 150 23269 0.33% 151 22138 0.31% 152 21141 0.30% 153 20736 0.29% 154 20053 0.28% 155 19760 0.28% 156 18906 0.26% 157 18409 0.26% 158 16911 0.24% 159 16881 0.24% 160 16087 0.23% 161 15324 0.21% 162 15058 0.21% 163 14646 0.20% 164 13924 0.19% 165 13448 0.19% 166 12874 0.18% 167 12437 0.17% 168 11931 0.17% 169 11779 0.16% 170 11062 0.15% 171 10953 0.15% 172 10450 0.15% 173 9892 0.14% 174 9652 0.14% 175 9256 0.13% 176 9063 0.13% 177 8528 0.12% 178 8287 0.12% 179 7843 0.11% 180 7529 0.11% 181 7338 0.10% 182 6949 0.10% 183 6728 0.09% 184 6474 0.09% 185 6169 0.09% 186 6150 0.09% 187 5796 0.08% 188 5502 0.08% 189 5296 0.07% 190 5209 0.07% 191 4737 0.07% 192 4735 0.07% 193 4474 0.06% 194 4283 0.06% 195 4053 0.06% 196 3931 0.06% 197 3838 0.05% 198 3593 0.05% 199 3386 0.05% 200 3324 0.05% 201 3112 0.04% 202 3060 0.04% 203 2804 0.04% 204 2763 0.04% 205 2571 0.04% 206 2351 0.03% 207 2238 0.03% 208 2213 0.03% 209 2121 0.03% 210 2066 0.03% 211 1896 0.03% 212 1857 0.03% 213 1724 0.02% 214 1637 0.02% 215 1565 0.02% 216 1421 0.02% 217 1402 0.02% 218 1322 0.02% 219 1273 0.02% 220 1157 0.02% 221 1041 0.01% 222 1065 0.01% 223 1001 0.01% 224 875 0.01% 225 859 0.01% 226 806 0.01% 227 785 0.01% 228 727 0.01% 229 662 0.01% 230 565 0.01% 231 538 0.01% 232 514 0.01% 233 520 0.01% 234 476 0.01% 235 428 0.01% 236 418 0.01% 237 407 0.01% 238 396 0.01% 239 328 0.00% 240 283 0.00% 241 257 0.00% 242 253 0.00% 243 238 0.00% 244 188 0.00% 245 183 0.00% 246 182 0.00% 247 138 0.00% 248 145 0.00% 249 126 0.00% 250 133 0.00% 251 105 0.00% 252 99 0.00% 253 88 0.00% 254 91 0.00% 255 74 0.00% 256 73 0.00% 257 56 0.00% 258 46 0.00% 259 48 0.00% 260 43 0.00% 261 53 0.00% 262 31 0.00% 263 45 0.00% 264 20 0.00% 265 18 0.00% 266 22 0.00% 267 22 0.00% 268 14 0.00% 269 16 0.00% 270 11 0.00% 271 14 0.00% 272 7 0.00% 273 10 0.00% 274 7 0.00% 275 8 0.00% 276 9 0.00% 277 3 0.00% 278 5 0.00% 279 4 0.00% 280 2 0.00% 281 2 0.00% 282 2 0.00% 283 4 0.00% 284 2 0.00% 285 0 0.00% 286 1 0.00% 287 0 0.00% 288 0 0.00% 289 2 0.00% 290 0 0.00% 291 0 0.00% 292 0 0.00% 293 1 0.00% 294 0 0.00% 295 0 0.00% 296 0 0.00% 297 0 0.00% 298 0 0.00% 299 0 0.00% 300 0 0.00% 301 0 0.00% 302 0 0.00% 303 0 0.00% 304 0 0.00% 305 0 0.00% 306 0 0.00% 307 0 0.00% 308 0 0.00% 309 0 0.00% 310 0 0.00% 311 0 0.00% 312 0 0.00% 313 0 0.00% 314 0 0.00% 315 0 0.00% 316 0 0.00% 317 0 0.00% 318 0 0.00% 319 0 0.00% 320 0 0.00% 321 0 0.00% 322 0 0.00% 323 0 0.00% 324 0 0.00% 325 0 0.00% 326 0 0.00% 327 0 0.00% 328 0 0.00% 329 0 0.00% 330 0 0.00% 331 0 0.00% 332 0 0.00% 333 0 0.00% 334 0 0.00% 335 0 0.00% 336 0 0.00% 337 0 0.00% 338 0 0.00% 339 0 0.00% 340 0 0.00% 341 0 0.00% 342 0 0.00% 343 0 0.00% 344 0 0.00% 345 0 0.00% 346 0 0.00% 347 0 0.00% 348 0 0.00% 349 0 0.00% 350 0 0.00% 351 0 0.00% 352 1 0.00% 7145821 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=25 prefix-density=0.31 prefix-fanout=3.1 sequence=AAGATCCAGGACAAGGAGGGCAT criterion=fanout-score sequence-density=0.09 sequence-density-rank=13 fanout-score=156.84 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=21.3 sequence=CAAGAAGAAGATCG Started job on | Dec 12 03:12:36 Started mapping on | Dec 12 03:12:36 Finished on | Dec 12 03:12:51 Mapping speed, Million of reads per hour | 1715.00 Number of input reads | 7145821 Average input read length | 97 UNIQUE READS: Uniquely mapped reads number | 5634418 Uniquely mapped reads % | 78.85% Average mapped length | 91.29 Number of splices: Total | 1749278 Number of splices: Annotated (sjdb) | 1650718 Number of splices: GT/AG | 1712488 Number of splices: GC/AG | 18887 Number of splices: AT/AC | 1391 Number of splices: Non-canonical | 16512 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.14% Deletion average length | 1.10 Insertion rate per base | 0.14% Insertion average length | 1.29 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 160403 % of reads mapped to multiple loci | 2.24% Number of reads mapped to too many loci | 151750 % of reads mapped to too many loci | 2.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 16.37% % of reads unmapped: other | 0.41% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1351000 1351000 1351000 N_multimapping 160403 160403 160403 N_noFeature 154130 198936 5511463 N_ambiguous 89579 11843 508 UnstrandedReadsAssigned:5390709 PositiveStrandReadsAssigned:5423639 NegativeStrandReadsAssigned:122447 Dataset is classified positive stranded MeadianReadLen=96 20thPercentileLength=70 echo kmer=65 ERR1806554 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in single-end mode [quant] will process file 1: ERR1806554-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,145,821 reads, 5,712,223 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,021 rounds 52973 ERR1806554.ke.tsv 35125 ERR1806554.se.tsv 88098 total ==> ERR1806554.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 837 95.7668 29.6185 PNS24247 1044 945 20.4167 5.59276 PNS24249 1928 1829 40.0219 5.66444 PNS24246 1044 945 20.4167 5.59276 PNS24248 1044 945 20.4167 5.59276 PNS24244 1471 1372 28.9613 5.46433 PNS24243 293 194 0 0 KQK14069 1603 1504 973.04 167.477 KQK14071 474 375 50.3758 34.7747 ==> ERR1806554.se.tsv <== BRADI_1g14170v3 1030 BRADI_1g53295v3 31 BRADI_1g59795v3 80 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 759 BRADI_1g74790v3 120 BRADI_1g09890v3 0 BRADI_1g77505v3 167 BRADI_1g48960v3 0 ERR1806554 completed mapping pipeline successfully